Homologs in group_2401

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19090 FBDBKF_19090 100.0 Morganella morganii S1 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
EHELCC_18835 EHELCC_18835 100.0 Morganella morganii S2 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
NLDBIP_18850 NLDBIP_18850 100.0 Morganella morganii S4 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
HKOGLL_18440 HKOGLL_18440 100.0 Morganella morganii S5 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
F4V73_RS19075 F4V73_RS19075 89.0 Morganella psychrotolerans rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
PMI_RS16300 PMI_RS16300 70.4 Proteus mirabilis HI4320 rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB

Distribution of the homologs in the orthogroup group_2401

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2401

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D000 0.0 640 70 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DFR7 0.0 634 69 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GKG7 0.0 625 70 1 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Serratia proteamaculans (strain 568)
A9R925 0.0 625 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Angola)
B4F1L5 0.0 624 69 1 426 3 rsmB Ribosomal RNA small subunit methyltransferase B Proteus mirabilis (strain HI4320)
B1JJH6 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664V2 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TH21 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis (strain Pestoides F)
Q1CCX4 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJ81 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis
B2K506 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2X7 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNK4 0.0 623 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JRZ3 0.0 621 69 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TEU2 0.0 607 67 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XNC2 0.0 606 67 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Klebsiella pneumoniae (strain 342)
A7MPE7 0.0 601 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Cronobacter sakazakii (strain ATCC BAA-894)
A4WF97 0.0 600 67 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Enterobacter sp. (strain 638)
A8AQI3 0.0 598 67 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4SUR0 0.0 596 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella newport (strain SL254)
Q8ZLM5 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PZV1 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi C (strain RKS4594)
A9N8B3 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TJX9 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella heidelberg (strain SL476)
Q57J62 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella choleraesuis (strain SC-B67)
B4TXB2 0.0 595 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella schwarzengrund (strain CVM19633)
B5BGV5 0.0 594 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi A (strain AKU_12601)
Q5PIT6 0.0 594 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RH47 0.0 594 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1E5 0.0 594 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella enteritidis PT4 (strain P125109)
B5FJI4 0.0 594 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella dublin (strain CT_02021853)
Q3YWX1 0.0 593 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella sonnei (strain Ss046)
Q31VY8 0.0 593 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella boydii serotype 4 (strain Sb227)
B5F7R5 0.0 593 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella agona (strain SL483)
Q8Z1X1 0.0 592 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella typhi
B7UK12 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2U2Q6 0.0 592 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LGP5 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain SMS-3-5 / SECEC)
B6I202 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain SE11)
B7M0Z4 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O8 (strain IAI1)
B7LHZ0 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain 55989 / EAEC)
A7ZSH7 0.0 592 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MN78 0.0 591 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P36929 0.0 590 65 2 429 1 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12)
B1IQ11 0.0 590 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A593 0.0 590 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O9:H4 (strain HS)
B1X6E1 0.0 590 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12 / DH10B)
C4ZUE3 0.0 590 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain K12 / MC4100 / BW2952)
Q32B61 0.0 589 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella dysenteriae serotype 1 (strain Sd197)
B5YT08 0.0 589 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XEE5 0.0 589 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O157:H7
B7LRQ5 0.0 588 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NLK8 0.0 588 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7N0S9 0.0 587 66 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O81 (strain ED1a)
B7NDR0 0.0 586 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0T014 0.0 585 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella flexneri serotype 5b (strain 8401)
Q7UBD3 0.0 585 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Shigella flexneri
Q1R644 0.0 585 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli (strain UTI89 / UPEC)
A1AGI0 0.0 585 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O1:K1 / APEC
B7MCQ4 0.0 585 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0TCH3 0.0 584 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FD12 0.0 583 65 2 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2VK95 0.0 582 65 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NQQ2 0.0 578 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Sodalis glossinidius (strain morsitans)
Q7MYI0 0.0 575 67 1 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KVU5 2.22e-170 487 57 2 424 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DDE5 7.9e-170 486 56 2 425 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio vulnificus (strain CMCP6)
Q7MGK4 9.94e-170 485 56 2 425 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio vulnificus (strain YJ016)
Q87KD3 1.19e-167 480 55 2 423 3 rsmB Ribosomal RNA small subunit methyltransferase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CKP7 3.52e-157 454 57 7 431 3 rsmB Ribosomal RNA small subunit methyltransferase B Pasteurella multocida (strain Pm70)
P44788 3.98e-155 449 53 7 444 3 rsmB Ribosomal RNA small subunit methyltransferase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8EKR0 2.58e-144 421 51 5 430 3 rsmB Ribosomal RNA small subunit methyltransferase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VKC4 1.04e-139 409 52 6 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q88B41 1.19e-118 356 47 4 418 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88RR3 4.71e-117 352 47 3 419 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45679 7.36e-116 348 43 5 432 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q9I7A9 6.47e-114 343 46 3 429 3 rsmB Ribosomal RNA small subunit methyltransferase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87AR1 1.35e-100 309 42 5 436 3 rsmB Ribosomal RNA small subunit methyltransferase B Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PG22 1.79e-100 309 42 6 430 3 rsmB Ribosomal RNA small subunit methyltransferase B Xanthomonas axonopodis pv. citri (strain 306)
Q9PEV0 4.06e-100 308 42 5 428 3 rsmB Ribosomal RNA small subunit methyltransferase B Xylella fastidiosa (strain 9a5c)
Q8P4G1 2.81e-95 296 42 6 420 3 rsmB Ribosomal RNA small subunit methyltransferase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P72943 3.09e-67 224 35 8 411 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94464 2.6e-56 195 32 12 452 3 rsmB Probable ribosomal RNA small subunit methyltransferase B Bacillus subtilis (strain 168)
P9WGX3 1.87e-31 128 31 13 411 1 Rv1407 Putative methyltransferase Rv1407 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGX2 1.87e-31 128 31 13 411 3 MT1451 Putative methyltransferase MT1451 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q922K7 8.96e-29 122 34 9 282 1 Nop2 28S rRNA (cytosine-C(5))-methyltransferase Mus musculus
Q5SII2 5.53e-28 118 33 8 264 1 rsmF Ribosomal RNA small subunit methyltransferase F Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P46087 1.43e-27 119 32 10 282 1 NOP2 28S rRNA (cytosine(4447)-C(5))-methyltransferase Homo sapiens
O57712 1.31e-25 110 32 6 220 1 PH1991 tRNA (cytosine(72)-C(5))-methyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q60343 4.93e-25 106 31 5 198 1 trm4 tRNA (cytosine(48)-C(5))-methyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P40991 5.45e-25 110 35 7 237 1 NOP2 25S rRNA (cytosine(2870)-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9V106 2.44e-24 105 32 6 234 1 PYRAB06230 tRNA (cytosine(49)-C(5))-methyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q9TYV5 2.85e-24 108 29 9 316 1 nsun-1 26S rRNA (cytosine-C(5))-methyltransferase nsun-1 Caenorhabditis elegans
Q9FG73 5e-24 108 31 6 239 1 NOP2A 25S rRNA (cytosine-C(5))-methyltransferase NOP2A Arabidopsis thaliana
Q8VYM6 6.07e-24 108 31 4 238 1 NOP2B 26S rRNA (cytosine-C(5))-methyltransferase NOP2B Arabidopsis thaliana
O94268 8.22e-24 107 32 7 238 1 nop2 25S rRNA (cytosine-C(5))-methyltransferase nop2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B5F3P3 2.77e-23 105 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella agona (strain SL483)
B5BHA6 3.34e-23 105 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi A (strain AKU_12601)
Q5PHN5 3.34e-23 105 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z662 3.54e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella typhi
C0Q2Y5 3.67e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi C (strain RKS4594)
Q57NF9 3.67e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella choleraesuis (strain SC-B67)
B4SV89 3.85e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella newport (strain SL254)
B4TY18 3.92e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella schwarzengrund (strain CVM19633)
Q8ZNZ2 4.04e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MV57 4.6e-23 104 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TKI0 8.82e-23 103 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella heidelberg (strain SL476)
B5R8V2 8.82e-23 103 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2S1 8.82e-23 103 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella enteritidis PT4 (strain P125109)
B5FTI4 8.82e-23 103 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella dublin (strain CT_02021853)
Q7MKY6 1.03e-22 103 31 4 199 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio vulnificus (strain YJ016)
Q8D9F3 1.03e-22 103 31 4 199 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio vulnificus (strain CMCP6)
A8GDM6 1.21e-22 103 31 6 218 3 rsmF Ribosomal RNA small subunit methyltransferase F Serratia proteamaculans (strain 568)
B7LPL0 1.25e-22 103 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6TB06 1.76e-22 102 34 8 221 3 rsmF Ribosomal RNA small subunit methyltransferase F Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B6ELC0 1.76e-22 102 31 5 219 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio salmonicida (strain LFI1238)
B2VJ83 1.98e-22 102 33 5 195 3 rsmF Ribosomal RNA small subunit methyltransferase F Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q321Y0 2.21e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella boydii serotype 4 (strain Sb227)
B2U477 2.21e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z2H4 2.32e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella sonnei (strain Ss046)
P76273 2.34e-22 102 34 9 225 1 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12)
B1XHA3 2.34e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12 / DH10B)
C4ZZJ2 2.34e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain K12 / MC4100 / BW2952)
B6IBR3 2.57e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain SE11)
B7M2B1 2.57e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O8 (strain IAI1)
B7L7N7 2.6e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain 55989 / EAEC)
A7ZMV8 2.6e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MVW5 2.69e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O81 (strain ED1a)
B7NBI3 3.47e-22 102 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5FE06 3.74e-22 101 28 9 305 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio fischeri (strain MJ11)
B1J0Q3 4.68e-22 101 34 10 228 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A133 4.68e-22 101 34 10 228 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O9:H4 (strain HS)
Q8FGS9 5.1e-22 101 34 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9MNH4 5.81e-22 101 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7USL2 7.69e-22 100 34 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TGZ7 8.06e-22 100 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LD37 9.54e-22 100 34 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain SMS-3-5 / SECEC)
B7NS84 1.01e-21 100 34 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A4WBJ4 1.01e-21 100 32 8 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Enterobacter sp. (strain 638)
Q87PA5 1.19e-21 100 27 8 303 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MKH5 1.31e-21 100 33 8 227 3 rsmF Ribosomal RNA small subunit methyltransferase F Cronobacter sakazakii (strain ATCC BAA-894)
B5XQ35 1.34e-21 100 34 9 221 3 rsmF Ribosomal RNA small subunit methyltransferase F Klebsiella pneumoniae (strain 342)
Q3IHA0 1.41e-21 100 31 7 220 3 rsmF Ribosomal RNA small subunit methyltransferase F Pseudoalteromonas translucida (strain TAC 125)
A8AFL6 1.44e-21 100 34 9 221 3 rsmF Ribosomal RNA small subunit methyltransferase F Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7N0K6 1.96e-21 99 29 6 227 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio campbellii (strain ATCC BAA-1116)
B5YQX9 2.15e-21 99 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCL9 2.15e-21 99 34 9 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O157:H7
A4SMI9 2.21e-21 99 34 4 197 3 rsmF Ribosomal RNA small subunit methyltransferase F Aeromonas salmonicida (strain A449)
Q32F19 2.56e-21 99 35 11 225 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella dysenteriae serotype 1 (strain Sd197)
Q83RJ3 3.46e-21 99 33 7 224 5 rsmF Putative ribosomal RNA small subunit methyltransferase F Shigella flexneri
Q0T529 3.46e-21 99 33 7 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Shigella flexneri serotype 5b (strain 8401)
B7VNJ8 4.33e-21 98 27 8 304 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio atlanticus (strain LGP32)
A1S788 4.34e-21 98 29 10 274 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1RAV2 5.35e-21 98 33 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli (strain UTI89 / UPEC)
A1AC00 5.35e-21 98 33 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O1:K1 / APEC
B7MBP2 5.35e-21 98 33 9 224 3 rsmF Ribosomal RNA small subunit methyltransferase F Escherichia coli O45:K1 (strain S88 / ExPEC)
Q5E5C7 9.22e-21 97 27 8 305 3 rsmF Ribosomal RNA small subunit methyltransferase F Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7TS68 2.22e-20 96 33 9 220 2 Nsun6 tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 Mus musculus
C6DFU6 3.45e-20 95 33 9 221 3 rsmF Ribosomal RNA small subunit methyltransferase F Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q5SK01 3.49e-20 95 28 11 339 1 rsmB Ribosomal RNA small subunit methyltransferase B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A0KKI5 5.09e-20 95 34 4 197 3 rsmF Ribosomal RNA small subunit methyltransferase F Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6LQU5 6.33e-20 95 32 6 219 3 rsmF Ribosomal RNA small subunit methyltransferase F Photobacterium profundum (strain SS9)
A3QDA2 2.7e-19 93 30 5 207 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella loihica (strain ATCC BAA-1088 / PV-4)
C3LMI5 7.33e-19 92 28 5 229 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio cholerae serotype O1 (strain M66-2)
Q9KRY1 7.33e-19 92 28 5 229 3 rsmF Ribosomal RNA small subunit methyltransferase F Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6D4C8 8.14e-19 92 32 7 217 3 rsmF Ribosomal RNA small subunit methyltransferase F Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8TEA1 1.63e-18 90 35 4 162 1 NSUN6 tRNA (cytosine(72)-C(5))-methyltransferase NSUN6 Homo sapiens
A8H3W2 2.19e-18 90 30 4 200 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q081I3 4.01e-18 89 29 6 220 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella frigidimarina (strain NCIMB 400)
B8CPH7 6.37e-18 89 30 7 219 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella piezotolerans (strain WP3 / JCM 13877)
A1SWV0 1.32e-17 88 28 6 232 3 rsmF Ribosomal RNA small subunit methyltransferase F Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1RIZ0 2.98e-17 87 31 6 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain W3-18-1)
A4Y7J8 2.98e-17 87 31 6 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12MJ8 4.14e-17 87 25 7 291 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0HJM6 1.14e-16 85 30 7 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain MR-4)
A8FWM8 1.57e-16 85 31 7 199 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sediminis (strain HAW-EB3)
A0KW34 2.32e-16 84 29 6 201 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain ANA-3)
Q0HVX2 2.73e-16 84 29 6 201 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella sp. (strain MR-7)
Q66KI9 2.75e-16 84 34 4 154 2 nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Xenopus tropicalis
B1KQN1 3.05e-16 84 31 7 204 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella woodyi (strain ATCC 51908 / MS32)
Q5ZLV4 6.65e-16 83 31 5 195 2 NSUN2 RNA cytosine-C(5)-methyltransferase NSUN2 Gallus gallus
A9L4E6 8.49e-16 82 31 7 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS195)
A3D5D5 9.13e-16 82 31 7 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS155 / ATCC BAA-1091)
B0TIZ6 1.12e-15 82 29 5 194 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella halifaxensis (strain HAW-EB4)
A6WP46 1.26e-15 82 31 7 194 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS185)
B8E968 1.47e-15 82 31 7 196 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella baltica (strain OS223)
Q9H649 2.64e-15 80 33 4 176 1 NSUN3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Homo sapiens
Q8EDY2 2.95e-15 80 30 7 202 3 rsmF Ribosomal RNA small subunit methyltransferase F Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9W4M9 3.06e-15 81 32 5 176 2 Nsun2 tRNA (cytosine(34)-C(5))-methyltransferase Drosophila melanogaster
Q0P5D8 3.07e-15 80 32 4 176 2 NSUN3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Bos taurus
Q8CCT7 7.05e-15 79 32 5 175 2 Nsun3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Mus musculus
Q4KMK0 9.86e-15 78 25 13 359 2 nsun3 tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial Danio rerio
Q5M7E3 1.29e-14 78 32 4 155 2 nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Xenopus laevis
P38205 2.01e-14 79 27 9 274 1 NCL1 Multisite-specific tRNA:(cytosine-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1HFZ0 5.31e-14 77 30 7 211 1 Nsun2 RNA cytosine C(5)-methyltransferase NSUN2 Mus musculus
Q08J23 6.11e-14 77 30 5 195 1 NSUN2 RNA cytosine C(5)-methyltransferase NSUN2 Homo sapiens
Q9HGQ2 7.35e-14 77 30 5 195 1 trm4a Multisite-specific tRNA:(cytosine-C(5))-methyltransferase trm4a Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0V8R7 1.64e-13 75 34 4 149 2 NSUN4 5-methylcytosine rRNA methyltransferase NSUN4 Bos taurus
Q4V7N2 1.73e-13 76 32 5 175 2 nsun2 RNA cytosine-C(5)-methyltransferase NSUN2 Xenopus laevis
Q28E61 2.35e-13 75 29 8 223 2 nsun2 RNA cytosine-C(5)-methyltransferase NSUN2 Xenopus tropicalis
Q9CZ57 3.6e-13 74 34 4 150 1 Nsun4 5-methylcytosine rRNA methyltransferase NSUN4 Mus musculus
O13935 3.55e-12 72 31 5 192 1 trm4b Multisite-specific tRNA:(cytosine-C(5))-methyltransferase trm4b Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q96CB9 4.31e-12 70 33 4 149 1 NSUN4 5-methylcytosine rRNA methyltransferase NSUN4 Homo sapiens
Q95XR2 9.54e-12 70 25 5 238 1 nsun-4 5-methylcytosine rRNA methyltransferase nsun-4 Caenorhabditis elegans
Q96P11 6.61e-11 67 26 8 257 1 NSUN5 28S rRNA (cytosine-C(5))-methyltransferase Homo sapiens
Q9NAA7 5.83e-10 64 27 8 209 1 nsun-5 26S rRNA (cytosine-C(5))-methyltransferase nsun-5 Caenorhabditis elegans
O14039 3.16e-09 62 25 14 297 3 rcm1 25S rRNA (cytosine-C(5))-methyltransferase rcm1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9VDZ4 8.4e-09 60 26 12 307 2 Nsun5 28S rRNA (cytosine-C(5))-methyltransferase Drosophila melanogaster
Q8GYE8 1.21e-08 60 26 9 234 1 NSUN5 25S rRNA (cytosine-C(5))-methyltransferase NSUN5 Arabidopsis thaliana
Q8K4F6 1.5e-08 60 30 8 182 1 Nsun5 28S rRNA (cytosine-C(5))-methyltransferase Mus musculus
Q84MA1 1.45e-06 54 33 2 109 2 NOP2C rRNA (cytosine-C(5))-methyltransferase NOP2C Arabidopsis thaliana
P53972 6.07e-05 48 21 10 269 1 RCM1 25S rRNA (cytosine(2278)-C(5))-methyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q214H2 7.1e-05 46 31 2 94 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain BisB18)
A6W2L6 0.000105 46 25 3 147 3 nusB Transcription antitermination protein NusB Marinomonas sp. (strain MWYL1)
Q136T4 0.000178 45 30 2 94 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain BisB5)
Q2IWR9 0.00019 45 31 2 94 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain HaA2)
Q6N688 0.000558 44 29 2 94 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QJK9 0.00074 43 29 2 94 3 nusB Transcription antitermination protein NusB Rhodopseudomonas palustris (strain TIE-1)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_18705
Feature type CDS
Gene rsmB
Product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
Location 5740 - 7032 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)
In genomic island -

Contig

Accession ZDB_385
Length 24827 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2401
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01029 NusB family
PF01189 16S rRNA methyltransferase RsmB/F
PF22458 Methyltr_RsmF/B-like, ferredoxin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0144 Translation, ribosomal structure and biogenesis (J) J 16S rRNA C967 or C1407 C5-methylase, RsmB/RsmF family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03500 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] - -

Protein Sequence

MKNSYNLRSIAARIISQVLDQGQSLSALLPEYQRDINPKDKALLQELCFGVMRVLPELEWYSQQLMAKPLTGKQRVLHYLILVGFYQLRYTRIPAHAALSETVDGAVALKKPQLKGLINGVLRQFQRQEQVLSERFANNESRWLHPKWLLSRIQAAYPDNWEAVITANNEKPPMWLRVNRNHHSAQEYQALLTEKDIEAFYNPAYPDALRLAVPCPVTDLPGFADGWVTVQDSSAQGCALLLDPQNDETILDLCAAPGGKTTHILEIAPRAHVMAVDVDKQRLTRVNENLQRLKQNAVVKTGDGRYPEQWAESQTFDRILLDAPCSATGVIRRHPDIKWLRRDNDINELAALQREILDAVWPYLKPGGTLVYATCSVLPEENIHQINNFLSSHRDAVLTDTPATGYQMLPDAQSGDGFFYAKLVKQALPA

Flanking regions ( +/- flanking 50bp)

TATGCCGGTCTCCCTTTCTCTTTATCGCTTGCCGGCATACCGGAATCACAATGAAAAACAGCTATAACTTACGCAGCATTGCTGCCCGTATCATCAGCCAGGTCCTGGATCAGGGACAGTCACTCAGCGCACTTCTGCCTGAATATCAGCGGGATATCAACCCGAAAGATAAAGCATTACTGCAGGAATTATGTTTTGGTGTGATGCGGGTGCTGCCGGAGCTTGAATGGTACAGCCAGCAGCTGATGGCAAAACCGCTGACCGGTAAGCAGCGGGTACTGCATTATCTGATTCTGGTCGGTTTTTATCAGCTCCGTTATACACGGATCCCGGCACACGCAGCACTATCCGAAACGGTTGACGGTGCTGTGGCACTGAAAAAACCACAGCTGAAAGGACTGATTAACGGCGTGCTGCGTCAGTTCCAGCGTCAGGAGCAGGTGTTGTCCGAGCGTTTTGCTAATAATGAAAGCCGCTGGCTGCATCCGAAATGGCTGCTGTCGCGGATTCAGGCGGCATATCCTGACAACTGGGAAGCTGTTATTACGGCAAATAATGAAAAACCGCCGATGTGGCTACGGGTTAACCGTAACCATCATTCCGCTCAGGAATATCAGGCGCTGCTGACAGAGAAGGATATTGAAGCCTTTTATAATCCGGCATATCCGGATGCACTGCGTCTGGCAGTTCCCTGCCCGGTCACTGATCTGCCGGGGTTTGCCGATGGCTGGGTCACCGTGCAGGACAGCTCCGCTCAGGGCTGTGCATTACTACTTGATCCGCAGAATGATGAGACTATTTTAGATTTGTGCGCGGCACCCGGCGGGAAGACCACCCACATTTTAGAGATAGCGCCCCGCGCTCATGTCATGGCTGTTGATGTGGATAAACAGCGTTTAACCCGGGTTAATGAGAATTTACAACGACTTAAACAAAACGCGGTGGTGAAAACCGGTGACGGCCGTTATCCGGAGCAATGGGCAGAATCGCAGACATTTGATCGCATTTTGCTGGATGCACCTTGCTCCGCGACCGGCGTTATCCGCCGCCATCCGGACATTAAATGGTTGCGCCGTGATAATGACATTAATGAGCTGGCTGCACTGCAACGGGAAATTCTGGACGCTGTCTGGCCTTATCTCAAACCCGGCGGCACACTGGTCTATGCAACCTGCTCGGTATTACCGGAAGAGAATATTCATCAGATAAATAATTTCCTCTCTTCGCACCGTGATGCTGTATTAACCGATACACCGGCAACAGGCTACCAGATGCTGCCGGATGCGCAGAGCGGAGACGGATTTTTTTACGCTAAACTGGTTAAACAGGCACTTCCTGCCTGATAAACAACCCGGACGATCATTTATATGAAAATTATTATTCTCGGTGCCGG