Homologs in group_1417

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08755 FBDBKF_08755 67.1 Morganella morganii S1 ubiT Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain
EHELCC_12770 EHELCC_12770 67.1 Morganella morganii S2 ubiT Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain
NLDBIP_13110 NLDBIP_13110 67.1 Morganella morganii S4 ubiT Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain
LHKJJB_13445 LHKJJB_13445 67.1 Morganella morganii S3 ubiT Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain
HKOGLL_11585 HKOGLL_11585 67.1 Morganella morganii S5 ubiT Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain
F4V73_RS09970 F4V73_RS09970 65.3 Morganella psychrotolerans - SCP2 domain-containing protein

Distribution of the homologs in the orthogroup group_1417

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1417

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P64599 2.77e-73 221 60 0 169 3 ubiT Ubiquinone biosynthesis accessory factor UbiT Escherichia coli (strain K12)
P64600 2.77e-73 221 60 0 169 3 ubiT Ubiquinone biosynthesis accessory factor UbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P64601 2.77e-73 221 60 0 169 3 ubiT Ubiquinone biosynthesis accessory factor UbiT Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17160
Feature type CDS
Gene -
Product SCP2 domain-containing protein
Location 3774627 - 3775160 (strand: 1)
Length 534 (nucleotides) / 177 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1417
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02036 SCP-2 sterol transfer family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3154 Coenzyme transport and metabolism (H) H Ubiquinone biosynthesis accessory factor UbiT, lipid carrier SCP2 domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K24843 O2-independent ubiquinone biosynthesis accessory factor UbiT - -

Protein Sequence

MFNKIRTRLVKDGPRFLRYPLQITPFALQRDILEQFLSWQFREALAEGDLHFLEDKWLKVEIKDLHLQWFISVCDDKLIVSRSEKEDVSFSGNANDLILIAARKEDPDTLFFQRRLQIEGDTELGLYVKNLMDAIELDSMPSVLRFGLLQLADFVKSGLQDEVEDTAHSHELSSTSC

Flanking regions ( +/- flanking 50bp)

CTATCTATATCTGGCACAATAGCCGCAATTAAATGTTAAGGAGTCCGAAAGTGTTTAATAAAATTCGCACCCGCCTAGTTAAAGATGGCCCTCGTTTCTTGCGTTACCCTTTGCAAATCACGCCATTTGCTTTGCAACGTGATATTTTAGAACAGTTTTTAAGTTGGCAATTCCGCGAAGCATTAGCTGAGGGGGATTTACACTTCTTAGAAGATAAATGGCTAAAGGTAGAAATTAAAGATTTACATTTGCAGTGGTTTATCAGTGTTTGTGATGATAAATTAATCGTAAGCCGTTCTGAAAAAGAAGATGTAAGTTTTAGTGGTAATGCTAACGATCTTATTTTAATTGCCGCGCGTAAAGAAGATCCGGACACCTTGTTTTTCCAACGACGCTTACAAATTGAGGGCGATACAGAACTTGGGTTATATGTTAAGAACCTAATGGATGCAATTGAGTTAGACTCTATGCCATCTGTATTGCGTTTTGGTTTACTACAATTGGCTGATTTTGTGAAAAGTGGCCTTCAAGATGAAGTTGAAGACACCGCACACAGCCATGAACTGAGCTCAACTTCATGCTAATACGTGTTGAAATTCCTGTTGATATTCCTGCTATTGATGATCTTTTACGC