Homologs in group_771

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03555 FBDBKF_03555 100.0 Morganella morganii S1 cadA zinc/cadmium/mercury/lead-transporting ATPase
EHELCC_06980 EHELCC_06980 100.0 Morganella morganii S2 cadA zinc/cadmium/mercury/lead-transporting ATPase
LHKJJB_06840 LHKJJB_06840 100.0 Morganella morganii S3 cadA zinc/cadmium/mercury/lead-transporting ATPase
HKOGLL_04090 HKOGLL_04090 100.0 Morganella morganii S5 cadA zinc/cadmium/mercury/lead-transporting ATPase
F4V73_RS11345 F4V73_RS11345 87.1 Morganella psychrotolerans - zinc/cadmium/mercury/lead-transporting ATPase
PMI_RS17915 PMI_RS17915 70.6 Proteus mirabilis HI4320 - zinc/cadmium/mercury/lead-transporting ATPase

Distribution of the homologs in the orthogroup group_771

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_771

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3YW59 0.0 825 61 3 718 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 0.0 822 61 3 718 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q6GIX1 2.05e-162 491 37 12 715 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P30336 1.84e-160 486 38 12 709 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P20021 2.49e-160 486 37 15 723 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P37386 4.14e-159 485 37 14 720 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
P58414 9.37e-157 476 38 14 713 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q60048 3.01e-144 444 36 13 719 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
Q59465 1.42e-126 397 32 12 706 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZL53 2.14e-125 394 33 12 701 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q59998 1.12e-122 388 35 12 719 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31688 1.36e-115 367 36 2 587 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
O32219 1.88e-115 369 33 14 721 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
O32220 7.54e-113 365 34 19 746 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q9RQB4 6.52e-108 348 32 14 706 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
P32113 1.64e-106 346 31 12 693 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q7A3E6 4.86e-101 333 32 16 726 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 4.86e-101 333 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 4.86e-101 333 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 4.86e-101 333 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 4.86e-101 333 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUQ9 1.23e-100 332 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 1.23e-100 332 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
A8Z3F8 3.33e-100 331 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 3.33e-100 331 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q6GDP1 4.41e-100 331 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A6QK47 7.12e-100 330 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 7.12e-100 330 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 7.12e-100 330 32 16 726 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CN02 7.81e-100 330 30 15 731 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 7.81e-100 330 30 15 731 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4A0G1 1.08e-99 330 30 18 770 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YWA3 1.17e-99 330 32 16 726 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A3BF39 5.71e-99 333 32 13 704 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q9CCL1 3.7e-98 323 36 16 628 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q4L970 1.04e-97 324 30 17 741 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
P9WPS3 1.2e-97 323 33 9 641 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 1.2e-97 323 33 9 641 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0CW78 3.45e-95 317 32 15 629 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
P58341 7.44e-95 317 30 14 707 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P9WPT5 7.38e-94 312 35 18 665 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 7.38e-94 312 35 18 665 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 7.38e-94 312 35 18 665 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2HEM2 8.62e-94 312 35 16 617 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9SZW4 1.79e-93 317 33 15 623 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
A0R3A7 3.02e-92 306 34 10 583 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9X5X3 3.23e-92 310 31 17 703 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
O30085 4.57e-92 306 32 14 629 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P58342 5.23e-92 310 31 13 703 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
Q8ZCA7 5.54e-92 313 31 17 755 3 copA Copper-exporting P-type ATPase Yersinia pestis
O64474 6.56e-92 316 32 11 623 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
P37279 1.25e-90 304 33 8 551 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5ZWR1 7.81e-90 301 31 20 771 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P9WPS7 1.04e-88 300 38 9 611 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.04e-88 300 38 9 611 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.04e-88 300 38 9 611 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O29777 1.54e-87 297 32 17 695 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8ZR95 4.68e-87 296 36 11 558 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XD24 7.25e-87 296 30 17 747 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8Z8S4 1.07e-86 295 36 11 558 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q9ZHC7 1.85e-86 295 34 10 552 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q59385 2.82e-86 295 31 19 750 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
P73241 1.4e-84 288 35 12 517 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73241 0.000116 49 40 1 64 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9X5V3 6.01e-83 285 34 10 594 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P77868 4.31e-81 278 28 15 729 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WPT7 8.66e-80 273 36 8 562 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 8.66e-80 273 36 8 562 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SH30 9.98e-80 280 33 7 523 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q6H7M3 1.3e-79 279 33 12 552 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
A3AWA4 2.06e-78 276 33 10 527 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 1.35e-77 273 32 8 543 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
O32619 4.29e-77 267 29 14 699 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q9S7J8 4.73e-77 272 31 14 619 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
P9WPT3 7.76e-77 265 34 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 7.76e-77 265 34 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 7.76e-77 265 34 8 538 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P35670 2.47e-75 271 29 25 764 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
Q8H384 4.71e-75 266 33 10 570 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q64446 1.02e-73 266 29 22 756 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64535 6.26e-73 263 28 18 764 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q9XT50 7.57e-73 263 28 22 773 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9KPZ7 2.91e-72 257 29 12 693 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P05425 1.7e-71 252 27 24 771 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q9SZC9 6.73e-71 254 33 8 533 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
B9DFX7 7.01e-71 253 30 9 552 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P37385 1.04e-67 243 27 14 731 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q64430 2.25e-67 247 30 12 582 1 Atp7a Copper-transporting ATPase 1 Mus musculus
P70705 5.33e-67 246 30 13 582 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P07893 5.95e-67 240 26 14 733 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O08462 2.89e-66 238 28 11 520 3 copA Copper-transporting ATPase Helicobacter pylori
Q8CQF7 5.93e-66 235 29 8 541 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q59467 2.66e-65 235 29 11 517 3 copA Copper-transporting ATPase Helicobacter pylori
A8YZ02 4.66e-65 233 29 8 541 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 4.66e-65 233 29 8 541 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
Q9ZM69 6.66e-65 234 29 8 516 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q4LAB1 9.09e-65 232 29 7 503 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q5HKB0 1.48e-64 231 29 9 542 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P49015 2.61e-64 238 28 14 610 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P9WPU1 3.21e-64 232 29 15 734 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 3.21e-64 232 29 15 734 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46840 8.13e-64 231 29 22 749 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
P77871 1.07e-63 230 28 11 520 3 copA Copper-transporting ATPase Helicobacter pylori
P55989 4.03e-63 229 28 11 520 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q04656 6.81e-63 233 30 14 582 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q69HU0 1.29e-62 226 28 6 502 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
Q6GIX4 4.76e-62 224 28 6 502 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
P9WPT8 1.06e-61 225 29 18 763 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 1.06e-61 225 29 18 763 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O33533 1.3e-61 225 27 16 727 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
P9WPT9 2.98e-61 224 29 18 763 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P18398 6.55e-61 223 28 21 738 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
O59666 6.92e-61 225 29 11 560 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38995 6.42e-60 223 29 13 544 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CW77 1.29e-59 214 31 11 467 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q9M3H5 2.44e-56 211 26 12 612 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
Q59207 4.11e-56 209 28 19 725 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P38360 7.53e-50 193 26 12 552 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P46839 9.24e-50 191 31 5 498 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
B7HWG1 1.34e-47 184 30 16 509 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
A9VFM1 1.42e-47 183 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
Q81HQ0 2.82e-47 182 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C1EYK0 4.75e-47 182 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
B7II09 6e-47 182 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
A0RA13 6.12e-47 181 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
B7JRB8 6.23e-47 181 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
C3LF99 6.23e-47 181 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q6HN78 6.47e-47 181 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63FR0 1.28e-46 181 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
B7HDF9 1.64e-46 180 30 16 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
O32328 6.18e-45 176 29 15 520 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7GLG4 1.29e-44 175 29 15 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8R8I6 7.98e-44 172 28 17 564 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9R6X1 3.78e-43 170 28 11 505 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q926K7 5.02e-43 170 29 13 503 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8YPE9 8.61e-42 166 29 10 467 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YSD5 2.24e-40 162 28 15 522 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q4LAI2 4.33e-40 161 28 16 513 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
P73867 7.3e-40 160 30 14 526 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5HK64 1.09e-39 160 27 13 504 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 1.09e-39 160 27 13 504 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 1.09e-39 160 27 13 504 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 1.09e-39 160 27 13 504 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q93MV5 1.55e-39 159 29 13 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q9A7X7 1.74e-38 156 28 10 490 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9RZP0 7.11e-38 154 29 10 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8NVI2 1.18e-37 154 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 1.18e-37 154 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
P63684 1.32e-37 153 27 12 496 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 1.32e-37 153 27 12 496 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z4X9 1.51e-37 153 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 1.51e-37 153 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 1.51e-37 153 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
Q6GEZ7 1.61e-37 153 27 12 496 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q92XJ0 1.76e-37 153 27 13 563 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
Q2YUH7 2.05e-37 153 27 12 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9X8Z9 2.21e-37 153 28 13 517 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P57700 4.74e-37 152 28 14 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q57RN0 1.76e-35 147 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
Q8PCM1 3.32e-35 146 30 12 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q58623 2.35e-34 144 27 19 604 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9CFU9 2.36e-34 144 24 15 643 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
B4SZB1 3.54e-34 143 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
P9WPU3 3.59e-34 143 29 16 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 3.59e-34 143 29 16 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 3.59e-34 143 29 16 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B4TQ22 4.09e-34 143 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
Q8PPC9 4.2e-34 143 31 12 481 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
B5FNE0 4.68e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B4TBA6 5.12e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 5.12e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
Q98GX6 5.26e-34 142 29 13 507 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q97BF6 5.4e-34 142 27 14 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B5R670 5.4e-34 142 29 18 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MUE0 5.65e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BCA4 9.6e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 9.6e-34 142 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EZE3 1.34e-33 141 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
Q324L0 2.35e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
B6HYQ5 3.16e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 3.16e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IY32 3.31e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P57699 3.43e-33 140 26 14 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 3.43e-33 140 26 14 486 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P03960 3.46e-33 140 30 14 463 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 3.46e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 3.46e-33 140 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
Q8ZQW2 3.75e-33 140 29 17 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7M5L3 4.57e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 4.57e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B7NMQ0 4.65e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A7ZXV8 4.86e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B1LLE1 5.87e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
B5YQN9 5.87e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 5.87e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q3Z4A6 5.97e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
B7N9U0 6.53e-33 139 29 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FJV4 6.95e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 6.95e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 6.95e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P59219 7.76e-33 139 29 15 483 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B7MPK0 7.88e-33 139 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
P57698 8.03e-33 139 28 11 445 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7LKR7 1.19e-32 138 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2TTJ7 1.44e-32 138 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B2V2P3 2.14e-32 137 27 13 509 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B2TMJ2 2.36e-32 137 28 11 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q8KU73 3.24e-32 137 26 11 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q1REM0 4.67e-32 136 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 4.67e-32 136 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 4.67e-32 136 30 14 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B4U8E4 4.85e-32 136 27 12 468 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q72TM6 1.05e-31 135 28 15 483 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A6T6D8 2.45e-31 134 27 19 598 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZE9 2.73e-31 134 27 19 598 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
A4SZG8 3.26e-31 134 27 17 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q0TRT3 3.36e-31 134 27 13 505 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
O59868 7.15e-31 134 24 23 668 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8U9D9 8.57e-31 132 28 13 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
P54679 1.69e-30 133 26 23 637 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
Q8XU11 6.14e-30 130 27 16 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7N6W6 6.47e-30 130 27 9 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q47H39 1.15e-29 129 27 10 454 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
A8GB61 1.85e-29 128 27 9 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
Q927G0 2.54e-29 128 27 16 512 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B1JR96 3.84e-29 127 29 16 535 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 3.84e-29 127 29 16 535 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TL06 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 4.12e-29 127 29 14 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
Q667S4 4.2e-29 127 29 16 535 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
P47317 4.81e-29 128 22 12 563 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A4W860 5.72e-29 127 29 15 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
P0ABB8 5.81e-29 127 25 20 611 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 5.81e-29 127 25 20 611 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
Q71W90 9.1e-29 126 27 16 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 9.1e-29 126 27 16 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
A1JQS2 1.28e-28 125 28 11 470 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Y3Z7 1.51e-28 125 27 16 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P05030 1.81e-28 126 25 20 598 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B8DAW1 1.9e-28 125 27 15 510 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
A0AM16 2e-28 125 27 16 512 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B2VJK3 2.16e-28 125 28 12 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4LDL7 3.92e-27 121 26 13 514 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P36640 2.28e-26 119 26 24 611 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 2.28e-26 119 26 24 611 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
P07038 8.19e-26 117 23 16 585 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P19657 2.12e-25 116 24 21 633 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q43128 3.35e-25 115 25 16 579 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
P28877 3.59e-24 112 23 20 649 1 PMA1 Plasma membrane ATPase 1 Candida albicans
A0R3Y2 5.22e-24 112 26 13 499 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P78036 6.85e-24 111 23 15 560 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q08436 3.47e-23 109 26 14 542 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
Q9SU58 4.52e-23 109 26 15 551 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q08435 4.62e-23 108 26 14 542 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
Q9SH76 1.26e-22 107 25 13 539 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q9LY32 1.49e-22 107 25 13 540 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
P35597 1.66e-22 107 23 13 534 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P24545 1.92e-22 107 24 20 597 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
Q9LV11 2.24e-22 107 27 18 543 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
P49380 2.79e-22 106 23 20 655 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q42556 4.12e-22 106 25 13 542 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
Q03194 5.71e-22 105 26 15 545 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
P54211 6.01e-22 105 23 17 601 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
P22180 9.29e-22 105 26 15 543 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q9M2A0 3.25e-21 103 25 13 539 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9SJB3 3.42e-21 103 25 18 553 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
Q7XPY2 7.38e-21 102 25 14 529 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P54210 1.37e-20 101 24 15 589 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
Q07421 7.13e-20 99 23 18 639 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P37278 8.92e-20 98 29 6 274 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.89e-13 77 31 3 169 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P20649 2.78e-19 97 25 14 542 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
Q73E41 4.35e-19 96 27 9 313 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 3.79e-15 83 30 5 206 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P9WPT0 4.48e-19 96 26 12 464 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 5.06e-19 95 26 12 464 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 5.06e-19 95 26 12 464 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9XES1 7.84e-19 95 29 10 300 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 2.2e-12 74 30 8 216 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
O53114 9.04e-19 95 26 18 564 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
P92939 1.02e-18 95 29 10 300 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 2.94e-12 74 30 8 216 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P19456 2.6e-18 94 25 13 541 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
Q8RUN1 3.09e-18 93 25 26 634 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
P05025 4.97e-18 93 27 5 281 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 2.67e-07 58 27 7 196 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P24797 5e-18 93 26 4 254 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 5.51e-05 50 23 5 196 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
Q9LF79 1.39e-17 91 24 23 643 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q8Z8E5 1.71e-17 90 32 8 284 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 5.46e-08 60 34 4 142 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q5RCD8 4.24e-17 90 25 4 254 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 3.69e-05 51 24 5 196 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
O43108 5.98e-17 89 33 5 207 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 1.65e-16 88 24 4 315 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P50993 6.28e-17 89 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 4.93e-05 50 24 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P06687 7.12e-17 89 26 4 254 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 5.49e-07 57 23 4 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 7.12e-17 89 26 4 254 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 5.49e-07 57 23 4 196 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q9M2L4 7.29e-17 89 23 25 633 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
P13637 7.95e-17 89 26 4 254 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 5.45e-07 57 23 4 196 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
D2WKD8 1.29e-16 88 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 0.000124 49 23 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
A2VDL6 1.35e-16 88 25 4 254 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 0.000127 49 23 5 196 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
Q92030 1.93e-16 87 27 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 4.35e-08 60 27 6 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P50997 2.18e-16 87 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 0.000189 48 25 5 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P05024 2.23e-16 87 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 6.47e-07 57 27 6 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P58312 2.48e-16 87 25 4 254 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 2.37e-05 52 24 5 196 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P06686 2.84e-16 87 25 4 254 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 4.26e-07 57 25 5 196 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 2.84e-16 87 25 4 254 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 4.26e-07 57 25 5 196 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
P04074 3.74e-16 87 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 2.33e-07 58 27 6 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q08DA1 3.9e-16 87 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 2.31e-07 58 27 6 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P30714 4.71e-16 86 25 4 274 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 3.06e-07 58 25 8 220 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P24798 5.01e-16 86 25 4 254 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 9.15e-07 56 26 5 196 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
Q8VDN2 5.09e-16 86 25 4 262 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 2.63e-07 58 27 6 196 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P18907 5.59e-16 86 25 4 262 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 7.37e-08 60 27 6 196 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P06685 5.59e-16 86 25 4 262 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 2.96e-07 58 27 6 196 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P05023 5.59e-16 86 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 2.25e-07 58 27 6 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
Q6RWA9 5.61e-16 86 27 5 258 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 3.98e-08 60 25 7 226 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
P37367 8.41e-16 85 27 5 296 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 3.08e-11 70 30 4 188 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9N0Z6 8.88e-16 85 25 4 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 2.98e-07 58 27 6 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P09626 1.17e-15 85 26 5 250 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.84e-08 60 26 5 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
Q64436 1.17e-15 85 26 5 250 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 3.97e-08 60 26 5 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q8Y8Q5 1.29e-15 85 32 4 205 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 3.61e-15 83 26 6 287 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9T0E0 1.84e-15 84 21 9 486 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P28876 1.97e-15 84 23 17 600 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5RDR3 2.26e-15 84 26 4 238 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 2.1e-07 58 27 6 196 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P09627 2.36e-15 84 22 18 611 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WHC8 2.36e-15 84 35 3 174 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 1.3e-05 52 24 7 278 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q13733 2.57e-15 84 26 4 241 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 0.000132 49 36 2 83 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
P20648 2.63e-15 84 26 5 250 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 1.09e-07 59 25 5 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
Q92126 2.86e-15 84 24 6 299 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 1.9e-07 58 26 5 200 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
O23087 3.76e-15 83 26 9 293 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 7.58e-09 63 27 8 218 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
P28774 4.47e-15 83 26 5 246 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 6.91e-09 63 27 6 201 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q4WND5 5.88e-15 83 31 7 215 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 4.34e-10 67 25 8 288 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P17326 6.44e-15 82 25 5 253 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 4.06e-08 60 26 6 219 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P27112 7.99e-15 82 26 5 250 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 1.23e-07 59 25 5 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P09572 8.07e-15 82 24 4 254 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 2.54e-07 58 27 6 196 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P35317 8.25e-15 82 25 4 241 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 2.68e-08 61 27 7 217 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
Q9YH26 1.24e-14 82 25 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 7.31e-08 60 28 6 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P50996 1.31e-14 82 26 5 250 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 1.19e-07 59 25 5 200 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P13607 1.34e-14 82 25 5 279 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 5.13e-05 50 23 5 197 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P11718 1.75e-14 81 22 13 555 2 H1A Probable proton ATPase 1A Leishmania donovani
Q92123 1.79e-14 81 25 4 274 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 6.89e-08 60 25 5 200 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q64541 2.02e-14 81 24 4 238 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 7.21e-09 63 25 3 196 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
P19156 2.14e-14 81 25 5 250 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 7.92e-08 60 25 5 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
Q9WV27 3.36e-14 80 23 3 238 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 1.58e-08 62 25 3 196 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9TV52 4.57e-14 80 25 5 289 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 9.65e-09 62 25 5 214 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P98194 7.2e-14 79 29 8 237 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 6.45e-10 66 22 8 285 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P25489 7.23e-14 79 26 4 254 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 5.61e-07 57 26 6 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P12522 8.02e-14 79 23 16 565 2 H1B Probable proton ATPase 1B Leishmania donovani
Q42883 8.09e-14 79 26 9 299 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 5.03e-09 63 27 8 218 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
P35315 8.52e-14 79 29 6 255 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 2.52e-13 77 30 7 215 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P54209 8.84e-14 79 27 7 281 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P54209 4.25e-11 70 29 6 227 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
Q292Q0 1.08e-13 79 30 7 215 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 8.95e-12 72 25 12 319 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q9YGL9 1.18e-13 79 29 6 215 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 9.09e-12 72 27 10 287 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P13586 1.25e-13 78 31 5 207 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 2.78e-13 77 21 6 298 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P22700 1.74e-13 78 30 7 215 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 1.61e-11 72 24 13 347 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q64392 2.26e-13 77 26 10 294 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 1.53e-09 65 26 5 214 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q9Z1W8 2.36e-13 77 22 5 279 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 4.22e-08 60 25 5 214 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
P9WPS9 2.49e-13 77 27 5 274 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 2.82e-10 67 32 3 174 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 2.49e-13 77 27 5 274 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 2.82e-10 67 32 3 174 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 2.49e-13 77 27 5 274 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 2.82e-10 67 32 3 174 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23980 2.66e-13 77 25 12 421 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
Q5R5K5 2.98e-13 77 30 8 232 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 6.28e-10 66 22 8 285 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
P57709 2.99e-13 77 29 8 237 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 3.83e-09 64 22 8 285 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
O77696 3.3e-13 77 29 6 215 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 2.36e-09 65 26 10 284 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
Q80XR2 3.3e-13 77 29 7 237 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 2.32e-09 64 23 8 248 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q37145 4.42e-13 77 30 8 218 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 2.41e-07 58 24 10 275 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q9LY77 6.41e-13 76 30 7 222 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q7PPA5 8.31e-13 76 30 7 215 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 4.28e-12 73 25 14 347 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
P54708 9.12e-13 75 22 5 279 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 4.29e-08 60 25 5 214 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P70083 1.04e-12 75 30 6 216 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 4.65e-10 67 25 12 317 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P35316 1.09e-12 75 30 7 215 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 8.15e-12 72 25 15 365 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
Q93084 1.15e-12 75 29 6 215 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 1.86e-09 65 24 10 307 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
P38929 1.18e-12 75 31 6 216 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18596 1.23e-12 75 29 6 218 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 1.76e-09 65 26 10 284 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
Q64518 1.34e-12 75 29 6 215 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 1.08e-09 65 26 10 279 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q9SY55 1.39e-12 75 28 7 222 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 2.72e-10 67 24 13 388 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q64566 1.43e-12 75 28 7 237 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 6.23e-10 66 22 8 286 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P54707 1.9e-12 75 24 4 252 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 2.19e-08 61 25 5 214 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P04191 2.4e-12 74 29 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 4.62e-10 67 25 12 322 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
O22218 2.76e-12 74 29 7 218 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 1.75e-05 52 23 7 226 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q0VCY0 3.25e-12 74 29 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 2.12e-09 65 25 12 317 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q8R429 4.13e-12 73 29 6 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 2.33e-10 68 25 10 313 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64578 4.31e-12 73 29 6 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 3.45e-10 67 24 10 313 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q92105 4.66e-12 73 30 7 215 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q92105 1.43e-10 68 25 14 341 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
O14983 4.92e-12 73 29 6 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 9.38e-10 66 24 10 314 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
P20647 5.35e-12 73 27 12 318 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 2.23e-11 71 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P13585 5.72e-12 73 29 6 215 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 1.03e-10 69 26 13 334 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
Q9LIK7 5.82e-12 73 30 7 219 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 0.00018 48 21 8 284 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q92036 6.92e-12 73 22 6 272 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 7.85e-05 50 30 4 110 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q03669 7.09e-12 73 29 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 1.3e-10 68 28 12 299 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q7XB51 7.49e-12 73 27 9 301 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 2.06e-10 68 26 3 196 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q6ATV4 1e-11 72 28 7 220 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 3.38e-09 64 25 6 239 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q08853 1.02e-11 72 23 6 267 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 5.71e-10 67 37 5 128 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
B9QMJ0 1.05e-11 72 29 4 214 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
B9QMJ0 3.94e-05 51 23 9 293 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q9HDW7 1.09e-11 72 30 8 216 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 5.05e-07 57 26 9 267 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O34431 1.35e-11 72 32 3 170 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 1.36e-11 72 24 6 275 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q7XEK4 1.38e-11 72 28 9 246 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 1.58e-11 72 28 6 218 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 2e-05 52 25 7 225 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P16615 1.64e-11 72 27 12 318 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 2.12e-11 71 28 6 215 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P11607 1.88e-11 71 27 12 318 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 4.02e-11 70 28 6 215 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q64542 1.99e-11 71 26 8 239 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
Q64542 0.000478 47 31 3 102 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
Q2QMX9 2.23e-11 71 29 8 218 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 8.45e-08 59 23 5 265 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
P11507 2.41e-11 71 27 12 318 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 4.3e-11 70 28 6 215 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
Q00779 2.47e-11 71 27 12 318 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 4.52e-11 70 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
O55143 2.71e-11 71 27 11 298 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 3.79e-11 70 28 6 215 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O46674 2.76e-11 71 27 11 298 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 4.34e-11 70 28 6 215 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
G5E829 3.09e-11 71 26 7 230 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 3.51e-11 70 26 7 230 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
P23634 3.68e-11 70 27 7 239 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
D3K0R6 3.85e-11 70 25 6 221 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
Q16720 3.86e-11 70 25 8 261 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
Q64568 3.93e-11 70 25 8 261 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q2RAS0 4.3e-11 70 30 7 220 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 9.93e-10 66 24 8 274 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
O81108 5.88e-11 70 29 7 219 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 9.49e-11 69 27 8 225 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O75185 6.96e-11 69 23 6 247 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 9.63e-11 69 27 8 232 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q7X8B5 7.94e-11 69 29 9 218 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q6Q477 8.42e-11 69 26 7 234 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
A7L9Z8 8.61e-11 69 28 8 232 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 1.51e-10 68 22 10 305 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P23220 9.52e-11 69 25 7 230 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P20020 9.93e-11 69 25 7 230 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
P22036 1.05e-10 69 30 4 177 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P22036 7.61e-10 66 23 8 337 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P83970 1.06e-10 69 28 3 191 2 ha1 Plasma membrane ATPase Triticum aestivum
P83970 9.46e-09 62 29 6 218 2 ha1 Plasma membrane ATPase Triticum aestivum
Q8R4C1 1.23e-10 68 28 8 232 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 2.06e-10 68 22 9 304 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
O13397 1.57e-10 68 26 7 250 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
P11506 1.57e-10 68 27 7 228 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
C1L360 1.58e-10 68 28 10 253 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 3.79e-10 67 29 3 175 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
P20431 1.62e-10 68 28 3 190 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P20431 1.01e-09 66 28 4 211 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
Q01814 1.71e-10 68 27 7 228 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
Q9R0K7 1.78e-10 68 27 7 228 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q98SH2 2.08e-10 68 25 6 230 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q2QY12 2.21e-10 68 31 8 219 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 1.91e-09 65 24 7 225 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
G5EFR6 2.85e-10 68 27 6 221 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
J9VQQ3 3.77e-10 67 29 7 217 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
O64806 4.34e-10 67 28 7 218 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 6.48e-10 66 28 7 225 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
A0A143ZZK9 7.42e-10 66 27 5 218 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
P22189 8.15e-10 66 28 5 198 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9SZR1 8.96e-10 66 28 8 219 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9LU41 1.14e-09 65 28 7 219 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
O13398 1.53e-09 65 27 6 210 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 2.07e-06 55 24 12 291 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P9WPS4 1.14e-08 62 29 3 197 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 1.29e-08 62 31 7 218 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS5 1.17e-08 62 29 3 197 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 1.59e-08 62 31 7 218 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P58165 3.09e-08 61 25 8 228 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P13587 3.37e-08 61 26 5 188 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13587 0.000621 47 32 3 95 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 4.04e-08 60 26 5 188 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 0.000676 47 32 3 95 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54678 4.27e-08 60 29 3 156 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P54678 1.32e-06 55 23 6 223 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
Q12691 4.39e-08 60 26 5 188 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 0.000682 47 32 3 95 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q58378 9.31e-06 51 32 4 129 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q27533 2.4e-05 52 23 13 365 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
O96185 8.76e-05 50 35 3 70 1 PF3D7_0210200 Uncharacterized protein PF3D7_0210200 Plasmodium falciparum (isolate 3D7)
O96185 0.000199 48 25 3 95 1 PF3D7_0210200 Uncharacterized protein PF3D7_0210200 Plasmodium falciparum (isolate 3D7)
O96185 0.000215 48 35 3 79 1 PF3D7_0210200 Uncharacterized protein PF3D7_0210200 Plasmodium falciparum (isolate 3D7)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07305
Feature type CDS
Gene cadA
Product zinc/cadmium/mercury/lead-transporting ATPase
Location 130188 - 132593 (strand: -1)
Length 2406 (nucleotides) / 801 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_771
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01534 Zn2+/Cd2+-exporting ATPase [EC:7.2.2.12 7.2.2.21] - -

Protein Sequence

MHPNKEHHEHTHTSSCCGSKSACTTGGKSESQAHQTHDHTAHDHSEHEHPEHDDDESRAHGHAPHDHAHSEHDHDHAGHEHAHGSCCSHDHAAPDDTALPELSGSQRYNWQVEGMDCPSCARKIETAVLKIAAVTQAKVMFATEKLVVDAAGDVRADVTSAVQQAGFVLWDLNGGSAAPKKKEEQSLLKQATPMLVLAVLIALSYVLEFVNPVLGKYAFIASTLIGLFPIAKSSLRLIRSGTPFAIETLMTVAAVGAIIIGATEEAAMVILLFLLGEMLESYAAGRARRGVSALMALVPEDAVVIKDGQKVSVPVAQLRPGDIIEIAPGGRLPTDAELLSEFASFDESALTGESVPVERAQGEKVAAGSLSVDRAVQMKVVSEQGQNAIDRILTLIEEAEERRAPIERFIDRFSRYYTPMIMLFSALVIVIPPLFMGQEWYPWIYRGLTLLLIGCPCALVISTPAAITSALAAATRRGALIKGGAALEQLGTVTTVALDKTGTLTEGKPQVTDIVALNNHSDADVLTFASAVESGSHHPLAKAILERTEALGLTITEAENRKAHAGKGVEGELSGVTILVSAPGKLADGLLTDAAAAEVTRLENEGKTVVAVVAGNRLTGLIAMQDTLRSDAIEAISQLKAMGVSAVMLTGDNPRAAAAIAGTIGMDFRAGLMPEDKVKAVMALNNEHHTMMVGDGINDAPAMKAASIGVAMGSGTDVALETADAALTHNRLTGIAEVITLSRATRKIIRENITIALGLKAVFLVTTLMGLTGLWVAVLADSGATALVTANAVRLLRVMKK

Flanking regions ( +/- flanking 50bp)

TGTTAATGAGAAAAATTAACATCAACTCACCGTTGAACAGGGAGGTGTTTATGCACCCGAACAAAGAACATCATGAGCACACTCATACCAGCAGTTGCTGCGGCAGCAAATCTGCCTGCACCACCGGCGGAAAGAGTGAATCACAGGCTCATCAGACACACGACCATACCGCACACGATCACAGTGAGCATGAGCATCCGGAACACGACGACGATGAGTCCCGTGCGCATGGTCATGCCCCGCACGATCATGCGCATTCTGAACACGACCATGACCACGCCGGTCATGAACACGCACACGGCAGCTGCTGTTCACACGATCACGCCGCCCCGGATGATACCGCACTGCCTGAATTAAGCGGCAGCCAGCGTTACAACTGGCAGGTGGAAGGGATGGACTGCCCGAGCTGTGCGCGCAAGATTGAAACTGCTGTCCTGAAAATTGCGGCAGTCACTCAGGCGAAAGTGATGTTTGCCACCGAAAAACTGGTGGTGGATGCCGCCGGGGATGTCCGCGCAGACGTGACCAGTGCCGTGCAGCAGGCCGGATTTGTCCTCTGGGATCTGAACGGCGGCAGCGCCGCACCGAAGAAAAAAGAAGAGCAGAGCCTGCTGAAACAGGCAACGCCAATGCTGGTTCTCGCGGTGCTGATTGCCCTCAGCTATGTGCTGGAGTTTGTGAACCCGGTGCTGGGCAAATACGCCTTTATCGCCTCAACGCTGATCGGGCTGTTCCCGATCGCCAAAAGCTCGCTGCGTCTTATCCGCTCCGGCACCCCGTTTGCGATTGAAACGCTGATGACGGTCGCGGCAGTCGGCGCCATAATTATCGGCGCCACTGAAGAAGCGGCCATGGTTATCCTGCTGTTCCTGCTGGGCGAAATGCTGGAATCCTATGCGGCAGGCCGTGCACGGCGGGGAGTCAGCGCGCTGATGGCGCTGGTGCCGGAAGATGCGGTGGTGATTAAGGACGGGCAGAAAGTATCCGTGCCGGTTGCACAGCTGCGTCCCGGCGACATTATTGAAATCGCACCTGGCGGCCGTCTGCCGACAGATGCCGAACTTCTCAGTGAGTTTGCCAGCTTTGACGAAAGCGCCCTGACCGGGGAATCCGTCCCGGTTGAGCGGGCACAGGGTGAAAAAGTGGCTGCCGGTTCGCTGTCAGTGGATCGCGCAGTGCAGATGAAAGTGGTCTCCGAGCAGGGTCAGAACGCCATCGACCGTATTCTGACACTGATTGAGGAAGCGGAAGAGCGCCGTGCACCAATCGAACGCTTTATCGACCGTTTCAGCCGTTACTATACGCCGATGATCATGCTGTTCTCCGCCCTGGTGATTGTCATTCCGCCGCTGTTTATGGGCCAGGAATGGTATCCGTGGATCTACCGAGGTCTGACACTGCTGCTGATTGGTTGTCCGTGCGCACTGGTAATCTCCACCCCGGCTGCGATTACCTCCGCGCTGGCCGCCGCCACCCGCCGTGGTGCGCTGATCAAAGGTGGTGCCGCACTGGAGCAGTTGGGTACCGTAACCACTGTCGCGCTGGATAAAACCGGTACGCTGACTGAGGGTAAACCGCAGGTGACTGATATTGTTGCCCTGAATAATCACAGTGATGCGGATGTGCTGACGTTTGCCTCCGCCGTGGAAAGCGGGTCACATCACCCGTTAGCCAAAGCAATTCTGGAGCGCACTGAAGCTCTGGGGCTGACTATCACCGAAGCGGAAAACCGCAAAGCCCATGCCGGTAAAGGGGTTGAAGGTGAACTCAGCGGTGTGACCATCCTGGTCAGCGCACCGGGTAAACTGGCAGACGGCCTGCTGACCGATGCCGCTGCGGCAGAAGTGACCCGGCTGGAAAATGAAGGGAAAACAGTCGTTGCTGTGGTTGCAGGTAACCGGCTGACCGGACTTATCGCCATGCAGGATACGCTGCGCAGTGATGCCATTGAAGCCATCAGCCAGCTGAAAGCGATGGGTGTCAGCGCCGTGATGCTGACCGGGGATAACCCGCGTGCAGCCGCTGCTATCGCCGGTACCATCGGCATGGATTTCCGTGCCGGACTGATGCCGGAAGATAAAGTCAAAGCGGTGATGGCGCTGAATAATGAACATCACACCATGATGGTCGGCGACGGTATCAATGATGCCCCGGCAATGAAAGCAGCCAGTATCGGGGTTGCCATGGGCAGCGGGACCGATGTGGCACTGGAAACCGCCGATGCCGCACTGACTCACAACCGCCTGACCGGCATTGCCGAAGTGATCACGCTGTCGCGGGCCACCCGTAAGATTATCCGCGAGAACATTACTATCGCTCTGGGTCTGAAAGCCGTGTTCCTGGTCACCACCCTGATGGGGCTGACCGGCCTGTGGGTTGCGGTTCTGGCTGACTCCGGTGCGACCGCACTGGTGACCGCCAACGCTGTCCGCCTGCTGCGGGTCATGAAAAAATAACCACGGGTTACTGACTGAAAAGGGATGCTGCGGCATCCCTTTTTTTTATC