Homologs in group_771

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03555 FBDBKF_03555 70.6 Morganella morganii S1 cadA zinc/cadmium/mercury/lead-transporting ATPase
EHELCC_06980 EHELCC_06980 70.6 Morganella morganii S2 cadA zinc/cadmium/mercury/lead-transporting ATPase
NLDBIP_07305 NLDBIP_07305 70.6 Morganella morganii S4 cadA zinc/cadmium/mercury/lead-transporting ATPase
LHKJJB_06840 LHKJJB_06840 70.6 Morganella morganii S3 cadA zinc/cadmium/mercury/lead-transporting ATPase
HKOGLL_04090 HKOGLL_04090 70.6 Morganella morganii S5 cadA zinc/cadmium/mercury/lead-transporting ATPase
F4V73_RS11345 F4V73_RS11345 69.3 Morganella psychrotolerans - zinc/cadmium/mercury/lead-transporting ATPase

Distribution of the homologs in the orthogroup group_771

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_771

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3YW59 0.0 818 60 4 711 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 0.0 818 60 4 711 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
P30336 8.02e-166 499 38 12 718 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P58414 2.78e-164 495 39 12 710 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P20021 9.14e-162 489 37 12 718 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
Q6GIX1 5.62e-160 484 37 13 718 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P37386 1.68e-158 483 36 13 730 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
Q60048 3.78e-151 461 36 15 714 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
Q59998 6.79e-123 388 34 13 719 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q59465 8.97e-121 381 31 12 707 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
O32219 9.38e-120 379 33 13 712 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
Q9ZL53 1.61e-119 378 32 12 707 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
O31688 8.25e-114 362 36 4 583 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q9RQB4 2.02e-112 359 31 8 691 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q8CN02 7.81e-112 361 30 11 734 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 7.81e-112 361 30 11 734 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P32113 1.61e-111 358 31 12 727 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q4L970 1.03e-108 353 32 14 728 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
O32220 6.3e-107 348 31 13 744 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q2YWA3 1.45e-105 345 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3E6 2.5e-105 344 30 15 735 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 2.5e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 2.5e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 2.5e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 2.5e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUQ9 2.78e-105 344 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 2.78e-105 344 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
A6QK47 3.32e-105 344 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 3.32e-105 344 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 3.32e-105 344 30 15 744 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GDP1 1.18e-104 342 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q4A0G1 1.72e-104 342 31 13 728 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8Z3F8 2.6e-104 342 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 2.6e-104 342 30 15 744 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
P0CW78 7.06e-103 337 32 14 713 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
P9WPS3 7.91e-100 328 34 10 608 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 7.91e-100 328 34 10 608 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A3BF39 7.81e-99 333 32 16 713 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q9CCL1 5.95e-97 320 33 11 602 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q9SZW4 7.99e-96 322 31 17 718 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
B2HEM2 8.37e-96 317 33 9 600 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
P73241 5.43e-95 315 31 23 763 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WPT5 2.13e-94 313 32 15 723 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 2.13e-94 313 32 15 723 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 2.13e-94 313 32 15 723 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P58342 2.87e-94 315 30 17 749 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
A0R3A7 9.68e-94 309 33 10 585 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P58341 2.24e-93 313 29 12 704 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q9X5X3 3.83e-93 312 30 11 691 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P9WPS7 1.35e-92 309 38 7 583 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.35e-92 309 38 7 583 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.35e-92 309 38 7 583 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O29777 2.09e-92 310 32 16 698 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8ZCA7 2.73e-92 313 29 16 759 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8Z8S4 4.09e-92 310 31 18 757 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8ZR95 5.4e-92 309 31 18 757 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O30085 5.59e-92 306 33 7 557 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O64474 1.17e-90 312 31 13 706 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
Q9ZHC7 2.33e-90 305 33 7 557 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q8XD24 2.12e-88 300 29 18 809 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q59385 2.15e-87 297 29 18 809 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q5ZWR1 5.56e-86 291 33 7 549 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9X5V3 8.78e-86 293 33 6 563 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P37279 1.67e-85 290 32 10 557 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9SH30 1.01e-83 290 34 11 531 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
P9WPT3 1.13e-83 283 34 9 540 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 1.13e-83 283 34 9 540 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 1.13e-83 283 34 9 540 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KPZ7 1.04e-81 283 30 11 694 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9S7J8 2.38e-81 283 33 9 561 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
A0A0P0X004 2.93e-81 283 31 10 546 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
P77868 3.49e-81 278 29 13 724 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WPT7 1.15e-79 272 33 8 562 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 1.15e-79 272 33 8 562 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P05425 3.45e-77 267 28 13 636 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O32619 4.34e-77 266 32 9 556 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q8H384 5.09e-77 271 34 9 567 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
P35670 1.31e-75 271 28 22 806 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
A3AWA4 1.73e-75 267 30 8 537 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q6H7M3 4.09e-75 266 32 13 553 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q59467 1.12e-74 260 31 11 556 3 copA Copper-transporting ATPase Helicobacter pylori
O08462 4.79e-74 259 31 11 560 3 copA Copper-transporting ATPase Helicobacter pylori
P07893 2.27e-72 255 27 18 736 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P77871 3.34e-72 254 30 11 563 3 copA Copper-transporting ATPase Helicobacter pylori
Q64446 3.57e-72 261 28 22 801 1 Atp7b Copper-transporting ATPase 2 Mus musculus
P46840 4.33e-72 253 28 15 744 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q64535 5.3e-72 260 27 20 797 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
P37385 7.95e-72 253 27 20 737 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9XT50 1.1e-71 259 28 20 763 2 ATP7B Copper-transporting ATPase 2 Ovis aries
P9WPU1 7.76e-71 250 28 17 736 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 7.76e-71 250 28 17 736 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SZC9 8.62e-71 253 32 8 530 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
Q9ZM69 2.8e-70 248 30 10 558 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P55989 1.12e-69 246 30 11 563 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q69HU0 2.01e-69 244 29 11 596 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
P70705 2.79e-69 252 30 11 579 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
Q6GIX4 7.31e-69 243 29 11 596 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
Q64430 8.26e-69 251 30 12 579 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q8CQF7 4.59e-67 238 28 15 642 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0CW77 4.68e-67 234 30 11 553 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q5HKB0 1.52e-66 236 27 15 642 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8YZ02 3.98e-66 235 27 15 642 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 3.98e-66 235 27 15 642 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
B9DFX7 5.49e-66 239 30 11 552 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P49015 1.09e-65 241 29 15 607 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P9WPT8 9.74e-65 233 29 18 745 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 9.74e-65 233 29 18 745 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4LAB1 1.29e-64 231 27 15 642 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
P9WPT9 2.09e-64 232 29 18 745 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9M3H5 3.12e-64 233 27 13 636 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
P18398 9.14e-62 225 30 12 548 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
O33533 3.59e-60 220 27 18 726 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
O59666 6.56e-58 216 28 10 526 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38995 9.45e-56 210 27 12 543 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P46839 1.69e-55 207 30 6 500 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q59207 2.84e-52 197 26 17 714 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P38360 9.25e-50 193 26 8 542 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4LAI2 3.23e-47 182 28 13 504 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q926K7 1.02e-46 181 28 10 503 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HK64 2.44e-46 179 28 13 504 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 2.44e-46 179 28 13 504 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 2.44e-46 179 28 13 504 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 2.44e-46 179 28 13 504 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8R8I6 6.96e-44 172 28 12 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8YPE9 7.23e-43 169 29 13 508 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q63FR0 1.25e-42 169 30 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
P57700 2.39e-42 167 28 11 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B7II09 4.26e-42 167 30 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
A9VFM1 4.72e-42 167 30 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
B7JRB8 7.16e-42 166 30 16 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
B7HDF9 9.19e-42 166 29 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
Q9R6X1 1.06e-41 166 28 11 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
O32328 1.12e-41 166 27 12 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q81HQ0 1.17e-41 166 30 21 520 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HWG1 1.25e-41 166 30 21 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
C1EYK0 1.42e-41 165 29 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
C3LF99 1.47e-41 166 29 18 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q6HN78 1.98e-41 165 30 21 520 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0RA13 2.41e-41 165 30 21 520 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q6GEZ7 2.97e-41 164 29 15 497 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q8NVI2 3.02e-41 164 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 3.02e-41 164 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
A8Z4X9 4.03e-41 164 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 4.03e-41 164 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 4.03e-41 164 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
P63684 4.03e-41 164 29 15 497 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 4.03e-41 164 29 15 497 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUH7 6e-41 163 29 15 497 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q93MV5 7.47e-41 163 29 12 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q8YSD5 5.7e-40 160 28 12 494 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P59219 7.73e-40 160 28 12 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q9RZP0 1e-39 160 29 8 456 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9X8Z9 1.81e-39 159 28 15 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q72TM6 9.2e-39 157 28 12 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A7GLG4 9.63e-39 157 28 17 508 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q57RN0 2.25e-38 155 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
Q04656 4e-38 157 31 6 317 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 1.56e-26 120 40 3 176 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
P73867 6.4e-38 154 30 15 499 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8PCM1 6.43e-38 154 31 12 489 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B2V2P3 6.79e-38 154 28 9 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
Q98GX6 1.06e-37 154 29 10 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B2TTJ7 1.3e-37 153 29 17 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P9WPU3 1.32e-37 154 28 15 525 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 1.32e-37 154 28 15 525 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 1.32e-37 154 28 15 525 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8PPC9 1.42e-37 153 30 12 499 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q9A7X7 1.45e-37 153 29 10 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8KU73 1.72e-37 153 27 9 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
B1LLE1 2.67e-37 152 30 18 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
Q92XJ0 3.1e-37 152 28 15 563 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
B4U8E4 3.69e-37 152 28 10 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q324L0 5.89e-37 151 30 17 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
B2TMJ2 7.11e-37 151 27 11 503 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q3Z4A6 7.13e-37 151 28 15 536 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
Q0TRT3 7.65e-37 151 28 12 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B5R670 7.76e-37 151 28 16 539 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7NMQ0 8.71e-37 151 29 17 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A7ZXV8 1.05e-36 150 29 17 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B1IY32 1.09e-36 150 29 18 549 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M5L3 1.09e-36 150 29 18 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 1.09e-36 150 29 18 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B4SZB1 1.11e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
P03960 1.17e-36 150 29 18 549 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 1.17e-36 150 29 18 549 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 1.17e-36 150 29 18 549 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B5YQN9 1.17e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 1.17e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
B7LKR7 1.32e-36 150 28 15 536 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4TBA6 1.36e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 1.36e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B7N9U0 1.36e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5BCA4 1.38e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 1.38e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MUE0 1.44e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FNE0 1.44e-36 150 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B6HYQ5 1.62e-36 150 29 18 549 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 1.62e-36 150 29 18 549 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TQ22 1.79e-36 150 29 11 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
Q8FJV4 1.87e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 1.87e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 1.87e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8ZQW2 1.89e-36 150 29 11 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7MPK0 1.89e-36 150 30 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
A6T6D8 4.89e-36 149 29 14 532 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5EZE3 5.26e-36 148 29 11 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
Q1REM0 1.32e-35 147 29 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 1.32e-35 147 29 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 1.32e-35 147 29 16 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XZE9 1.46e-35 147 28 14 532 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
A4SZG8 2.11e-35 147 28 13 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8XU11 5.25e-35 146 28 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7N6W6 2.3e-34 144 28 11 476 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q97BF6 5.62e-34 142 26 13 509 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q8U9D9 6.64e-34 142 29 13 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
A4W860 5.07e-33 139 28 12 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
Q9CFU9 5.58e-33 140 24 16 640 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
P57699 1.19e-32 138 25 11 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 1.19e-32 138 25 11 496 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A8GB61 1.28e-32 138 27 11 479 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
Q8Y3Z7 1.75e-32 137 28 14 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P57698 1.82e-32 137 28 10 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C4LDL7 3.46e-32 137 27 11 509 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0AM16 3.55e-32 137 28 14 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q927G0 3.99e-32 136 28 14 513 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DAW1 5.5e-32 136 28 14 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q71W90 6.35e-32 136 28 14 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 6.35e-32 136 28 14 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
Q47H39 1.14e-31 135 28 11 503 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
B2VJK3 1.42e-30 132 27 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4TL06 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 1.8e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
Q667S4 2.09e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
B1JR96 2.11e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 2.11e-30 131 28 12 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P07038 6.06e-30 130 24 19 594 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1JQS2 2.72e-29 128 27 11 476 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P05030 3.95e-29 128 25 23 618 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q58623 1.84e-28 125 25 18 615 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P47317 3.16e-28 125 23 17 564 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P19456 6.63e-27 121 25 16 547 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
P20431 1.73e-26 120 26 16 547 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P98194 1.9e-26 119 23 19 660 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P24545 8.68e-26 117 24 22 607 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
P19657 8.95e-26 117 24 23 618 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5R5K5 1.25e-25 117 23 19 659 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q9SU58 1.69e-25 117 24 15 530 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
P54679 2.26e-25 116 25 23 618 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
P28877 3.81e-25 115 24 21 593 1 PMA1 Plasma membrane ATPase 1 Candida albicans
Q08436 3.88e-25 115 26 16 530 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
Q03194 4e-25 115 25 16 549 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q80XR2 4.58e-25 115 23 17 622 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q08435 4.78e-25 115 26 16 532 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P78036 5.01e-25 115 23 15 566 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7XPY2 6.32e-25 115 25 16 549 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P49380 6.39e-25 114 24 21 615 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P83970 7.45e-25 114 25 16 549 2 ha1 Plasma membrane ATPase Triticum aestivum
Q9SJB3 8.54e-25 114 24 16 550 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P20649 8.77e-25 114 24 16 547 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P22180 9.06e-25 114 26 16 530 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q42556 1.79e-24 113 25 15 527 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P57709 1.92e-24 113 22 19 660 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P36640 2.18e-24 113 24 19 586 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 2.18e-24 113 24 19 586 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
P0ABB8 4.04e-24 112 24 18 584 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 4.04e-24 112 24 18 584 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
Q9LV11 4.78e-24 112 25 16 530 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9SH76 5.17e-24 112 24 15 526 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q64566 5.23e-24 112 22 18 660 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P35597 1.75e-23 110 23 14 535 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q43128 5.38e-23 108 24 15 528 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9M2A0 8.08e-23 108 25 16 528 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q07421 1.87e-22 107 23 20 628 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
Q9LY32 6.16e-22 105 24 14 518 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
A0R3Y2 8.15e-22 104 25 15 501 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P37278 1.64e-20 100 29 8 282 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.96e-11 70 30 3 171 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P9WPT0 2.86e-20 99 24 11 504 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 2.89e-20 99 24 11 504 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 2.89e-20 99 24 11 504 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Z8E5 3.1e-20 99 30 5 281 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 1.99e-06 55 45 0 61 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q73E41 2.27e-19 97 27 11 313 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 2.19e-14 81 32 5 193 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P28876 9.23e-19 95 24 25 631 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O43108 2.08e-18 94 26 3 269 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 2.79e-13 77 28 5 207 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P09627 4.91e-18 92 23 24 632 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P11718 1.94e-17 90 24 17 563 2 H1A Probable proton ATPase 1A Leishmania donovani
P12522 4.57e-17 89 24 16 561 2 H1B Probable proton ATPase 1B Leishmania donovani
P54210 1.09e-16 88 23 19 602 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
P9WPS9 1.29e-16 88 26 11 391 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 1.76e-06 55 29 3 172 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.29e-16 88 26 11 391 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 1.76e-06 55 29 3 172 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.29e-16 88 26 11 391 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 1.76e-06 55 29 3 172 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54211 2.61e-16 87 22 19 624 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
Q9XES1 2.64e-16 87 27 11 300 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 9.75e-11 69 29 8 216 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P92939 3.16e-16 87 27 11 300 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 1.51e-10 68 29 8 216 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
O59868 3.75e-16 86 25 7 303 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 3.94e-11 70 28 7 213 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P22036 5.27e-16 86 23 26 650 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34431 2.07e-15 84 24 9 357 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 2.82e-09 64 27 4 209 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
P06687 2.12e-15 84 27 6 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 2.03e-06 55 26 5 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 2.12e-15 84 27 6 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 2.03e-06 55 26 5 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 2.23e-15 84 27 6 259 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 1.87e-06 55 26 5 196 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P23980 3.75e-15 83 26 12 377 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
P24797 3.78e-15 83 25 5 243 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 1.73e-05 52 24 5 196 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
Q08853 5.26e-15 83 25 7 272 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 2.27e-09 65 39 4 109 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P05025 6.06e-15 82 25 5 251 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 0.001 46 24 6 197 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
A7L9Z8 7.52e-15 82 24 7 308 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 1.03e-06 56 24 6 207 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
Q6RWA9 7.67e-15 82 29 9 265 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 3.89e-06 54 26 6 220 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q8R4C1 7.78e-15 82 24 7 308 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 5.23e-07 57 24 6 207 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
P58312 9.73e-15 82 25 5 243 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 0.000596 47 37 1 67 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P13586 1.01e-14 82 23 4 282 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 9.46e-10 66 26 4 213 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9YGL9 1.27e-14 82 29 7 215 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 1.81e-13 78 26 10 282 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P24798 1.38e-14 81 25 6 259 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 2.56e-06 55 26 5 196 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P17326 2.7e-14 80 24 7 288 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 8.97e-05 50 25 6 215 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P20648 2.73e-14 80 28 8 251 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 4.67e-06 54 25 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
Q64436 3.35e-14 80 28 8 251 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 3.38e-06 54 25 5 196 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
P35315 3.43e-14 80 29 6 254 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 1.25e-12 75 29 5 215 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P09626 3.65e-14 80 28 8 251 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.41e-06 54 25 5 196 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
Q5RCD8 3.95e-14 80 24 5 243 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 5.86e-06 53 25 5 196 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
P50993 4.49e-14 80 24 5 243 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 7.44e-06 53 25 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P30714 5.47e-14 79 25 5 243 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 0.000597 47 24 8 221 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P04074 5.61e-14 79 25 5 243 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 0.000255 48 24 6 197 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q08DA1 6.06e-14 79 25 5 251 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 0.000255 48 24 6 197 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P05024 6.11e-14 79 25 5 240 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P18907 6.43e-14 79 25 5 240 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 4.58e-06 54 26 5 196 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P05023 6.5e-14 79 25 5 243 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
Q8VDN2 6.72e-14 79 25 5 243 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q4WHC8 6.89e-14 79 32 5 204 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 3.13e-06 54 26 6 237 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P06686 7.13e-14 79 24 5 243 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 7.13e-14 79 24 5 243 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q5RDR3 7.26e-14 79 25 5 243 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q92030 7.32e-14 79 25 5 251 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P06685 7.45e-14 79 25 5 243 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P50997 7.51e-14 79 24 4 241 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
D2WKD8 7.9e-14 79 23 5 243 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 1.84e-05 52 24 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
A2VDL6 7.97e-14 79 23 5 243 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 1.85e-05 52 24 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
Q9TV52 8.08e-14 79 24 5 257 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 1.17e-05 52 24 6 215 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P04191 8.9e-14 79 28 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 1.12e-10 69 25 9 290 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
Q9N0Z6 1.13e-13 79 25 6 259 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P37367 1.14e-13 79 27 6 281 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 2.85e-10 67 29 4 171 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O23087 1.15e-13 79 26 9 288 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 1.03e-08 62 27 9 220 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
P22700 1.22e-13 79 30 9 216 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 1.52e-12 75 24 10 336 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q13733 1.27e-13 78 25 5 243 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 0.000877 46 35 1 67 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
P54209 1.38e-13 78 27 7 274 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P54209 4.77e-10 67 29 8 224 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
Q8R429 1.46e-13 78 28 6 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 4.68e-11 70 25 9 287 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64578 1.53e-13 78 28 6 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 4.64e-11 70 25 9 287 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q8Y8Q5 1.54e-13 78 26 7 291 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 4.74e-13 76 30 4 205 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P27112 1.56e-13 78 27 8 251 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 4.75e-06 54 25 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P19156 1.58e-13 78 28 8 251 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 4.75e-06 54 25 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P09572 1.68e-13 78 25 6 259 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 1.25e-05 52 26 5 196 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
O14983 1.86e-13 78 28 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 6.72e-11 69 25 9 287 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
P54707 1.92e-13 78 24 5 254 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 2.87e-05 51 24 6 215 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
Q4WND5 1.96e-13 78 29 9 242 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 9.26e-11 69 26 7 281 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9YH26 2.43e-13 77 25 5 243 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 2.97e-06 54 26 5 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q0VCY0 2.74e-13 77 28 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 1.07e-10 69 25 9 289 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q64392 3.1e-13 77 24 5 254 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 5.65e-07 57 25 6 215 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q7PPA5 3.16e-13 77 26 8 290 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 5.27e-13 76 30 9 216 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
O77696 3.44e-13 77 29 7 216 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 4.61e-11 70 26 9 284 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
P28774 3.56e-13 77 25 5 246 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 0.001 46 37 2 85 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q03669 4.23e-13 77 30 8 216 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 1.19e-11 72 27 10 291 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P50996 4.4e-13 77 27 8 253 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 5.18e-06 53 25 5 196 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
Q64541 5.67e-13 76 24 5 243 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q9SY55 5.79e-13 76 28 6 209 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 1.18e-12 75 25 7 301 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
O75185 5.89e-13 76 25 6 255 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 3.98e-08 60 23 6 205 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
P13607 6.88e-13 76 25 5 246 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 0.000354 48 23 5 198 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13585 7.1e-13 76 28 8 216 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 1.16e-10 68 26 9 289 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
Q92126 8.2e-13 76 24 6 296 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 1.46e-05 52 25 4 196 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q9T0E0 8.61e-13 75 22 10 467 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
Q93084 9.04e-13 75 30 7 215 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 6.22e-11 70 26 9 284 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
P16615 9.05e-13 75 29 8 216 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 2.99e-12 74 27 9 290 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
Q92105 9.33e-13 75 27 8 230 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q92105 8.05e-12 72 26 9 290 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q9Z1W8 9.5e-13 75 21 5 279 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 6.83e-05 50 24 6 215 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q292Q0 1.02e-12 75 29 9 216 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 2.04e-12 74 27 9 286 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
P20647 1.03e-12 75 29 8 216 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 4.14e-12 73 27 9 290 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
Q64518 1.29e-12 75 29 7 216 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 1.58e-11 72 26 9 285 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P35317 1.35e-12 75 24 4 241 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 0.000104 49 38 2 85 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P18596 1.45e-12 75 29 7 216 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 3.89e-11 70 26 9 284 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P70083 1.55e-12 75 28 7 217 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 6e-11 70 25 9 293 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
Q9WV27 1.67e-12 75 23 5 243 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
P11507 1.89e-12 75 29 8 216 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 3.87e-12 73 27 9 290 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
O55143 1.92e-12 74 29 8 216 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 3.21e-12 74 27 9 290 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
P11607 1.97e-12 74 29 9 216 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 3.49e-12 73 27 9 290 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q00779 2.33e-12 74 28 7 216 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 3.8e-12 73 27 9 290 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
O46674 2.39e-12 74 29 8 216 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 3.96e-12 73 27 9 290 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q2QMX9 2.68e-12 74 29 6 214 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 1.05e-08 62 25 7 231 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q37145 3.29e-12 73 29 8 214 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 1.14e-07 59 24 7 225 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q7XB51 4.12e-12 73 26 9 298 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 3.29e-09 64 27 7 217 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
P35316 4.44e-12 73 27 9 291 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 1.23e-11 72 29 9 216 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
Q9M2L4 4.64e-12 73 29 7 214 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2L4 1.58e-09 65 25 7 231 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q92036 6.35e-12 73 24 6 265 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 0.000159 49 24 6 197 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q2RAS0 6.97e-12 73 25 6 225 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 5.32e-11 70 29 6 215 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
P54708 7.02e-12 73 21 6 285 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 4.82e-05 50 24 6 215 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q92123 7.11e-12 73 24 5 243 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 4.28e-06 54 25 6 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q2QY12 7.79e-12 72 25 6 225 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 2.52e-10 68 28 5 215 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
O22218 1.01e-11 72 29 6 213 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 3.08e-09 64 24 7 231 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q6ATV4 1.17e-11 72 28 7 214 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 4.09e-09 63 26 7 237 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
P25489 1.35e-11 72 25 5 243 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 0.000739 47 24 5 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q8RUN1 1.54e-11 72 29 7 215 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 1.27e-06 55 25 8 227 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
O81108 2.15e-11 71 28 6 214 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 3.14e-10 67 27 8 225 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O13397 4.83e-11 70 27 7 218 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
O64806 4.88e-11 70 28 6 214 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 5.48e-09 63 27 7 225 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q42883 6.9e-11 69 25 10 327 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 6.51e-09 63 27 8 218 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q9HDW7 9.94e-11 69 29 9 218 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 0.000147 49 23 6 242 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
C1L360 1.4e-10 68 28 8 246 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 1.85e-07 58 27 4 179 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
O13398 3.44e-10 67 28 7 212 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 7.84e-07 56 25 11 273 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
D3K0R6 6.41e-10 66 26 5 230 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
Q7XEK4 6.71e-10 66 27 8 237 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 0.000652 47 24 6 241 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
G5E829 8.23e-10 66 27 6 228 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 8.44e-10 66 26 5 223 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
Q7X8B5 9.19e-10 66 28 9 226 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q9LIK7 1.1e-09 65 27 8 231 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 0.000137 49 23 8 256 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q64542 1.33e-09 65 27 7 228 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
O53114 1.57e-09 65 30 4 183 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
O53114 1.27e-07 59 27 7 237 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
P23220 1.91e-09 65 26 6 228 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P20020 1.93e-09 65 26 6 228 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
Q64568 2.05e-09 65 26 5 223 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q16720 2.07e-09 65 26 5 223 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
Q9LY77 2.1e-09 65 27 8 238 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
P38929 2.11e-09 65 28 6 216 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WPS4 2.59e-09 65 29 4 185 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 2.97e-08 61 29 7 233 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A143ZZK9 2.62e-09 64 25 9 296 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
Q9R0K7 2.63e-09 64 26 8 250 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q65X71 2.71e-09 64 26 5 215 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 1.28e-06 55 26 11 286 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P9WPS5 2.78e-09 64 29 4 185 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 3.26e-08 61 29 7 233 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P11506 2.94e-09 64 26 8 250 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q01814 3.04e-09 64 26 8 250 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
Q9LF79 3.26e-09 64 27 9 227 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q98SH2 3.67e-09 64 26 5 223 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q6Q477 4.87e-09 63 26 5 223 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q9LU41 5.7e-09 63 26 7 226 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
P23634 5.76e-09 63 26 6 230 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P13587 1.38e-08 62 26 7 223 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13587 9.23e-05 50 38 1 75 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 1.64e-08 62 26 7 223 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 9.47e-05 50 38 1 75 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 1.74e-08 62 26 7 223 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 0.000102 49 38 1 75 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54678 2.03e-08 62 30 4 145 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
B9QMJ0 3.57e-08 61 28 4 183 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
B9QMJ0 1.06e-06 56 25 5 269 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
G5EFR6 5.66e-08 60 26 6 223 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
Q9SZR1 9.86e-08 59 25 8 243 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
P22189 9.94e-08 59 26 5 168 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q27533 1.04e-07 59 24 13 380 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
Q00804 1.36e-07 59 26 6 228 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
J9VQQ3 7.01e-07 57 26 7 223 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P58165 1.21e-06 56 25 6 235 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P42962 0.000152 47 32 4 115 1 ycsE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YcsE Bacillus subtilis (strain 168)
Q5XF89 0.000695 47 39 1 61 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
Q95JN5 0.000764 47 39 1 61 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17915
Feature type CDS
Gene -
Product zinc/cadmium/mercury/lead-transporting ATPase
Location 3937417 - 3939759 (strand: -1)
Length 2343 (nucleotides) / 780 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_771
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01534 Zn2+/Cd2+-exporting ATPase [EC:7.2.2.12 7.2.2.21] - -

Protein Sequence

MSKHAHQHDNHKHTDACCSSSQCCSNQADNSSMHSHTESGHTHSKIDKSDPECEEEHDHAHGCCDSNAPVSNVEPEKIAQQRFSWKVQGMDCPSCAQKIETAVLKVVGVKQAKILFATEKLVVDADTDLRTDVISAVKSAGFELFDISSAGSQPPAKQSLLKESSFVIILAILMAISWGAEFIDPQAGRAAFIATTLIGLFPIVKKSLRLIRSGTPFAIETLMSVAAIGALFINATEEAAMVILLFMIGEMLESYAAGRARRGVSALMALVPEEAVVIKEGKKQTVPVAQLRPGDIIEIAPGARLPTDAELITAFASFDESALTGESVPVERLQGEKVAAGCLSVDRSVQMKVVSEQGQNAIDRILQLIEEAEERKAPIERFVDRFSRYYTPLIMLFSALVIIIPPLLFAQPWETWFYRGLTLLLIGCPCALVISTPAAITSALAAATKRGALIKGGAALEQLGTVNTVALDKTGTLTEGKPQVTDVIANVGFNEKELLMLASSVEVGSHHPLAKAIINKAQEQQIDVVEADNRKALAGKGIEGYLNNQHILVSAPTQLSETTPLSAQWQQQVARLEDEGKTVVVVLKEDQFIGVIAMQDTLRNDAIESMKVLKSMNINAVMLTGDNPRAAAAIAQKLGMDFRAGLLPEDKVTSVMEISQTHNTMMVGDGINDAPAMKAATIGVAMGSGTDVALETADAALTHNRLTGLPEIIQLSRATRKIIRENITIALGLKAIFLVTSLFGITGLWVAVLADSGATALVTANAVRLLKVKLKSPHQD

Flanking regions ( +/- flanking 50bp)

AAAGTATCGGTAATTGATAAAACTGTACTTTGTTGAACGAGGAGAGGCGTATGTCTAAACACGCTCATCAACACGATAACCATAAACATACCGATGCTTGCTGTTCAAGCTCTCAATGCTGCTCTAATCAGGCAGATAATAGTAGTATGCACTCACATACTGAAAGTGGACACACTCATAGCAAAATCGATAAGAGTGATCCCGAATGTGAAGAAGAACATGATCATGCCCATGGCTGTTGTGACAGCAACGCCCCTGTCTCTAATGTAGAGCCTGAAAAAATTGCACAGCAACGTTTTAGTTGGAAAGTGCAAGGAATGGATTGCCCAAGCTGCGCGCAAAAGATAGAGACAGCAGTACTGAAAGTGGTCGGCGTTAAACAAGCGAAGATCTTGTTTGCCACTGAAAAACTGGTTGTCGATGCCGATACCGATTTACGTACTGATGTGATTAGTGCCGTTAAAAGTGCCGGTTTTGAACTATTTGATATCTCATCAGCGGGATCTCAGCCTCCTGCAAAACAAAGCCTCTTAAAAGAGAGCTCATTCGTCATTATCTTAGCGATTTTAATGGCGATAAGTTGGGGTGCCGAGTTTATTGATCCACAAGCAGGTCGCGCTGCCTTTATTGCAACGACATTAATCGGGTTATTCCCTATTGTAAAAAAATCACTACGACTCATTCGTAGTGGTACCCCATTCGCGATTGAAACCTTGATGAGTGTTGCGGCTATTGGGGCACTGTTTATTAATGCCACCGAAGAAGCGGCAATGGTAATTTTGCTGTTTATGATTGGCGAAATGCTTGAGTCTTATGCTGCGGGTCGTGCACGCCGCGGAGTCAGCGCATTAATGGCTCTTGTACCTGAAGAAGCGGTAGTAATAAAAGAGGGTAAAAAACAGACAGTCCCTGTAGCTCAATTGCGCCCCGGCGATATTATTGAAATTGCACCAGGTGCGCGCTTACCCACAGATGCCGAATTAATTACTGCTTTTGCAAGTTTTGATGAAAGCGCATTAACGGGTGAATCGGTGCCGGTCGAACGTTTACAAGGTGAAAAAGTCGCTGCTGGCTGTTTATCTGTTGATCGCTCGGTGCAAATGAAAGTGGTCTCTGAACAGGGGCAAAATGCCATCGACCGTATTTTACAACTGATCGAAGAAGCGGAAGAGCGTAAAGCGCCCATTGAACGTTTTGTTGACCGTTTCAGTCGCTATTACACACCACTGATTATGCTGTTTTCCGCATTAGTGATCATTATTCCACCTTTGTTATTCGCTCAACCTTGGGAAACTTGGTTCTACCGTGGTTTAACACTGTTATTAATTGGTTGTCCTTGTGCTCTGGTTATTTCAACACCAGCCGCCATTACATCAGCACTGGCAGCAGCAACAAAACGAGGTGCCTTAATTAAAGGTGGTGCAGCACTTGAACAACTGGGCACAGTCAATACCGTTGCTCTAGATAAAACAGGCACATTAACAGAGGGTAAACCTCAAGTCACTGATGTCATAGCAAATGTAGGCTTTAATGAGAAAGAGCTACTGATGTTGGCTTCTTCTGTAGAAGTTGGCTCTCATCACCCTCTCGCAAAAGCCATTATTAATAAAGCACAAGAGCAACAAATTGATGTTGTGGAAGCCGATAATCGCAAGGCTTTAGCGGGTAAAGGGATTGAAGGTTATTTAAATAATCAGCATATTCTGGTCAGTGCCCCAACACAATTATCAGAAACCACACCATTATCTGCACAATGGCAACAACAAGTCGCTCGTCTTGAAGATGAAGGCAAAACCGTTGTCGTGGTATTAAAAGAAGATCAGTTCATTGGTGTGATTGCGATGCAAGATACATTGCGCAACGATGCTATCGAATCAATGAAAGTGTTGAAATCGATGAATATCAATGCCGTGATGTTAACCGGTGATAACCCAAGAGCAGCGGCTGCGATTGCACAAAAACTGGGTATGGATTTCCGTGCAGGATTGCTCCCTGAAGATAAAGTCACCTCAGTGATGGAAATCAGTCAAACACATAACACAATGATGGTGGGTGATGGTATTAATGATGCACCAGCAATGAAAGCGGCTACCATTGGTGTTGCGATGGGAAGTGGTACAGATGTCGCCTTAGAAACTGCCGACGCAGCATTAACCCATAATCGTTTAACTGGCTTACCCGAAATTATTCAGCTATCTCGTGCAACACGTAAAATTATACGTGAAAACATTACCATAGCATTGGGTTTAAAAGCGATATTCTTAGTCACCAGTTTATTCGGTATCACTGGACTTTGGGTTGCCGTATTGGCTGACTCAGGAGCAACAGCTTTAGTGACCGCCAATGCCGTAAGACTATTAAAAGTTAAACTAAAATCTCCTCACCAAGATTAAACTAACCTAAAAATAAAACCCAAACCACAGTCATTGCTATGGTTTGGGTT