Homologs in group_2368

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19090 FBDBKF_19090 70.4 Morganella morganii S1 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
EHELCC_18835 EHELCC_18835 70.4 Morganella morganii S2 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
NLDBIP_18850 NLDBIP_18850 70.4 Morganella morganii S4 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
LHKJJB_18705 LHKJJB_18705 70.4 Morganella morganii S3 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
HKOGLL_18440 HKOGLL_18440 70.4 Morganella morganii S5 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
F4V73_RS19075 F4V73_RS19075 69.4 Morganella psychrotolerans rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB

Distribution of the homologs in the orthogroup group_2368

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2368

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1L5 0.0 873 100 0 422 3 rsmB Ribosomal RNA small subunit methyltransferase B Proteus mirabilis (strain HI4320)
A8GKG7 0.0 636 71 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Serratia proteamaculans (strain 568)
A1JRZ3 0.0 633 71 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JJH6 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664V2 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TH21 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis (strain Pestoides F)
Q1CCX4 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJ81 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis
B2K506 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2X7 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNK4 0.0 630 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9R925 0.0 629 72 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Angola)
Q3YWX1 0.0 623 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella sonnei (strain Ss046)
B7NLK8 0.0 623 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q31VY8 0.0 622 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella boydii serotype 4 (strain Sb227)
B6I202 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain SE11)
B7M0Z4 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O8 (strain IAI1)
B7N0S9 0.0 621 69 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O81 (strain ED1a)
B7LHZ0 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain 55989 / EAEC)
A7ZSH7 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LGP5 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain SMS-3-5 / SECEC)
B7UK12 0.0 621 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LRQ5 0.0 620 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32B61 0.0 620 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella dysenteriae serotype 1 (strain Sd197)
B2U2Q6 0.0 620 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R644 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain UTI89 / UPEC)
P36929 0.0 619 68 2 429 1 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12)
B1IQ11 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A1AGI0 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O1:K1 / APEC
A8A593 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O9:H4 (strain HS)
B1X6E1 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12 / DH10B)
C4ZUE3 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12 / MC4100 / BW2952)
B7MCQ4 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YT08 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XEE5 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O157:H7
Q0TCH3 0.0 619 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NDR0 0.0 618 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FD12 0.0 618 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T014 0.0 615 68 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella flexneri serotype 5b (strain 8401)
Q7UBD3 0.0 614 67 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella flexneri
B4SUR0 0.0 613 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella newport (strain SL254)
A8AQI3 0.0 612 67 1 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TEU2 0.0 611 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8ZLM5 0.0 611 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TJX9 0.0 611 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella heidelberg (strain SL476)
B5F7R5 0.0 610 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella agona (strain SL483)
Q8Z1X1 0.0 610 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella typhi
B5BGV5 0.0 610 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi A (strain AKU_12601)
C0PZV1 0.0 610 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi C (strain RKS4594)
A9N8B3 0.0 610 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIT6 0.0 610 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57J62 0.0 610 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella choleraesuis (strain SC-B67)
B4TXB2 0.0 609 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella schwarzengrund (strain CVM19633)
Q6D000 0.0 609 68 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5RH47 0.0 609 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1E5 0.0 609 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella enteritidis PT4 (strain P125109)
B5FJI4 0.0 608 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella dublin (strain CT_02021853)
A9MN78 0.0 608 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C6DFR7 0.0 607 67 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5XNC2 0.0 606 66 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Klebsiella pneumoniae (strain 342)
Q7MYI0 0.0 603 70 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MPE7 0.0 600 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Cronobacter sakazakii (strain ATCC BAA-894)
A4WF97 0.0 593 65 1 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Enterobacter sp. (strain 638)
B2VK95 0.0 586 64 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NQQ2 0.0 577 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Sodalis glossinidius (strain morsitans)
Q9KVU5 1.06e-173 495 58 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MGK4 1.69e-171 489 57 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio vulnificus (strain YJ016)
Q8DDE5 2.24e-171 489 57 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio vulnificus (strain CMCP6)
Q87KD3 1.64e-170 487 56 2 423 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P44788 1.07e-156 453 55 5 435 3 rsmB Ribosomal RNA small subunit methyltransferase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CKP7 2.55e-154 446 55 5 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Pasteurella multocida (strain Pm70)
Q8EKR0 3.65e-145 422 52 5 430 3 rsmB Ribosomal RNA small subunit methyltransferase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VKC4 5.63e-140 410 52 6 426 3 rsmB Ribosomal RNA small subunit methyltransferase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q88B41 1.12e-122 366 46 3 416 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P45679 4.94e-121 361 45 5 432 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q88RR3 6.19e-120 358 47 3 417 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I7A9 8.12e-119 356 46 3 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9PEV0 8.51e-96 296 40 3 425 3 rsmB Ribosomal RNA small subunit methyltransferase B Xylella fastidiosa (strain 9a5c)
Q87AR1 1.86e-94 293 39 3 433 3 rsmB Ribosomal RNA small subunit methyltransferase B Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8P4G1 4.11e-88 277 39 5 418 3 rsmB Ribosomal RNA small subunit methyltransferase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PG22 9.44e-88 276 38 5 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Xanthomonas axonopodis pv. citri (strain 306)
P94464 6.74e-70 230 35 13 451 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Bacillus subtilis (strain 168)
P72943 1.23e-63 214 35 9 416 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q922K7 3.15e-31 129 32 13 345 1 Nop2 28S rRNA (cytosine-C(5))-methyltransferase Mus musculus
P9WGX3 4.06e-31 127 30 12 371 1 Rv1407 Putative methyltransferase Rv1407 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGX2 4.06e-31 127 30 12 371 3 MT1451 Putative methyltransferase MT1451 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46087 3.54e-30 126 33 10 283 1 NOP2 28S rRNA (cytosine(4447)-C(5))-methyltransferase Homo sapiens
Q60343 4.22e-25 107 31 8 230 1 trm4 tRNA (cytosine(48)-C(5))-methyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9FG73 5.94e-25 110 30 6 256 1 NOP2A 25S rRNA (cytosine-C(5))-methyltransferase NOP2A Arabidopsis thaliana
Q9TYV5 9.4e-25 110 30 6 260 1 nsun-1 26S rRNA (cytosine-C(5))-methyltransferase nsun-1 Caenorhabditis elegans
Q8VYM6 8.39e-24 107 30 7 256 1 NOP2B 26S rRNA (cytosine-C(5))-methyltransferase NOP2B Arabidopsis thaliana
Q7TS68 2.07e-23 105 31 7 232 2 Nsun6 tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 Mus musculus
Q5SII2 2.26e-23 105 35 2 180 1 rsmF Ribosomal RNA small subunit methyltransferase F Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O57712 5.45e-22 100 31 7 222 1 PH1991 tRNA (cytosine(72)-C(5))-methyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O94268 5.18e-21 99 30 8 237 1 nop2 25S rRNA (cytosine-C(5))-methyltransferase nop2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40991 5.53e-21 99 33 7 211 1 NOP2 25S rRNA (cytosine(2870)-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8TEA1 2.68e-20 96 33 6 199 1 NSUN6 tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 Homo sapiens
Q9V106 1.42e-19 92 33 4 187 1 PYRAB06230 tRNA (cytosine(49)-C(5))-methyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q7MKY6 1.77e-19 93 32 9 220 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio vulnificus (strain YJ016)
Q8D9F3 1.77e-19 93 32 9 220 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio vulnificus (strain CMCP6)
Q87PA5 1.91e-19 93 28 8 273 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5SK01 3.23e-19 92 24 12 400 1 rsmB Ribosomal RNA small subunit methyltransferase B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C3LMI5 5.81e-19 92 33 5 193 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio cholerae serotype O1 (strain M66-2)
Q9KRY1 5.81e-19 92 33 5 193 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A7N0K6 2.2e-18 90 28 8 273 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio campbellii (strain ATCC BAA-1116)
B4TKI0 5.13e-18 89 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella heidelberg (strain SL476)
B5R8V2 5.13e-18 89 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2S1 5.13e-18 89 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella enteritidis PT4 (strain P125109)
B5FTI4 5.13e-18 89 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella dublin (strain CT_02021853)
C6DFU6 6.58e-18 89 30 6 199 3 rsmF Ribosomal RNA small subunit methyltransferase F Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5F3P3 8.34e-18 88 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella agona (strain SL483)
B7VNJ8 1.1e-17 88 32 6 193 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio atlanticus (strain LGP32)
A8GDM6 1.29e-17 88 29 5 197 3 rsmF Ribosomal RNA small subunit methyltransferase F Serratia proteamaculans (strain 568)
B5BHA6 1.53e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi A (strain AKU_12601)
Q5PHN5 1.53e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z662 1.69e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella typhi
C0Q2Y5 1.69e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi C (strain RKS4594)
Q57NF9 1.69e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella choleraesuis (strain SC-B67)
B4SV89 1.77e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella newport (strain SL254)
A9MV57 1.78e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8ZNZ2 1.83e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TY18 1.88e-17 87 28 13 312 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella schwarzengrund (strain CVM19633)
Q6D4C8 1.9e-17 87 29 7 223 3 rsmF Ribosomal RNA small subunit methyltransferase F Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5YQX9 2.43e-17 87 31 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCL9 2.43e-17 87 31 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O157:H7
A7MKH5 2.49e-17 87 31 9 211 3 rsmF Ribosomal RNA small subunit methyltransferase F Cronobacter sakazakii (strain ATCC BAA-894)
Q1RAV2 2.71e-17 87 31 6 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain UTI89 / UPEC)
A1AC00 2.71e-17 87 31 6 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O1:K1 / APEC
B7MBP2 2.71e-17 87 31 6 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FGS9 5.79e-17 86 30 6 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B6IBR3 6.69e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain SE11)
B7M2B1 6.69e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O8 (strain IAI1)
B7L7N7 6.82e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain 55989 / EAEC)
A7ZMV8 6.82e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LPL0 7.61e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B8CPH7 8.48e-17 85 29 9 221 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella piezotolerans (strain WP3 / JCM 13877)
P76273 8.48e-17 85 30 7 218 1 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12)
B1XHA3 8.48e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12 / DH10B)
C4ZZJ2 8.48e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12 / MC4100 / BW2952)
B7USL2 9.04e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3Z2H4 9.21e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella sonnei (strain Ss046)
Q321Y0 9.29e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella boydii serotype 4 (strain Sb227)
B2U477 9.29e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7MVW5 9.73e-17 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O81 (strain ED1a)
B1LD37 1.08e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain SMS-3-5 / SECEC)
B1J0Q3 1.08e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A133 1.08e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O9:H4 (strain HS)
Q0TGZ7 1.09e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NS84 1.22e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q32F19 1.3e-16 85 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella dysenteriae serotype 1 (strain Sd197)
A9MNH4 1.6e-16 84 32 7 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WBJ4 1.7e-16 84 26 14 321 3 rsmF Ribosomal RNA small subunit methyltransferase F Enterobacter sp. (strain 638)
A4SMI9 1.94e-16 84 30 5 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Aeromonas salmonicida (strain A449)
B6ELC0 2.3e-16 84 27 6 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio salmonicida (strain LFI1238)
B1KQN1 2.43e-16 84 30 7 194 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella woodyi (strain ATCC 51908 / MS32)
A8AFL6 2.69e-16 84 30 11 255 3 rsmF Ribosomal RNA small subunit methyltransferase F Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VJ83 3.02e-16 84 30 7 199 3 rsmF Ribosomal RNA small subunit methyltransferase F Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7NBI3 5.37e-16 83 30 7 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A6TB06 6.12e-16 83 27 9 286 3 rsmF Ribosomal RNA small subunit methyltransferase F Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A0KKI5 7.15e-16 82 31 6 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A8H3W2 7.8e-16 82 30 6 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B5FE06 7.85e-16 82 27 6 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio fischeri (strain MJ11)
O14039 9.31e-16 82 28 10 257 3 rcm1 25S rRNA (cytosine-C(5))-methyltransferase rcm1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B5XQ35 1.36e-15 82 30 5 198 3 rsmF Ribosomal RNA small subunit methyltransferase F Klebsiella pneumoniae (strain 342)
Q5E5C7 1.38e-15 82 27 6 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3IHA0 1.84e-15 81 30 7 194 3 rsmF Ribosomal RNA small subunit methyltransferase F Pseudoalteromonas translucida (strain TAC 125)
Q9W4M9 2e-15 82 37 7 157 2 Nsun2 tRNA (cytosine(34)-C(5))-methyltransferase Drosophila melanogaster
A8FWM8 2.09e-15 81 28 12 286 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sediminis (strain HAW-EB3)
B0TIZ6 2.8e-15 81 25 11 310 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella halifaxensis (strain HAW-EB4)
Q081I3 4.84e-15 80 26 8 272 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella frigidimarina (strain NCIMB 400)
Q6LQU5 5.22e-15 80 28 6 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Photobacterium profundum (strain SS9)
Q5ZLV4 6.81e-15 80 32 5 179 2 NSUN2 RNA cytosine-C(5)-methyltransferase NSUN2 Gallus gallus
Q83RJ3 9.82e-15 79 28 5 217 5 rsmF Putative ribosomal RNA small subunit methyltransferase F Shigella flexneri
Q0T529 9.82e-15 79 28 5 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella flexneri serotype 5b (strain 8401)
A1SWV0 1.65e-14 78 28 8 204 3 rsmF Ribosomal RNA small subunit methyltransferase F Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q28E61 3.43e-14 78 32 5 174 2 nsun2 RNA cytosine-C(5)-methyltransferase NSUN2 Xenopus tropicalis
Q1HFZ0 6.11e-14 77 32 5 174 1 Nsun2 RNA cytosine C(5)-methyltransferase NSUN2 Mus musculus
Q9NAA7 7.51e-14 76 26 20 388 1 nsun-5 26S rRNA (cytosine-C(5))-methyltransferase nsun-5 Caenorhabditis elegans
Q4V7N2 1.37e-13 76 32 5 174 2 nsun2 RNA cytosine-C(5)-methyltransferase NSUN2 Xenopus laevis
Q4KMK0 1.59e-13 75 25 13 339 2 nsun3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Danio rerio
Q0HJM6 2.66e-13 75 26 6 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain MR-4)
A3QDA2 3.31e-13 74 25 7 222 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S788 3.73e-13 74 25 12 274 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q08J23 3.78e-13 75 32 6 182 1 NSUN2 RNA cytosine C(5)-methyltransferase NSUN2 Homo sapiens
A1RIZ0 3.92e-13 74 28 6 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain W3-18-1)
A4Y7J8 3.92e-13 74 28 6 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EDY2 5.12e-13 73 26 6 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8K4F6 5.13e-13 73 27 9 255 1 Nsun5 28S rRNA (cytosine-C(5))-methyltransferase Mus musculus
A0KW34 5.18e-13 73 26 6 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain ANA-3)
Q0HVX2 5.36e-13 73 26 6 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain MR-7)
A6WP46 5.62e-13 73 26 5 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS185)
Q96P11 5.93e-13 73 26 13 311 1 NSUN5 28S rRNA (cytosine-C(5))-methyltransferase Homo sapiens
A9L4E6 6.78e-13 73 26 5 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS195)
A3D5D5 6.84e-13 73 26 5 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E968 1e-12 73 26 5 192 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS223)
Q8CCT7 1.12e-12 72 26 9 282 2 Nsun3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Mus musculus
Q0P5D8 1.45e-12 72 25 9 289 2 NSUN3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Bos taurus
Q9H649 3.88e-12 70 26 8 281 1 NSUN3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Homo sapiens
P38205 4.08e-12 71 32 6 171 1 NCL1 Multisite-specific tRNA:(cytosine-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HGQ2 4.36e-12 71 29 5 179 1 trm4a Multisite-specific tRNA:(cytosine-C(5))-methyltransferase trm4a Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12MJ8 4.83e-12 71 24 9 285 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8GYE8 2.22e-11 69 26 10 258 1 NSUN5 25S rRNA (cytosine-C(5))-methyltransferase NSUN5 Arabidopsis thaliana
O13935 9.45e-11 67 32 6 183 1 trm4b Multisite-specific tRNA:(cytosine-C(5))-methyltransferase trm4b Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q66KI9 9.86e-11 66 31 3 145 2 nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Xenopus tropicalis
Q9CZ57 6.64e-10 63 31 4 147 1 Nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Mus musculus
Q0V8R7 9.19e-10 63 31 4 147 2 NSUN4 5-methylcytosine rRNA methyltransferase NSUN4 Bos taurus
Q5M7E3 1.48e-09 63 30 3 142 2 nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Xenopus laevis
Q9VDZ4 3.73e-09 62 26 9 223 2 Nsun5 28S rRNA (cytosine-C(5))-methyltransferase Drosophila melanogaster
Q96CB9 3.99e-09 61 31 4 147 1 NSUN4 5-methylcytosine rRNA methyltransferase NSUN4 Homo sapiens
P53972 1.05e-07 57 24 15 305 1 RCM1 25S rRNA (cytosine(2278)-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q95XR2 1.25e-06 54 27 4 154 1 nsun-4 5-methylcytosine rRNA methyltransferase nsun-4 Caenorhabditis elegans
Q84MA1 0.000101 48 39 1 68 2 NOP2C rRNA (cytosine-C(5))-methyltransferase NOP2C Arabidopsis thaliana
Q84MA1 0.000191 47 43 1 62 2 NOP2C rRNA (cytosine-C(5))-methyltransferase NOP2C Arabidopsis thaliana
Q89K81 0.000482 44 30 2 90 3 nusB Transcription antitermination protein NusB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q214H2 0.000736 43 27 4 134 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain BisB18)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16300
Feature type CDS
Gene rsmB
Product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
Location 3599012 - 3600280 (strand: -1)
Length 1269 (nucleotides) / 422 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2368
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01029 NusB family
PF01189 16S rRNA methyltransferase RsmB/F
PF22458 Methyltr_RsmF/B-like, ferredoxin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0144 Translation, ribosomal structure and biogenesis (J) J 16S rRNA C967 or C1407 C5-methylase, RsmB/RsmF family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03500 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] - -

Protein Sequence

MKTSYNLRSIAAKAIAQVLDQGLSLSSVIPELQKNISDKDKALLQELCFGTLRTLPQLEWIIQQLMDKPLKGKQRILHYLIMVGLYQLLYTRVPAHAALAETVNGAIALKKPQLKGLINGVLRQFQRQQDVLMERFQNNDSRYLHPSWLLTRIKNAYPELWESIIEGNNQKPPMWLRVNQIHHSREQYLALLEKEGISAFSDDHHPNAIRLETPCNVHLLPGFNEGWVTVQDRSAQRCAELLAPQNNEQILDLCAAPGGKTTHILEIAPKAHVLAIDIDEQRLARVKENLNRLKLHATVKSGDGRYPEQWCANMQFDRILLDAPCSATGVIRRHPDIKWLRRNEDIAQLAQIQKEILHAIWPYLKSGGTLVYATCSILPEENSQQIAAFLSSMQDAQCDYQHQCLPEQYSGDGFFYALINKK

Flanking regions ( +/- flanking 50bp)

ACGCCAATATTATTCTTCTCTGGCGGCCAATATATAAACGCTAATTCACTATGAAAACGTCATACAACTTACGCAGTATTGCAGCAAAGGCAATAGCTCAAGTTTTAGATCAAGGCTTATCATTAAGTTCGGTGATCCCTGAATTACAAAAAAACATTTCAGATAAAGACAAAGCGCTCTTGCAAGAGCTCTGCTTTGGTACCTTACGTACCTTACCCCAGCTAGAATGGATCATCCAACAACTAATGGATAAACCACTGAAAGGTAAACAACGAATTTTACATTACCTCATTATGGTCGGTTTATATCAGCTCCTTTATACTCGAGTTCCTGCCCATGCAGCACTCGCTGAAACTGTTAATGGTGCGATCGCACTGAAAAAACCACAATTAAAAGGGTTAATTAACGGTGTATTACGCCAATTTCAGCGTCAACAAGATGTATTAATGGAACGTTTCCAAAATAATGATAGCCGCTATTTGCACCCTTCTTGGTTACTCACACGAATAAAAAACGCCTACCCTGAGCTATGGGAAAGTATTATTGAAGGAAATAACCAAAAGCCACCAATGTGGTTACGGGTAAATCAAATACATCATTCACGTGAACAGTACTTAGCGCTGCTTGAAAAAGAAGGGATCAGCGCGTTCTCCGATGACCACCATCCCAATGCTATTCGTTTAGAAACACCTTGTAATGTTCACCTGTTACCAGGGTTTAATGAGGGCTGGGTCACTGTTCAAGACCGCAGCGCTCAGCGTTGTGCAGAATTATTAGCGCCACAAAATAACGAACAAATTCTTGATTTATGTGCAGCCCCTGGGGGAAAAACAACCCATATCTTAGAAATAGCCCCTAAAGCGCATGTTCTCGCCATTGATATCGATGAGCAACGTTTAGCCAGAGTTAAAGAAAATCTAAACCGCTTAAAACTACATGCCACAGTCAAAAGTGGTGATGGACGTTATCCAGAGCAATGGTGTGCAAATATGCAATTTGACAGGATCTTACTTGATGCTCCTTGCTCAGCAACTGGCGTTATACGTCGCCATCCAGATATCAAATGGCTACGTCGTAATGAAGACATAGCTCAGTTAGCGCAAATTCAAAAAGAAATATTACATGCTATATGGCCATACCTAAAATCAGGCGGCACATTAGTTTATGCTACTTGTTCTATTTTACCGGAAGAAAATAGCCAACAAATTGCAGCCTTCTTATCGTCAATGCAAGATGCTCAATGTGACTATCAGCATCAATGCTTACCGGAGCAATATAGCGGTGATGGCTTCTTTTATGCGCTGATCAACAAAAAATGATCTTCTGATAAAAGATGATATCAGATCTAAAAGAAGCTACTATTCCAACA