Homologs in group_841

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03555 FBDBKF_03555 87.1 Morganella morganii S1 cadA zinc/cadmium/mercury/lead-transporting ATPase
EHELCC_06980 EHELCC_06980 87.1 Morganella morganii S2 cadA zinc/cadmium/mercury/lead-transporting ATPase
NLDBIP_07305 NLDBIP_07305 87.1 Morganella morganii S4 cadA zinc/cadmium/mercury/lead-transporting ATPase
LHKJJB_06840 LHKJJB_06840 87.1 Morganella morganii S3 cadA zinc/cadmium/mercury/lead-transporting ATPase
HKOGLL_04090 HKOGLL_04090 87.1 Morganella morganii S5 cadA zinc/cadmium/mercury/lead-transporting ATPase
PMI_RS17915 PMI_RS17915 69.3 Proteus mirabilis HI4320 - zinc/cadmium/mercury/lead-transporting ATPase

Distribution of the homologs in the orthogroup group_841

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_841

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3YW59 0.0 822 61 4 718 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 0.0 817 61 4 718 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q6GIX1 2.72e-162 491 37 12 715 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P37386 1.52e-159 486 37 13 718 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
P20021 2e-158 481 36 13 718 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P30336 2.55e-156 475 37 12 710 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P58414 3.41e-156 474 37 13 712 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q60048 1.64e-143 442 35 13 709 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
Q59465 2.82e-131 409 32 12 708 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZL53 3.34e-130 407 34 12 699 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q59998 2.05e-126 398 35 13 716 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32219 9.31e-120 380 33 13 707 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
O32220 1.95e-115 371 33 17 738 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
P32113 4.64e-115 368 32 11 690 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O31688 2.76e-114 363 36 4 584 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q9RQB4 2.03e-113 362 32 16 704 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q4A0G1 9.39e-107 348 31 15 726 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A3E6 3.25e-106 347 31 16 724 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 3.25e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 3.25e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 3.25e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 3.25e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUQ9 5.1e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 5.1e-106 347 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q8CN02 3.12e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 3.12e-105 344 30 15 735 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6QK47 4.16e-105 344 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 4.16e-105 344 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 4.16e-105 344 31 16 724 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GDP1 6.32e-105 343 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A8Z3F8 7.09e-105 343 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 7.09e-105 343 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2YWA3 1.95e-104 342 31 16 724 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WPS3 1.61e-101 334 35 8 608 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 1.61e-101 334 35 8 608 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4L970 3.26e-99 328 30 19 769 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q9CCL1 1.77e-98 324 35 12 606 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
P58341 2.14e-98 327 32 15 708 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
A3BF39 4.06e-97 328 31 12 697 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
P58342 7.57e-95 317 31 14 705 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
B2HEM2 6.84e-94 312 35 13 602 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
P9WPS7 1.24e-93 313 38 10 631 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.24e-93 313 38 10 631 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.24e-93 313 38 10 631 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8ZCA7 1.68e-93 317 31 20 762 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q9SZW4 1.84e-93 316 31 19 712 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
P0CW78 2.29e-93 311 31 12 619 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q9X5X3 5.25e-93 312 31 15 705 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P9WPT5 5.94e-93 310 35 14 601 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 5.94e-93 310 35 14 601 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 5.94e-93 310 35 14 601 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3A7 4.43e-92 305 35 10 585 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O30085 1.08e-91 305 32 13 640 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O64474 1.14e-91 315 31 10 623 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
Q8ZR95 1.48e-91 308 32 17 738 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O29777 1.65e-91 308 31 18 712 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8Z8S4 5.2e-91 307 32 17 738 3 copA Copper-exporting P-type ATPase Salmonella typhi
P37279 5.49e-91 305 30 13 711 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P73241 1.29e-89 301 31 20 713 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9ZHC7 2.48e-88 300 30 15 697 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q8XD24 2.08e-87 297 31 17 745 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q59385 2.53e-87 297 31 17 745 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q5ZWR1 5.63e-83 283 30 20 758 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9X5V3 7.14e-83 285 34 12 598 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
A0A0P0X004 6.48e-82 286 33 8 543 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
P9WPT7 3.86e-81 276 36 8 562 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 3.86e-81 276 36 8 562 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P77868 7.28e-81 277 29 17 732 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9S7J8 1.8e-80 281 30 19 725 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
A3AWA4 2.07e-80 281 34 10 527 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q6H7M3 8.17e-80 279 33 12 553 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
P9WPT3 2.07e-79 271 36 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 2.07e-79 271 36 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 2.07e-79 271 36 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9SH30 2.37e-78 276 33 8 531 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
O32619 4.11e-78 270 26 12 701 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
P35670 4.28e-77 276 30 22 765 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
Q8H384 2.15e-75 267 33 9 569 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q64446 1.35e-74 268 29 23 761 1 Atp7b Copper-transporting ATPase 2 Mus musculus
P37385 1.24e-73 259 27 14 730 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P05425 1.25e-73 258 29 16 651 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q64535 1.51e-73 265 28 19 760 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
P07893 2.39e-73 258 27 14 730 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9XT50 7.5e-73 263 28 20 766 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9KPZ7 1.04e-72 258 32 6 502 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q59467 5.53e-72 253 26 18 712 3 copA Copper-transporting ATPase Helicobacter pylori
P70705 1.1e-71 260 31 13 578 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
B9DFX7 3.42e-71 254 30 9 552 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
Q64430 6.92e-71 257 31 14 578 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q9SZC9 8.98e-71 254 33 10 531 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
O08462 1.36e-70 249 26 17 716 3 copA Copper-transporting ATPase Helicobacter pylori
P77871 2.54e-70 249 26 17 716 3 copA Copper-transporting ATPase Helicobacter pylori
Q9ZM69 4.2e-70 248 26 15 713 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q4LAB1 3.04e-69 244 29 13 651 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q5HKB0 4.98e-69 244 29 13 651 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQF7 1.19e-68 243 28 12 650 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P55989 2.04e-68 243 26 17 717 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
A8YZ02 5.05e-68 241 28 12 650 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 5.05e-68 241 28 12 650 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
P9WPU1 3.87e-67 240 30 16 732 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 3.87e-67 240 30 16 732 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46840 6.09e-66 237 29 18 747 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q69HU0 4.79e-64 230 29 6 502 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
Q6GIX4 1.73e-63 228 29 6 502 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
P49015 1.02e-62 233 29 15 613 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P9WPT8 1.33e-62 228 30 17 756 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 1.33e-62 228 30 17 756 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P18398 4.05e-62 226 29 17 733 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P9WPT9 4.07e-62 226 30 17 756 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O33533 1.51e-61 224 27 20 769 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
O59666 3.97e-61 226 28 11 558 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M3H5 3.85e-60 221 27 14 613 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
P38995 5.25e-59 220 28 12 543 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CW77 7.82e-58 209 29 9 457 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q59207 6.52e-56 208 26 18 725 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q04656 7e-56 212 28 14 582 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
P38360 2.51e-51 198 26 14 624 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P46839 1.35e-50 193 31 4 495 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
A9VFM1 2.15e-47 183 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
C1EYK0 2.94e-47 182 30 18 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
B7II09 4.66e-47 182 31 19 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
B7JRB8 5.58e-47 182 30 18 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
Q6HN78 9.11e-47 181 30 18 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81HQ0 1.05e-46 181 30 19 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HDF9 1.13e-46 181 30 19 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
A0RA13 1.27e-46 181 30 18 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
B7HWG1 2.87e-46 179 30 18 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
O32328 5.15e-46 179 29 14 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C3LF99 5.92e-46 179 30 18 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q8R8I6 8.75e-46 178 29 12 507 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q63FR0 2.1e-45 177 30 18 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
Q9R6X1 1.5e-44 174 28 11 509 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q926K7 7.9e-44 172 28 15 503 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8YPE9 1.23e-43 172 29 10 468 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A7GLG4 1.8e-43 171 28 14 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9A7X7 6.77e-42 166 30 12 492 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8YSD5 2.73e-41 165 29 17 500 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q4LAI2 2.94e-41 164 27 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q5HK64 9.34e-41 163 27 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 9.34e-41 163 27 14 510 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 9.34e-41 163 27 14 510 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 9.34e-41 163 27 14 510 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GEZ7 8.14e-40 160 29 14 498 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q2YUH7 1.25e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NVI2 2.15e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 2.15e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
A8Z4X9 2.57e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 2.57e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 2.57e-39 159 29 14 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
P63684 3.11e-39 158 29 14 498 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 3.11e-39 158 29 14 498 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P73867 3.9e-39 158 30 15 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P57700 8.53e-38 154 26 11 505 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9RZP0 2.45e-37 152 29 10 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q73E41 2.58e-37 154 25 20 665 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q93MV5 8.22e-37 151 29 13 503 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q57RN0 2.74e-36 149 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
Q9X8Z9 3.74e-36 149 28 15 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q98GX6 4.43e-36 149 30 12 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B5R670 2.32e-35 147 30 21 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q92XJ0 2.61e-35 146 27 16 564 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
B4SZB1 6.83e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B4TQ22 6.89e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
B4TBA6 8.32e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 8.32e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B5FNE0 8.63e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B5BCA4 9.27e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 9.27e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQW2 9.7e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MUE0 9.7e-35 145 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8U9D9 1.01e-34 145 29 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
B1IY32 1.15e-34 144 31 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B6HYQ5 1.4e-34 144 31 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 1.4e-34 144 31 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8PCM1 1.42e-34 144 31 13 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q324L0 1.44e-34 144 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
P03960 1.49e-34 144 31 15 468 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 1.49e-34 144 31 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 1.49e-34 144 31 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B5EZE3 1.98e-34 144 29 20 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B1LLE1 2.61e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
A7ZXV8 2.66e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B7NMQ0 2.78e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQN9 2.83e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 2.83e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q9CFU9 3.48e-34 144 24 14 640 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q3Z4A6 3.48e-34 143 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
P59219 3.73e-34 143 31 16 477 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P9WPU3 3.93e-34 143 29 16 518 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 3.93e-34 143 29 16 518 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 3.93e-34 143 29 16 518 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P57698 4.87e-34 142 30 13 450 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7N9U0 5.71e-34 142 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M5L3 6.24e-34 142 30 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 6.24e-34 142 30 15 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B7MPK0 6.3e-34 142 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
Q8FJV4 6.89e-34 142 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 6.89e-34 142 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 6.89e-34 142 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2V2P3 7.21e-34 142 28 12 452 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B2TTJ7 1.16e-33 141 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B2TMJ2 1.18e-33 141 28 12 452 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
B4U8E4 1.27e-33 141 27 12 464 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
B7LKR7 1.48e-33 141 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q58623 1.73e-33 142 27 19 604 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1REM0 3.79e-33 140 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 3.79e-33 140 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 3.79e-33 140 30 13 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
Q72TM6 4.97e-33 139 30 16 477 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A6T6D8 5.28e-33 139 27 20 581 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8KU73 6.43e-33 139 27 14 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q97BF6 8.01e-33 139 25 11 504 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q8PPC9 1.21e-32 138 30 12 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
B5XZE9 1.22e-32 138 27 20 581 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
Q7N6W6 2.43e-32 137 27 10 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0TRT3 3.83e-32 137 27 16 516 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P47317 2.87e-31 135 24 15 595 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A4W860 8.7e-31 132 29 15 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
A4SZG8 4.74e-30 130 28 17 525 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8XU11 6.84e-30 130 26 9 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q667S4 1e-29 129 28 15 537 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
B1JR96 1.08e-29 129 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 1.08e-29 129 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TL06 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 1.21e-29 129 28 15 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A1JQS2 2.52e-29 128 28 14 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Y3Z7 4.38e-29 127 28 16 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A8GB61 5.27e-29 127 27 9 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
Q47H39 6.6e-29 127 27 14 515 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
Q71W90 1.24e-28 125 27 16 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 1.24e-28 125 27 16 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
Q927G0 1.42e-28 125 27 14 511 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P54679 1.71e-28 126 26 20 622 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
B8DAW1 1.79e-28 125 28 16 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
A0AM16 6.97e-28 123 27 16 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P05030 8.51e-28 124 24 20 620 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C4LDL7 1.13e-27 123 26 13 517 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B2VJK3 1.15e-27 123 28 11 455 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
O59868 8.01e-27 120 23 20 666 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78036 8.92e-26 117 23 15 600 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0ABB8 1.93e-25 116 24 19 611 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 1.93e-25 116 24 19 611 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P20649 2.66e-25 116 27 15 537 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P19657 3.19e-25 115 24 22 640 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28877 6.31e-25 115 23 18 627 1 PMA1 Plasma membrane ATPase 1 Candida albicans
Q43128 1.41e-24 114 25 17 580 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
Q42556 1.55e-24 114 26 16 540 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P20431 1.82e-24 113 26 14 532 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P07038 4.04e-24 112 22 17 592 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P19456 7.96e-24 111 26 13 534 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
Q08436 1.38e-23 110 26 15 549 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
Q9SJB3 1.63e-23 110 27 18 547 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P22180 3.31e-23 109 26 15 549 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
P35597 3.61e-23 109 25 15 536 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q08435 4.64e-23 108 26 15 546 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P36640 5.07e-23 108 24 21 611 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 5.07e-23 108 24 21 611 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
A0R3Y2 6.44e-23 108 27 15 515 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9M2A0 8.06e-23 108 26 17 550 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9SU58 1.05e-22 108 27 18 554 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q9LV11 1.7e-22 107 26 16 546 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
P49380 1.93e-22 107 23 20 610 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P24545 2.51e-22 106 23 21 604 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
Q7XPY2 2.75e-22 106 26 18 553 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P83970 7.94e-22 105 25 14 544 2 ha1 Plasma membrane ATPase Triticum aestivum
P54211 3.79e-21 103 24 17 602 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
P57699 4.22e-21 102 24 17 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 4.22e-21 102 24 17 500 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O53114 3.8e-20 100 26 18 563 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
P54210 2.68e-19 97 24 16 591 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
Q8Z8E5 7.7e-19 94 33 11 295 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 4.23e-07 57 32 5 151 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q9XES1 7.86e-19 95 28 10 300 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 1.25e-13 79 31 8 216 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P92939 9.58e-19 95 28 10 300 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 1.7e-13 78 31 8 216 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P37278 2.5e-18 94 28 8 302 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.58e-13 77 32 3 174 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q07421 3.02e-18 93 23 19 640 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P24797 9.63e-18 92 26 4 254 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 2.69e-05 51 23 10 325 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P9WPT1 1.18e-17 91 27 19 509 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT0 1.18e-17 91 27 19 509 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A505 1.18e-17 91 27 19 509 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P05025 2.11e-17 90 26 5 281 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 3.03e-08 61 26 5 201 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
Q5RCD8 4.92e-17 89 25 4 254 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 3.5e-05 51 25 5 197 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q8Y8Q5 5.4e-17 89 32 4 206 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 8.65e-16 85 26 6 287 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
D2WKD8 6.81e-17 89 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 0.000119 49 24 5 197 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
A2VDL6 7.36e-17 89 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 0.000133 49 24 5 197 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
P50993 9.12e-17 89 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 5.18e-05 50 25 5 197 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P06687 1.65e-16 88 25 5 276 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 9.54e-08 59 25 4 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 1.65e-16 88 25 5 276 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 9.54e-08 59 25 4 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 1.65e-16 88 25 5 276 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 1.01e-07 59 25 4 196 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
Q9M2L4 1.68e-16 88 24 25 631 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
O43108 2.65e-16 87 24 4 315 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 5.31e-16 86 31 5 207 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P06686 3.47e-16 87 25 4 254 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 5.09e-05 50 25 5 197 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 3.47e-16 87 25 4 254 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 5.09e-05 50 25 5 197 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q92126 5.26e-16 86 25 5 303 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 1.53e-07 58 27 5 196 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
P09626 5.36e-16 86 26 4 254 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.17e-08 61 27 5 196 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
Q64436 5.89e-16 86 26 4 254 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 3.48e-08 61 27 5 196 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
P24798 6.23e-16 86 25 4 254 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 1.16e-06 56 26 4 196 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
Q9T0E0 6.48e-16 85 22 8 469 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P50997 7.07e-16 85 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P18907 7.77e-16 85 25 4 262 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 3.98e-05 51 25 5 197 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
Q92030 8.25e-16 85 26 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 7.73e-08 60 27 6 224 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P58312 8.56e-16 85 24 4 257 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 0.000142 49 25 5 196 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P05024 8.61e-16 85 25 4 254 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 0.000119 49 25 5 197 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P30714 1.09e-15 85 25 4 254 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 2.42e-06 55 25 4 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P04074 1.19e-15 85 24 4 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 4.56e-08 60 27 4 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q08DA1 1.23e-15 85 24 4 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 4.22e-08 60 27 4 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P20648 1.33e-15 85 25 4 254 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 1e-07 59 27 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P05023 1.57e-15 85 25 4 254 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 3.81e-05 51 25 5 197 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
Q8VDN2 1.69e-15 84 25 4 254 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 7.1e-05 50 25 5 197 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P06685 1.85e-15 84 25 4 254 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 7.16e-05 50 25 5 197 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P28876 2.07e-15 84 23 17 602 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P35317 2.34e-15 84 25 4 241 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 2.53e-07 58 25 6 217 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
Q9N0Z6 2.56e-15 84 24 4 257 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 5.13e-05 50 25 5 197 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q6RWA9 3.21e-15 84 27 5 258 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 1.95e-07 58 26 8 225 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q5RDR3 3.48e-15 84 25 4 238 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 3.84e-05 51 25 5 197 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P17326 3.7e-15 83 25 5 253 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 2.15e-06 55 26 7 219 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P27112 3.75e-15 83 25 4 254 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 1.05e-07 59 27 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P37367 3.76e-15 83 27 6 294 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 1.21e-11 72 31 4 189 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13733 3.93e-15 83 25 4 241 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 0.000769 47 38 1 65 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
O23087 4.3e-15 83 25 10 315 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 3.03e-10 67 28 8 218 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
P13607 7.2e-15 82 25 6 286 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 8.59e-05 50 25 5 202 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P50996 7.24e-15 82 25 4 254 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 9.36e-08 59 27 5 196 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P09572 8.53e-15 82 24 4 254 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 0.000112 49 25 5 197 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P35315 9.33e-15 82 30 8 237 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 6.29e-14 79 28 7 259 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P19156 1.02e-14 82 25 4 254 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 1.17e-07 59 27 5 196 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P11718 1.14e-14 82 22 12 563 2 H1A Probable proton ATPase 1A Leishmania donovani
P12522 1.77e-14 81 22 12 563 2 H1B Probable proton ATPase 1B Leishmania donovani
P28774 2.17e-14 81 25 5 246 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 4.77e-08 60 28 6 197 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
O77696 2.18e-14 81 30 8 238 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 2.01e-09 65 26 10 289 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
Q64541 2.58e-14 80 24 4 238 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 1.92e-09 65 26 3 196 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
P09627 2.97e-14 80 22 17 605 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92123 3.76e-14 80 25 5 281 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 5.14e-08 60 26 5 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q9WV27 3.77e-14 80 23 3 238 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 4.69e-09 63 26 3 196 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
O22218 3.86e-14 80 22 23 628 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q9YGL9 3.94e-14 80 30 7 217 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 4.06e-12 73 25 11 317 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P13586 4.59e-14 80 30 5 213 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 1.55e-13 78 21 7 332 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9TV52 5.93e-14 79 24 6 293 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 3.39e-08 61 25 5 214 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9YH26 7.57e-14 79 24 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 5.79e-08 60 28 5 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P25489 8.26e-14 79 26 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 0.000326 48 25 5 197 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q4WND5 8.32e-14 79 30 7 218 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 1.11e-10 69 26 5 280 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P23980 9.33e-14 79 26 14 422 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
Q42883 1.14e-13 79 25 9 300 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 6.35e-11 70 27 8 225 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
P54209 1.46e-13 78 28 9 286 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P54209 5.16e-11 70 29 6 223 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
Q9SY55 1.48e-13 78 27 7 240 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 1.05e-10 69 27 11 293 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q4WHC8 1.69e-13 78 34 3 174 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 1.8e-05 52 23 6 278 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q37145 2.02e-13 78 30 8 213 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 1.05e-07 59 25 8 228 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
P9WPS9 3.44e-13 77 28 7 282 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 2.66e-09 64 36 3 152 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 3.44e-13 77 28 7 282 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 2.66e-09 64 36 3 152 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 3.44e-13 77 28 7 282 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 2.66e-09 64 36 3 152 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q64392 4.39e-13 77 27 8 262 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 3.54e-09 64 26 5 214 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
O13397 5.82e-13 76 27 8 268 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
Q7PPA5 5.98e-13 76 25 13 364 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 3.22e-12 74 30 7 215 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q9Z1W8 6.23e-13 76 22 8 322 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 3.79e-07 57 25 4 196 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q93084 7.73e-13 76 30 7 220 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 5.23e-10 67 24 12 338 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
P22700 8.14e-13 76 25 13 364 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 8.57e-13 76 29 7 215 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q292Q0 8.21e-13 76 30 7 215 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 1.49e-12 75 24 13 364 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q64518 9.57e-13 75 29 7 221 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 5.74e-10 67 26 12 316 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P70083 1.36e-12 75 29 6 219 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 3.18e-10 67 25 11 297 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
Q92105 1.62e-12 75 29 7 229 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q92105 8.4e-11 69 25 14 341 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
P04191 1.98e-12 74 29 6 218 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 4.97e-10 67 25 12 303 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P54708 2.28e-12 74 22 8 322 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 3.85e-07 57 25 5 214 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q8R429 2.44e-12 74 29 6 218 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 2.7e-10 67 25 12 322 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64578 2.51e-12 74 29 6 218 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 2.57e-10 68 26 12 315 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
P18596 2.56e-12 74 29 7 218 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 9.26e-10 66 26 12 315 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
Q0VCY0 2.75e-12 74 29 6 218 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 6.4e-10 66 25 12 322 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
O14983 2.93e-12 74 29 6 218 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 2.37e-10 68 25 11 324 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O34431 3.13e-12 74 32 3 173 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 7.82e-12 72 24 6 274 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q9LIK7 3.16e-12 74 30 7 219 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 7.27e-05 50 24 8 274 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
P13585 4.45e-12 73 29 6 218 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 8.18e-11 69 25 13 338 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
Q03194 4.51e-12 73 30 3 181 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q03194 8.81e-09 63 29 6 219 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q08853 4.57e-12 73 23 8 272 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 8.48e-10 66 37 5 128 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P38929 6.07e-12 73 31 6 214 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SH76 7.21e-12 73 30 3 188 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q9SH76 1.91e-08 62 26 6 222 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q92036 7.5e-12 73 22 6 272 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 0.000371 48 31 5 114 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q6ATV4 8.72e-12 72 29 8 213 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 1.44e-09 65 23 7 292 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
P54707 1.03e-11 72 23 4 265 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 1.06e-07 59 25 5 214 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
Q7XB51 1.11e-11 72 27 4 204 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 1.11e-11 72 27 8 284 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q9LY77 1.15e-11 72 30 8 219 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
A0A143ZZK9 1.31e-11 72 27 5 218 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
P35316 1.45e-11 72 30 7 215 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 1.87e-11 71 25 13 324 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P20647 1.47e-11 72 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 1.97e-11 71 26 12 322 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P16615 1.55e-11 72 28 6 215 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 1.79e-11 71 27 11 302 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
O81108 1.69e-11 72 30 8 213 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 1.7e-11 72 28 8 225 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O55143 1.73e-11 72 27 11 302 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 2.24e-11 71 28 6 215 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
Q2QMX9 1.78e-11 71 30 8 213 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 6.81e-09 63 24 6 248 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
P11507 1.9e-11 71 27 11 302 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 2.32e-11 71 28 6 215 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11607 1.94e-11 71 27 11 302 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 2.66e-11 71 28 6 215 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
O46674 1.99e-11 71 27 11 302 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 3.26e-11 70 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q00779 2.2e-11 71 27 11 302 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 3.18e-11 70 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q03669 2.24e-11 71 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 5.53e-11 70 26 11 302 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P22189 2.31e-11 71 30 5 198 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23634 2.4e-11 71 27 7 239 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P98194 3.2e-11 70 28 8 237 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 4.09e-10 67 23 7 285 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
D3K0R6 3.49e-11 70 25 5 221 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
Q16720 3.98e-11 70 26 8 249 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
P57709 5.03e-11 70 30 8 210 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 2.47e-09 64 23 7 285 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
Q64568 5.05e-11 70 26 8 249 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q64542 5.24e-11 70 26 9 239 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
Q2RAS0 5.39e-11 70 25 10 295 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 1.45e-09 65 29 7 215 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 6.24e-11 70 30 8 215 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 4.64e-06 54 25 10 273 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
O64806 6.78e-11 70 30 8 213 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 8.32e-11 69 27 9 267 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O13398 7.12e-11 69 28 6 210 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 4.15e-06 54 24 12 291 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
G5E829 7.22e-11 70 26 7 230 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 7.34e-11 69 26 7 230 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
Q5R5K5 7.72e-11 69 30 8 210 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 3.78e-10 67 23 7 285 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q64566 9.16e-11 69 28 6 207 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 3.82e-10 67 23 7 286 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P22036 1.24e-10 68 31 4 175 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P22036 2.8e-09 64 23 10 364 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6Q477 1.36e-10 68 24 6 237 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q80XR2 1.43e-10 68 27 7 237 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 1.16e-09 65 25 7 248 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q2QY12 1.87e-10 68 25 7 225 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 8.55e-09 63 28 6 215 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
C1L360 2.07e-10 68 29 3 185 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 9.01e-10 66 28 10 253 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
B9QMJ0 2.09e-10 68 29 5 214 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
B9QMJ0 0.000325 48 23 9 293 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q65X71 2.1e-10 68 27 7 231 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 2.42e-06 55 24 8 250 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P13587 2.18e-10 68 27 5 194 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
G5EFR6 2.42e-10 68 27 7 228 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
O75185 2.59e-10 68 23 6 247 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 2.57e-09 64 27 7 229 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
J9VQQ3 2.63e-10 68 29 7 224 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q12691 2.94e-10 67 27 5 194 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 3.07e-10 67 27 5 194 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7L9Z8 3.63e-10 67 23 6 263 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 4.32e-09 63 26 6 205 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
Q8R4C1 3.86e-10 67 22 6 263 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 5.17e-09 63 26 6 205 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
P20020 5.39e-10 67 25 7 221 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
P23220 5.58e-10 67 25 7 221 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P11506 6.88e-10 66 26 7 221 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q9R0K7 7.1e-10 66 26 7 221 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q01814 7.49e-10 66 26 7 221 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
P9WPS4 9.94e-10 66 29 3 197 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 3.5e-09 64 30 8 231 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS5 1.05e-09 66 29 3 197 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 4.25e-09 64 30 8 231 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q98SH2 1.05e-09 66 25 6 221 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q9LY32 1.39e-09 65 28 3 187 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9LY32 2.84e-09 64 28 4 210 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9LF79 1.54e-09 65 27 7 222 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9LF79 2.43e-05 52 24 10 308 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q7X8B5 3.99e-09 64 26 7 221 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q9SZR1 5.35e-09 63 27 7 222 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9LU41 9.35e-09 63 28 7 219 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
Q00804 1.61e-08 62 25 7 221 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
P54678 8.56e-08 59 28 3 156 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P54678 1.31e-05 52 23 8 224 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P58165 1.38e-07 59 24 6 221 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
Q9HDW7 2.53e-05 52 25 6 244 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q58378 3.76e-05 50 32 4 129 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P42962 0.000107 48 29 3 114 1 ycsE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YcsE Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11345
Feature type CDS
Gene -
Product zinc/cadmium/mercury/lead-transporting ATPase
Location 410447 - 412846 (strand: -1)
Length 2400 (nucleotides) / 799 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_841
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01534 Zn2+/Cd2+-exporting ATPase [EC:7.2.2.12 7.2.2.21] - -

Protein Sequence

MHPNKDKHEHTHSTSCCTGKSECSTGQTAAAPAHHDHDAHDHSEHAQKEHDEDESRAHDHATHDHAHSDSNHDHAGHDHAQGSCCSHDQAANDDVTPPELSGSRRYNWLVEGMDCPSCARKIETAVGKVASVRQAKVMFATEKLVVDADEDVRAAVTSAVQQTGFTLYDLNDKNAAPKKKEEISLLKQAAPMIILAVLIALSYGLELINPTLGKYAFIASTLVGLYPIAKSSFRLIRSGSPFAIETLMTVAAVGAIVIGATEEAAMVILLFLLGEMLESYAAGRARRGVSALMALVPEDAVVVKDGKKISVPVSQLRPGDIIEIAPGGRLPTDAEMLSEFASFDESALTGESVPVERAQGEKVAAGSLSVDRAVQMKVVSEQGQNAIDRIMTLIEEAEERRAPIERFIDQFSRYYTPMIMLFSALVIVVPPLFMGAEWYPWIYRGLTLLLIGCPCALVISTPAAITSALAAATRRGALIKGGAALEQLGTVTTVALDKTGTLTEGKPQVTDIVALNNHSNADVLTFASSVESGSHHPLAKAILERTAELGLTITEADNRKAHAGKGVEGNLNGTNVLVSAPGKLAEGLLTDANAAEVIRLENEGKTVVAVVADQQLTGLIAMQDTLRDDAVEAIAQLRKMGVNAVMLTGDNPRAAAAIANAVGMDFRAGLMPEDKVKAVMALNEEHRTMMVGDGINDAPAMKAAGIGVAMGSGTDVALETADAALTHNRLTGIAEIIALSRATRRVIRENIAIALGLKAVFLVTTLMGLTGLWVAVLADSGATALVTANAVRLLRAVKK

Flanking regions ( +/- flanking 50bp)

GTTAATGAGACAAATTAACAACAACTGAACTGTTGAACAGGGAGGTGTTTATGCACCCGAATAAAGATAAACATGAGCATACGCACAGCACCAGCTGCTGCACCGGTAAATCAGAGTGCTCCACCGGTCAGACAGCGGCGGCACCGGCGCATCATGACCATGATGCACACGACCACAGCGAACACGCGCAGAAGGAACATGACGAAGACGAGTCCCGCGCGCATGACCATGCCACGCACGATCATGCGCATTCTGACTCAAATCATGACCACGCCGGTCACGACCACGCGCAGGGAAGCTGCTGCTCACACGACCAGGCCGCAAATGATGATGTCACACCGCCTGAGTTATCCGGCAGCCGCCGTTATAACTGGCTGGTCGAAGGTATGGACTGCCCGAGCTGTGCACGGAAAATAGAAACCGCCGTCGGCAAAGTCGCCTCTGTCAGACAGGCAAAAGTGATGTTTGCCACCGAAAAACTGGTGGTGGATGCCGATGAAGATGTGCGCGCAGCCGTCACAAGCGCTGTACAACAGACAGGTTTCACCCTGTATGACCTGAATGACAAAAACGCGGCACCAAAGAAAAAAGAAGAAATCAGCCTGCTGAAACAAGCAGCACCGATGATTATTCTTGCAGTACTGATCGCCCTCAGTTACGGGCTGGAGTTAATTAATCCGACGCTGGGTAAATATGCCTTTATCGCGTCAACACTGGTCGGGCTGTATCCGATTGCAAAAAGTTCGTTTCGCCTTATCCGTTCCGGATCGCCGTTTGCCATTGAAACACTGATGACGGTTGCTGCCGTCGGCGCCATTGTTATCGGTGCCACAGAAGAAGCGGCAATGGTTATCCTGCTCTTCCTGCTGGGTGAAATGCTGGAGTCTTATGCCGCAGGTCGCGCCCGCCGGGGTGTCAGTGCGCTGATGGCGCTGGTGCCGGAAGATGCGGTGGTGGTTAAAGACGGCAAAAAGATATCTGTGCCGGTTTCACAACTGCGTCCGGGCGATATTATTGAAATTGCACCGGGCGGACGTTTACCGACAGATGCTGAAATGCTCAGTGAGTTCGCCAGTTTTGACGAAAGCGCACTGACCGGGGAATCCGTCCCGGTTGAGCGGGCACAGGGCGAAAAAGTCGCGGCAGGCTCGCTTTCCGTCGACAGAGCCGTACAAATGAAAGTGGTTTCTGAACAGGGACAGAATGCGATTGACCGCATTATGACGCTGATTGAAGAAGCCGAAGAGCGCCGCGCACCGATTGAGCGGTTTATCGACCAGTTCAGCCGTTACTATACGCCGATGATCATGTTGTTCTCTGCGCTGGTGATTGTGGTTCCGCCACTGTTTATGGGTGCTGAGTGGTATCCGTGGATCTACCGTGGTCTGACTCTGCTGCTGATTGGTTGTCCGTGTGCGCTGGTTATTTCCACACCTGCGGCGATCACCTCCGCACTGGCTGCTGCCACCCGCCGTGGTGCGCTGATTAAAGGCGGTGCCGCACTGGAGCAACTGGGTACAGTGACCACCGTTGCCCTGGATAAAACCGGCACACTAACAGAAGGTAAACCACAGGTTACGGATATCGTTGCACTGAATAATCACAGTAATGCGGATGTTCTGACCTTTGCATCATCAGTTGAAAGCGGCTCACATCACCCGTTAGCCAAAGCGATTCTTGAACGCACAGCTGAACTCGGACTGACCATCACAGAAGCGGATAACCGCAAAGCACATGCCGGTAAAGGAGTTGAAGGTAACCTTAATGGTACAAATGTACTGGTCAGCGCCCCGGGTAAACTGGCAGAAGGTCTGCTGACGGATGCCAATGCGGCTGAAGTCATCCGCCTTGAAAATGAAGGGAAAACCGTGGTCGCAGTGGTCGCAGACCAACAGCTGACCGGGCTTATCGCCATGCAGGATACACTGCGTGACGATGCCGTGGAGGCTATCGCACAGTTGCGCAAAATGGGCGTCAATGCCGTAATGCTGACAGGGGATAACCCGCGTGCTGCCGCTGCTATCGCCAATGCGGTCGGGATGGATTTCCGCGCGGGTCTGATGCCGGAAGATAAAGTAAAAGCGGTGATGGCGCTCAATGAAGAGCACCGCACCATGATGGTGGGTGATGGTATCAATGACGCTCCGGCAATGAAAGCCGCCGGTATTGGTGTCGCAATGGGCAGCGGGACAGATGTGGCGCTGGAAACAGCCGATGCCGCCCTGACCCATAACCGCCTGACCGGTATTGCAGAGATCATCGCGCTGTCCCGGGCAACACGCAGAGTTATCCGTGAAAACATTGCTATCGCGCTGGGTCTGAAAGCAGTCTTCCTGGTGACCACACTGATGGGACTGACCGGACTGTGGGTCGCGGTACTGGCTGACTCAGGTGCAACCGCACTGGTCACCGCAAACGCCGTGCGCCTGCTGCGGGCAGTGAAAAAGTAACCCGCTGATATCGCAATGCTGTAAAGCATAATGCTGTAAAAACAGAAAGG