Homologs in group_249

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05350 FBDBKF_05350 61.9 Morganella morganii S1 wcaG Nucleoside-diphosphate-sugar epimerase
EHELCC_12240 EHELCC_12240 61.9 Morganella morganii S2 wcaG Nucleoside-diphosphate-sugar epimerase
NLDBIP_12580 NLDBIP_12580 61.9 Morganella morganii S4 wcaG Nucleoside-diphosphate-sugar epimerase
LHKJJB_12440 LHKJJB_12440 61.9 Morganella morganii S3 wcaG Nucleoside-diphosphate-sugar epimerase
HKOGLL_11055 HKOGLL_11055 61.9 Morganella morganii S5 wcaG Nucleoside-diphosphate-sugar epimerase
F4V73_RS05805 F4V73_RS05805 62.2 Morganella psychrotolerans - NAD-dependent epimerase
PMI_RS07210 PMI_RS07210 66.0 Proteus mirabilis HI4320 - NAD-dependent epimerase

Distribution of the homologs in the orthogroup group_249

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_249

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q04871 1.61e-168 474 67 1 335 3 None Uncharacterized 37.6 kDa protein in cld 5'region Escherichia coli O111:H-
P39858 5.74e-146 417 58 1 334 3 capI Protein CapI Staphylococcus aureus
B9J8R3 6.07e-126 367 52 2 336 1 lpsL UDP-glucuronate 4-epimerase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
O54067 3.18e-121 355 51 1 335 3 lspL Probable UDP-glucuronate 4-epimerase Rhizobium meliloti (strain 1021)
Q58455 4.43e-105 313 48 4 334 3 MJ1055 Uncharacterized protein MJ1055 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O22141 7.68e-103 311 49 7 338 1 GAE4 UDP-glucuronate 4-epimerase 4 Arabidopsis thaliana
Q9LPC1 3.38e-102 310 48 6 336 2 GAE2 UDP-glucuronate 4-epimerase 2 Arabidopsis thaliana
O81312 8.34e-101 306 48 6 335 2 GAE3 UDP-glucuronate 4-epimerase 3 Arabidopsis thaliana
Q9M0B6 5.23e-100 304 48 5 335 1 GAE1 UDP-glucuronate 4-epimerase 1 Arabidopsis thaliana
Q9LIS3 1.16e-97 299 48 6 341 1 GAE6 UDP-glucuronate 4-epimerase 6 Arabidopsis thaliana
Q9STI6 4.86e-89 276 45 7 340 2 GAE5 UDP-glucuronate 4-epimerase 5 Arabidopsis thaliana
F8C4X8 1.62e-86 266 43 4 329 1 TOPB45_0660 UDP-glucuronate 4-epimerase Thermodesulfobacterium geofontis (strain OPF15)
O34886 2.2e-48 167 34 7 336 3 ytcB Uncharacterized UDP-glucose epimerase YtcB Bacillus subtilis (strain 168)
Q04973 3.79e-39 144 29 6 338 3 vipB Vi polysaccharide biosynthesis protein VipB/TviC Salmonella typhi
Q7BJX9 8.91e-38 140 30 8 342 1 wbgU UDP-N-acetylglucosamine 4-epimerase Plesiomonas shigelloides
Q43070 2.85e-33 129 28 8 349 2 GALE UDP-glucose 4-epimerase Pisum sativum
O65780 4.23e-33 128 31 10 348 2 None UDP-glucose 4-epimerase GEPI42 Cyamopsis tetragonoloba
B0M3E8 4.3e-33 128 28 8 349 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Pisum sativum
Q57664 1.75e-32 125 30 11 333 3 MJ0211 Putative UDP-glucose 4-epimerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8VDR7 1.92e-32 127 27 11 354 2 Tgds dTDP-D-glucose 4,6-dehydratase Mus musculus
Q9W0P5 1.56e-31 124 27 9 347 1 Gale UDP-glucose 4-epimerase Drosophila melanogaster
O95455 1.71e-31 124 27 10 341 1 TGDS dTDP-D-glucose 4,6-dehydratase Homo sapiens
Q9SN58 2.09e-31 124 26 6 343 1 UGE5 UDP-glucose 4-epimerase 5 Arabidopsis thaliana
A6QLW2 2.16e-31 124 27 10 345 2 TGDS dTDP-D-glucose 4,6-dehydratase Bos taurus
Q9T0A7 7.34e-31 122 27 10 350 1 UGE2 UDP-glucose 4-epimerase 2 Arabidopsis thaliana
Q8LNZ3 8.22e-31 122 27 9 351 2 UGE-1 UDP-glucose 4-epimerase 1 Oryza sativa subsp. japonica
Q8LDN8 1.55e-30 121 28 9 347 1 UGE3 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 3 Arabidopsis thaliana
P9WN67 2.8e-30 120 28 9 339 1 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN66 2.8e-30 120 28 9 339 3 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O06485 3.27e-30 120 25 9 340 3 yfnG Putative sugar dehydratase/epimerase YfnG Bacillus subtilis (strain 168)
Q564Q1 5.67e-30 120 28 10 356 1 gale-1 UDP-glucose 4-epimerase Caenorhabditis elegans
Q42605 6.31e-30 120 28 9 351 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Arabidopsis thaliana
O65781 6.73e-30 120 28 8 346 2 None UDP-glucose 4-epimerase GEPI48 Cyamopsis tetragonoloba
A0R5C5 2.18e-29 117 28 7 338 1 MSMEG_6142 UDP-glucose 4-epimerase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P35673 2.41e-29 118 26 8 348 3 galE UDP-glucose 4-epimerase Erwinia amylovora
P37759 6.7e-29 117 25 8 356 3 rfbB dTDP-glucose 4,6-dehydratase 1 Escherichia coli (strain K12)
Q9C7W7 1.2e-28 116 27 7 342 1 UGE4 UDP-glucose 4-epimerase 4 Arabidopsis thaliana
P55462 1.2e-28 116 27 9 350 3 NGR_a03580 Probable dTDP-glucose 4,6-dehydratase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9LH76 1.58e-28 119 27 8 333 2 RHM3 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 Arabidopsis thaliana
Q9LPG6 3.83e-28 118 27 9 338 1 RHM2 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM2 Arabidopsis thaliana
Q57301 4.19e-28 114 26 8 350 3 galE UDP-glucose 4-epimerase Yersinia enterocolitica
Q9SYM5 4.23e-28 118 28 9 333 1 RHM1 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM1 Arabidopsis thaliana
Q6K2E1 1.15e-27 114 26 8 346 2 UGE-4 UDP-glucose 4-epimerase 4 Oryza sativa subsp. japonica
Q6ZDJ7 2.25e-27 114 28 9 349 2 UGE-2 UDP-glucose 4-epimerase 2 Oryza sativa subsp. japonica
P37777 7.19e-27 112 25 9 356 3 rfbB dTDP-glucose 4,6-dehydratase Shigella flexneri
P26391 9.08e-27 111 25 9 357 1 rfbB dTDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P22715 1.24e-25 108 25 9 363 3 galE UDP-glucose 4-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56093 1.49e-25 107 25 9 363 3 galE UDP-glucose 4-epimerase Salmonella typhi
O84903 2.08e-25 107 27 8 346 3 galE UDP-glucose 4-epimerase Lacticaseibacillus casei
Q6T1X6 2.09e-25 107 26 9 341 1 rmd GDP-6-deoxy-D-mannose reductase Aneurinibacillus thermoaerophilus
Q7WTB1 2.71e-25 107 25 8 350 2 galE UDP-glucose 4-epimerase Lactobacillus helveticus
Q9KDV3 3.4e-25 107 25 8 343 3 galE UDP-glucose 4-epimerase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P27830 4.67e-25 107 24 7 351 1 rffG dTDP-glucose 4,6-dehydratase 2 Escherichia coli (strain K12)
P55180 7.23e-25 105 26 10 348 3 galE UDP-glucose 4-epimerase Bacillus subtilis (strain 168)
P55293 7.52e-25 106 24 9 357 3 rfbB dTDP-glucose 4,6-dehydratase Escherichia coli
Q9FI17 1.33e-24 106 26 8 325 3 At5g44480 Putative UDP-arabinose 4-epimerase 4 Arabidopsis thaliana
Q9HDU3 3.89e-24 106 27 10 348 3 gal10 Bifunctional protein gal10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P33119 4.17e-24 103 24 5 323 3 galE UDP-glucose 4-epimerase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
D4GU72 5.33e-24 103 25 7 335 3 agl12 Low-salt glycan biosynthesis protein Agl12 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P09147 8.03e-24 103 24 7 348 1 galE UDP-glucose 4-epimerase Escherichia coli (strain K12)
Q9SUN3 8.1e-24 104 24 9 350 2 At4g20460 Probable UDP-arabinose 4-epimerase 3 Arabidopsis thaliana
P0C7J0 2.02e-23 102 24 8 349 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8H0B6 2.25e-23 102 27 8 319 2 UEL-2 Probable UDP-arabinose 4-epimerase 2 Oryza sativa subsp. japonica
Q3T105 2.37e-23 102 26 9 351 2 GALE UDP-glucose 4-epimerase Bos taurus
Q8R059 2.51e-23 102 26 8 346 1 Gale UDP-glucose 4-epimerase Mus musculus
Q652A8 2.61e-23 102 25 9 344 2 UGE-3 UDP-glucose 4-epimerase 3 Oryza sativa subsp. japonica
E8MF10 3.26e-23 101 25 8 345 1 lnpD UDP-glucose 4-epimerase Bifidobacterium longum subsp. longum (strain ATCC 15707 / DSM 20219 / JCM 1217 / NCTC 11818 / E194b)
Q9F7D4 4.87e-23 100 26 9 344 3 galE UDP-glucose 4-epimerase Yersinia pestis
P39630 7.31e-23 100 24 7 337 1 rfbB dTDP-glucose 4,6-dehydratase Bacillus subtilis (strain 168)
Q5R8D0 8.49e-23 100 25 9 352 2 GALE UDP-glucose 4-epimerase Pongo abelii
P18645 9.92e-23 100 26 11 350 2 Gale UDP-glucose 4-epimerase Rattus norvegicus
Q54WS6 1.11e-22 101 29 3 238 3 tgds dTDP-D-glucose 4,6-dehydratase Dictyostelium discoideum
B0RVL0 1.79e-22 99 23 8 349 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain B100)
Q59678 2.73e-22 99 23 8 351 3 galE UDP-glucose 4-epimerase Mannheimia haemolytica
Q8VZC0 3.09e-22 100 26 10 337 1 UXS1 UDP-glucuronic acid decarboxylase 1 Arabidopsis thaliana
Q8H930 3.13e-22 99 25 10 352 2 UEL-1 Probable UDP-arabinose 4-epimerase 1 Oryza sativa subsp. japonica
Q14376 3.32e-22 99 25 9 352 1 GALE UDP-glucose 4-epimerase Homo sapiens
Q9RR28 8.07e-22 97 25 8 337 3 oleE dTDP-glucose 4,6-dehydratase Streptomyces antibioticus
Q9SA77 1.11e-21 98 26 10 346 1 MUR4 UDP-arabinose 4-epimerase 1 Arabidopsis thaliana
P56986 1.31e-21 97 24 7 362 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup C
P96995 2.02e-21 96 26 9 338 3 galE UDP-glucose 4-epimerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P56985 2.12e-21 96 24 7 362 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9ZAE8 4.21e-21 95 25 10 343 3 acbB dTDP-glucose 4,6-dehydratase Actinoplanes sp. (strain ATCC 31044 / CBS 674.73 / SE50/110)
Q9S642 5.15e-21 95 23 12 360 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q59083 5.51e-21 95 24 9 344 3 exoB UDP-glucose 4-epimerase Azospirillum brasilense
P44914 5.69e-21 95 25 10 354 3 rffG dTDP-glucose 4,6-dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q553X7 6.02e-21 95 25 9 348 1 galE UDP-glucose 4-epimerase Dictyostelium discoideum
Q9LZI2 1.43e-20 95 23 10 337 1 UXS2 UDP-glucuronic acid decarboxylase 2 Arabidopsis thaliana
P56600 6.87e-20 88 38 2 131 3 GAL10 Bifunctional protein GAL10 (Fragment) Candida maltosa
Q6E7F4 7.13e-20 92 23 10 368 1 rmlB dTDP-glucose 4,6-dehydratase Escherichia coli
Q9L9E8 7.28e-20 92 23 9 342 3 novT dTDP-glucose 4,6-dehydratase Streptomyces niveus
P56997 9.36e-20 92 24 8 357 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q45291 1.51e-19 91 24 7 326 3 galE UDP-glucose 4-epimerase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2SYH7 1.87e-19 91 23 8 370 1 wbiB dTDP-L-rhamnose 4-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P9WN65 1.9e-19 90 28 6 238 1 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN64 1.9e-19 90 28 6 238 3 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8S8T4 1.99e-19 92 22 10 337 2 UXS4 UDP-glucuronic acid decarboxylase 4 Arabidopsis thaliana
P55294 2.52e-19 90 23 12 368 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O64749 3.39e-19 91 26 11 350 2 At2g34850 Putative UDP-arabinose 4-epimerase 2 Arabidopsis thaliana
P21977 3.94e-19 90 26 8 326 3 galE UDP-glucose 4-epimerase Streptococcus thermophilus
Q05026 6.19e-19 89 25 12 354 3 galE UDP-glucose 4-epimerase Neisseria gonorrhoeae
Q8H0B2 6.44e-19 90 25 10 351 2 UEL-3 Probable UDP-arabinose 4-epimerase 3 Oryza sativa subsp. japonica
A3QJB2 8.74e-19 89 28 18 348 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A0QSK6 1.55e-18 88 25 11 349 1 rmlB dTDP-glucose 4,6-dehydratase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5PQX0 1.62e-18 89 23 9 338 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Rattus norvegicus
Q5R885 1.72e-18 89 23 9 338 2 UXS1 UDP-glucuronic acid decarboxylase 1 Pongo abelii
Q8NBZ7 1.72e-18 89 23 9 338 1 UXS1 UDP-glucuronic acid decarboxylase 1 Homo sapiens
Q91XL3 2.02e-18 89 23 9 338 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Mus musculus
P09609 2.61e-18 89 29 11 274 2 GAL10 Bifunctional protein GAL10 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9HDU4 3.46e-18 87 25 12 363 3 SPBPB2B2.11 Uncharacterized protein PB2B2.11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZV36 4.63e-18 87 25 11 330 2 UXS6 UDP-glucuronic acid decarboxylase 6 Arabidopsis thaliana
P45602 6.32e-18 82 32 2 141 3 galE UDP-glucose 4-epimerase (Fragment) Klebsiella pneumoniae
P24325 7.41e-18 86 22 6 345 3 galE UDP-glucose 4-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P13226 1e-17 85 22 8 345 3 galE UDP-glucose 4-epimerase Streptomyces lividans
Q9FIE8 1.22e-17 85 25 12 331 1 UXS3 UDP-glucuronic acid decarboxylase 3 Arabidopsis thaliana
Q9CNY5 1.29e-17 85 23 6 348 3 galE UDP-glucose 4-epimerase Pasteurella multocida (strain Pm70)
Q6DF08 1.39e-17 86 23 9 338 2 uxs1 UDP-glucuronic acid decarboxylase 1 Xenopus tropicalis
P29782 1.46e-17 85 24 6 333 1 strE dTDP-glucose 4,6-dehydratase Streptomyces griseus
P14169 2.07e-17 85 24 12 361 1 rfbE CDP-paratose 2-epimerase Salmonella typhi
P04397 5.76e-17 85 25 8 345 1 GAL10 Bifunctional protein GAL10 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P37761 8.39e-17 83 22 11 358 3 rfbB dTDP-glucose 4,6-dehydratase Neisseria gonorrhoeae
Q9SN95 9.07e-17 83 25 12 331 2 UXS5 UDP-glucuronic acid decarboxylase 5 Arabidopsis thaliana
Q6GMI9 2.6e-16 82 22 9 336 1 uxs1 UDP-glucuronic acid decarboxylase 1 Danio rerio
Q07W60 2.61e-16 81 26 18 348 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella frigidimarina (strain NCIMB 400)
Q59745 7.59e-16 80 23 9 342 3 exoB UDP-glucose 4-epimerase Rhizobium leguminosarum bv. trifolii
Q5UR12 1.15e-15 80 23 8 332 1 MIMI_R141 Putative dTDP-D-glucose 4,6-dehydratase Acanthamoeba polyphaga mimivirus
P40801 1.36e-15 81 26 11 352 2 GAL10 Bifunctional protein GAL10 Pachysolen tannophilus
Q6E7F2 3.38e-15 78 25 10 331 1 fcf1 dTDP-4-dehydro-6-deoxyglucose reductase Escherichia coli
B8CVJ3 4.73e-15 78 25 17 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella piezotolerans (strain WP3 / JCM 13877)
P26503 7.61e-15 77 23 8 342 3 exoB UDP-glucose 4-epimerase Rhizobium meliloti (strain 1021)
Q9Y7X5 1.6e-14 77 22 10 356 1 uge1 UDP-glucose 4-epimerase uge1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0A4T8 2.2e-14 76 28 10 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q93VR3 5.25e-14 75 23 9 349 1 At5g28840 GDP-mannose 3,5-epimerase Arabidopsis thaliana
A2Z7B3 1.23e-13 74 26 6 245 2 OsI_032456 GDP-mannose 3,5-epimerase 1 Oryza sativa subsp. indica
Q3J7X9 1.33e-13 73 27 15 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q7NTL6 2.05e-13 73 26 15 363 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A3C4S4 2.08e-13 73 26 6 245 1 GME-1 GDP-mannose 3,5-epimerase 1 Oryza sativa subsp. japonica
Q2R1V8 4.18e-13 72 23 9 351 2 GME-2 GDP-mannose 3,5-epimerase 2 Oryza sativa subsp. japonica
Q331Q7 4.24e-13 72 21 8 338 1 gerKI dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces sp.
Q3SK74 1.38e-12 71 28 12 245 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Thiobacillus denitrificans (strain ATCC 25259)
Q5HIC2 1.94e-12 70 25 7 237 3 SACOL0599 Uncharacterized epimerase/dehydratase SACOL0599 Staphylococcus aureus (strain COL)
Q99W56 1.94e-12 70 25 7 237 3 SAV0553 Uncharacterized epimerase/dehydratase SAV0553 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FJ87 1.94e-12 70 25 7 237 3 SAUSA300_0538 Uncharacterized epimerase/dehydratase SAUSA300_0538 Staphylococcus aureus (strain USA300)
Q2G0M5 1.94e-12 70 25 7 237 3 SAOUHSC_00535 Uncharacterized epimerase/dehydratase SAOUHSC_00535 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GBT4 1.94e-12 70 25 7 237 3 SAS0511 Uncharacterized epimerase/dehydratase SAS0511 Staphylococcus aureus (strain MSSA476)
Q7A788 1.94e-12 70 25 7 237 1 SA0511 Uncharacterized epimerase/dehydratase SA0511 Staphylococcus aureus (strain N315)
Q7A1Q7 1.94e-12 70 25 7 237 3 MW0508 Uncharacterized epimerase/dehydratase MW0508 Staphylococcus aureus (strain MW2)
Q2YSA8 2.22e-12 70 25 7 237 3 SAB0504 Uncharacterized epimerase/dehydratase SAB0504 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2SY18 2.28e-12 70 25 20 364 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A0U3AP28 2.33e-12 70 27 9 241 1 HS5.17 CDP-6-D-glucitol synthase Campylobacter jejuni
B2U894 3.12e-12 70 24 16 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Ralstonia pickettii (strain 12J)
Q3A8K5 4.2e-12 69 23 17 348 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A3NC24 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 668)
Q3JPY8 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1710b)
A3NXW3 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1106a)
A1V6L4 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain SAVP1)
Q62M34 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain ATCC 23344)
A2S4R1 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10229)
A3MHP7 6.3e-12 68 25 21 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10247)
P0DMK5 6.73e-12 68 24 19 363 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain K96243)
I1WGR6 8.65e-12 68 25 22 371 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1026b)
Q6GJB5 8.77e-12 68 24 7 237 3 SAR0558 Uncharacterized epimerase/dehydratase SAR0558 Staphylococcus aureus (strain MRSA252)
B2FI29 1.37e-11 68 25 16 366 1 oleD 2-alkyl-3-oxoalkanoate reductase Stenotrophomonas maltophilia (strain K279a)
Q47GJ3 1.41e-11 68 23 14 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Dechloromonas aromatica (strain RCB)
Q13VD0 1.42e-11 68 25 17 368 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia xenovorans (strain LB400)
P47364 1.7e-11 67 21 11 347 3 galE UDP-glucose 4-epimerase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q7VZF5 1.83e-11 67 25 16 362 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9CL97 1.9e-11 67 23 17 346 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pasteurella multocida (strain Pm70)
Q0P8I7 1.92e-11 67 25 14 344 1 Cj1427c GDP-D-glycero-alpha-D-manno-heptose dehydrogenase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B2T625 2.02e-11 67 24 16 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C5BB97 2.4e-11 67 25 21 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Edwardsiella ictaluri (strain 93-146)
P95780 2.79e-11 67 24 11 345 1 rmlB dTDP-glucose 4,6-dehydratase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P45048 3.01e-11 67 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLI0 3.09e-11 67 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain 86-028NP)
Q7N3Q7 3.23e-11 67 23 6 277 3 arnA Bifunctional polymyxin resistance protein ArnA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Y0X8 3.38e-11 67 24 15 368 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2VL47 3.38e-11 66 25 16 345 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A5UIN9 3.43e-11 66 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain PittGG)
Q7W609 3.53e-11 67 25 14 361 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGU9 3.53e-11 67 25 14 361 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B3R3C0 3.71e-11 66 26 16 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q8PDW5 3.81e-11 67 25 14 365 1 oleD 2-alkyl-3-oxoalkanoate reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q31FG4 4.14e-11 66 26 15 341 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5SFA6 4.14e-11 66 20 9 344 1 chmD dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces bikiniensis
P75517 5.34e-11 66 21 12 347 3 galE UDP-glucose 4-epimerase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A9ADU8 5.4e-11 66 25 22 371 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia multivorans (strain ATCC 17616 / 249)
A1VGB0 7.15e-11 65 28 13 244 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain DP4)
Q72ET7 7.56e-11 65 28 13 244 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0KDH0 1.01e-10 65 25 15 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q49VA1 1.09e-10 65 28 5 178 3 SSP2164 Uncharacterized epimerase/dehydratase SSP2164 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8ARK8 1.13e-10 65 25 21 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q39IF3 1.13e-10 65 24 19 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B2JF12 1.43e-10 65 24 18 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B4EB34 1.71e-10 64 24 19 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1JPN5 1.75e-10 65 25 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1BY20 1.78e-10 64 24 19 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain AU 1054)
B1JXS7 1.78e-10 64 24 19 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain MC0-3)
A0K5M9 1.78e-10 64 24 19 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain HI2424)
A6VLD2 1.99e-10 64 26 18 348 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A4W527 2.12e-10 64 24 18 345 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Enterobacter sp. (strain 638)
C6DIA9 2.55e-10 64 25 19 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P0A1P4 2.64e-10 63 23 10 329 1 rfbJ CDP-abequose synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q48HZ1 3.35e-10 64 25 8 268 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4SQW9 3.51e-10 64 25 10 296 3 arnA Bifunctional polymyxin resistance protein ArnA Aeromonas salmonicida (strain A449)
Q4KC82 4.1e-10 64 25 8 268 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P35675 4.12e-10 61 36 3 116 3 None Uncharacterized protein in galE 3'region (Fragment) Erwinia amylovora
Q4L3L8 4.3e-10 63 26 5 178 3 SH2450 Uncharacterized epimerase/dehydratase SH2450 Staphylococcus haemolyticus (strain JCSC1435)
B1LK58 4.53e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain SMS-3-5 / SECEC)
Q1R1N5 4.54e-10 63 25 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4JCI2 4.64e-10 63 23 18 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B7LVH8 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I3J9 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain SE11)
P67910 5.76e-10 63 25 20 349 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12)
B1X953 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12 / DH10B)
C4ZXL1 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M4A5 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O8 (strain IAI1)
B5YWC0 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P67911 5.76e-10 63 25 20 349 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O157:H7
B7L745 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain 55989 / EAEC)
B7ULH4 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTH2 5.76e-10 63 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2L2R8 6.24e-10 63 27 8 235 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella avium (strain 197N)
Q46Y59 7.13e-10 62 30 9 195 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3YVY3 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella sonnei (strain Ss046)
Q83PP2 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri
Q0SYE8 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri serotype 5b (strain 8401)
Q31V04 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 4 (strain Sb227)
B2U5D7 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R4X2 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain UTI89 / UPEC)
B7NES6 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FCA0 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBI8 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHF5 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O1:K1 / APEC
B7N1S3 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O81 (strain ED1a)
B7NPC7 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MFI2 8.26e-10 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7MQ91 9.4e-10 62 25 19 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cronobacter sakazakii (strain ATCC BAA-894)
A9IJJ7 1.08e-09 62 23 12 361 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A8GLC8 1.11e-09 62 26 19 348 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Serratia proteamaculans (strain 568)
A1SRT6 1.12e-09 62 24 20 352 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0BH85 1.15e-09 62 23 18 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
C3KAD2 1.17e-09 63 25 9 268 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain SBW25)
Q329N6 1.2e-09 62 25 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella dysenteriae serotype 1 (strain Sd197)
Q1LQG2 1.24e-09 62 24 17 365 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B1YV41 1.31e-09 62 23 18 366 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain MC40-6)
Q56872 1.36e-09 62 27 3 205 3 gmd GDP-mannose 4,6-dehydratase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5RGG8 1.39e-09 62 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5E3 1.39e-09 62 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella enteritidis PT4 (strain P125109)
B5FLI8 1.39e-09 62 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella dublin (strain CT_02021853)
Q3KCC1 1.64e-09 62 26 8 248 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas fluorescens (strain Pf0-1)
P67912 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67913 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhi
B4TZW1 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella schwarzengrund (strain CVM19633)
B5BHZ3 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain AKU_12601)
A9MVL2 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PC05 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9A3 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella heidelberg (strain SL476)
B5EXC5 1.78e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella agona (strain SL483)
B4SXC1 1.79e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella newport (strain SL254)
C0Q1V2 1.95e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi C (strain RKS4594)
Q57IC3 1.95e-09 61 23 16 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella choleraesuis (strain SC-B67)
Q5P2S1 2.19e-09 61 24 15 350 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B4ETL7 2.36e-09 62 22 6 270 3 arnA Bifunctional polymyxin resistance protein ArnA Proteus mirabilis (strain HI4320)
Q2NQV7 2.59e-09 61 27 19 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Sodalis glossinidius (strain morsitans)
B5XTI2 2.87e-09 60 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae (strain 342)
A0KGY6 3.07e-09 62 23 6 274 3 arnA Bifunctional polymyxin resistance protein ArnA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4ZSZ2 3.12e-09 61 26 8 247 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas syringae pv. syringae (strain B728a)
A9MKQ6 3.36e-09 60 24 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XTK9 3.44e-09 61 24 7 250 3 arnA Bifunctional polymyxin resistance protein ArnA Klebsiella pneumoniae (strain 342)
B1JJ30 3.45e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q93PD8 3.49e-09 61 24 8 270 2 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5L3 3.49e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHH4 3.49e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q02QH1 3.8e-09 60 23 17 372 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain UCBPP-PA14)
A4TIM4 3.95e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis (strain Pestoides F)
Q1CIH7 3.95e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R093 3.95e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX8 3.95e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis
Q1C742 3.95e-09 61 24 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Yersinia pestis bv. Antiqua (strain Antiqua)
Q9XCA1 4.11e-09 60 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae
A6TFL4 4.19e-09 60 25 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A1KBH4 4.38e-09 60 25 10 239 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Azoarcus sp. (strain BH72)
B1IZH2 5.52e-09 60 24 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A683 5.52e-09 60 24 20 349 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O9:H4 (strain HS)
A8GDR7 5.79e-09 60 23 7 268 3 arnA Bifunctional polymyxin resistance protein ArnA Serratia proteamaculans (strain 568)
B7LM76 5.79e-09 60 25 10 280 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q9HYQ8 5.85e-09 60 23 17 372 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q12CM2 6.09e-09 60 26 11 240 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9K002 6.53e-09 60 24 17 357 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B5RCC4 8.9e-09 60 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella gallinarum (strain 287/91 / NCTC 13346)
C6DAW5 9.13e-09 60 24 6 247 3 arnA Bifunctional polymyxin resistance protein ArnA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1KT78 1.04e-08 59 24 17 357 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M3Q7 1.06e-08 59 25 10 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C (strain 053442)
Q9JQX8 1.13e-08 59 25 10 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8CQ79 1.19e-08 59 22 6 237 3 SE_0317 Uncharacterized epimerase/dehydratase SE_0317 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRJ9 1.19e-08 59 22 6 237 3 SERP0194 Uncharacterized epimerase/dehydratase SERP0194 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q51061 1.23e-08 59 25 10 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae
A6TF98 1.3e-08 59 24 7 250 3 arnA Bifunctional polymyxin resistance protein ArnA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7MY46 1.32e-08 58 25 20 351 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5F9J0 1.39e-08 58 25 10 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q18801 1.42e-08 59 23 10 340 1 bre-1 GDP-mannose 4,6 dehydratase 1 Caenorhabditis elegans
O52325 1.68e-08 59 23 8 280 1 arnA Bifunctional polymyxin resistance protein ArnA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SYX1 1.68e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella newport (strain SL254)
B5FNT9 1.73e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella dublin (strain CT_02021853)
Q6D2F1 1.77e-08 59 24 6 247 3 arnA Bifunctional polymyxin resistance protein ArnA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C0Q069 1.84e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi C (strain RKS4594)
Q9ZUY6 1.87e-08 58 24 8 262 1 AXS1 UDP-D-apiose/UDP-D-xylose synthase 1 Arabidopsis thaliana
P0C0R6 1.89e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella choleraesuis (strain SC-B67)
Q8Z540 1.99e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella typhi
B5BCP6 1.99e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi A (strain AKU_12601)
Q5PNA6 1.99e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TPI2 2.06e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella schwarzengrund (strain CVM19633)
B5EZH8 2.1e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella agona (strain SL483)
A9N5B2 2.14e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8RIA5 2.18e-08 58 26 24 364 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B5R272 2.24e-08 59 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella enteritidis PT4 (strain P125109)
Q8X7P7 2.31e-08 58 26 14 300 1 gnu N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase Escherichia coli O157:H7
B4TBG6 2.47e-08 58 23 8 280 3 arnA Bifunctional polymyxin resistance protein ArnA Salmonella heidelberg (strain SL476)
P9WQP7 2.5e-08 58 22 12 302 1 Rv1106c 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQP6 2.5e-08 58 22 12 302 3 MT1137 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A8FRR2 2.51e-08 58 24 9 275 3 arnA Bifunctional polymyxin resistance protein ArnA Shewanella sediminis (strain HAW-EB3)
Q02R25 3.09e-08 58 27 9 248 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas aeruginosa (strain UCBPP-PA14)
A4WAM3 3.23e-08 58 24 7 250 3 arnA Bifunctional polymyxin resistance protein ArnA Enterobacter sp. (strain 638)
A8Y0L5 3.34e-08 58 23 9 340 3 CBG21737 GDP-mannose 4,6 dehydratase 1 Caenorhabditis briggsae
O45583 3.74e-08 58 24 13 358 1 gmd-2 GDP-mannose 4,6 dehydratase 2 Caenorhabditis elegans
B7VBN2 4.38e-08 58 26 9 248 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas aeruginosa (strain LESB58)
Q9SNY3 4.54e-08 57 26 7 240 1 GMD1 GDP-mannose 4,6 dehydratase 1 Arabidopsis thaliana
Q9HY63 4.62e-08 58 26 9 248 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9JRN5 5.09e-08 57 23 8 337 1 gmd GDP-mannose 4,6-dehydratase Aggregatibacter actinomycetemcomitans
Q67ZE1 5.23e-08 57 21 10 373 1 3BETAHSD/D2 3beta-hydroxysteroid-dehydrogenase/decarboxylase isoform 2 Arabidopsis thaliana
P77398 6.71e-08 57 23 8 270 1 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12)
B1IXT2 6.71e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1X8W8 6.71e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12 / DH10B)
C4ZU97 6.71e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain K12 / MC4100 / BW2952)
B7UFR7 6.9e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I7J8 6.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain SE11)
B7M5T7 6.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O8 (strain IAI1)
B7LAS0 6.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain 55989 / EAEC)
A7ZP73 6.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NNT4 7.02e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q31YK2 7.21e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella boydii serotype 4 (strain Sb227)
A8A2C2 7.28e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O9:H4 (strain HS)
A0KQV3 7.46e-08 56 26 11 241 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B2TW38 7.47e-08 57 23 8 270 5 arnA Putative bifunctional polymyxin resistance protein ArnA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LLK9 7.61e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain SMS-3-5 / SECEC)
Q1R9G0 7.81e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli (strain UTI89 / UPEC)
A1ADA7 7.81e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O1:K1 / APEC
B7MG22 7.81e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YXP8 7.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDZ3 7.96e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O157:H7
Q60A54 8.09e-08 56 25 11 237 1 sdmB Sterol demethylase protein B Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q3YZV1 8.1e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella sonnei (strain Ss046)
Q32DT3 8.39e-08 57 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella dysenteriae serotype 1 (strain Sd197)
Q06952 9.01e-08 56 26 3 203 3 gmd GDP-mannose 4,6-dehydratase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0UWU3 9.75e-08 56 23 18 345 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 2336)
Q0I569 9.75e-08 56 23 18 345 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 129Pt)
A4SHC0 1.02e-07 56 26 10 237 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aeromonas salmonicida (strain A449)
B7MXT6 1.07e-07 57 22 7 272 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O81 (strain ED1a)
B7N5M0 1.13e-07 57 24 8 249 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FFM1 1.15e-07 57 22 7 272 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44094 1.23e-07 56 28 9 226 1 denD D-erythronate dehydrogenase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6V291 1.32e-07 56 27 13 255 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain PA7)
Q5E8J9 1.34e-07 55 24 17 357 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0P9D4 1.45e-07 56 24 8 248 1 pglF UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8S9Z2 1.48e-07 56 24 8 262 2 Os01g0969100 UDP-D-apiose/UDP-D-xylose synthase Oryza sativa subsp. japonica
B5FFS9 1.48e-07 55 24 17 357 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain MJ11)
A6V1P0 1.49e-07 56 26 9 248 3 arnA Bifunctional polymyxin resistance protein ArnA Pseudomonas aeruginosa (strain PA7)
Q9FX01 1.69e-07 56 22 11 368 1 3BETAHSD/D1 3beta-hydroxysteroid-dehydrogenase/decarboxylase isoform 1 Arabidopsis thaliana
Q0TFI7 1.81e-07 56 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1VR25 1.83e-07 55 26 12 245 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas naphthalenivorans (strain CJ2)
Q60555 2.07e-07 55 26 9 217 2 HSD3B1 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1 Mesocricetus auratus
B1XVP6 2.44e-07 55 24 18 355 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
O85713 3.24e-07 55 23 4 233 3 gmd GDP-mannose 4,6-dehydratase Rhizobium fredii (strain HH103)
B0BSD7 3.88e-07 54 23 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N308 3.88e-07 54 23 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q15738 4.49e-07 54 21 14 376 1 NSDHL Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Homo sapiens
Q8EG63 4.52e-07 54 27 9 199 1 oleD 2-alkyl-3-oxoalkanoate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2NRV7 4.69e-07 55 24 8 249 3 arnA Bifunctional polymyxin resistance protein ArnA Sodalis glossinidius (strain morsitans)
Q0T2M8 7.18e-07 54 23 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella flexneri serotype 5b (strain 8401)
B4F132 7.2e-07 53 24 18 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Proteus mirabilis (strain HI4320)
B3GYT6 8.11e-07 53 23 17 344 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P24815 1.13e-06 53 27 8 193 1 Hsd3b1 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1 Mus musculus
P0DX24 1.26e-06 53 22 10 295 1 MN2019_09805 3-beta-hydroxysteroid dehydrogenase Mycolicibacterium neoaurum
P93031 1.28e-06 53 23 11 340 1 MUR1 GDP-mannose 4,6 dehydratase 2 Arabidopsis thaliana
A1TYR6 1.42e-06 52 22 16 353 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P0AC91 1.57e-06 53 26 4 207 3 gmd GDP-mannose 4,6-dehydratase Shigella flexneri
P0AC88 1.57e-06 53 26 4 207 1 gmd GDP-mannose 4,6-dehydratase Escherichia coli (strain K12)
P0AC89 1.57e-06 53 26 4 207 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AC90 1.57e-06 53 26 4 207 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O157:H7
Q9R1J0 2.22e-06 52 22 13 372 1 Nsdhl Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Mus musculus
A6NKP2 2.34e-06 52 22 7 290 3 SDR42E2 Putative short-chain dehydrogenase/reductase family 42E member 2 Homo sapiens
Q9JRN7 2.87e-06 51 25 10 264 1 tld GDP-6-deoxy-D-talose 4-dehydrogenase Aggregatibacter actinomycetemcomitans
O46516 3.07e-06 52 25 8 231 2 HSD3B 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Equus caballus
B2VBI9 3.31e-06 52 22 9 274 3 arnA Bifunctional polymyxin resistance protein ArnA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q55C77 3.44e-06 51 25 8 236 1 ger GDP-L-fucose synthase Dictyostelium discoideum
C3LQK1 4.57e-06 51 27 15 246 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain M66-2)
Q06963 4.57e-06 51 27 15 246 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3Z4 4.57e-06 51 27 15 246 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q67477 5.04e-06 51 29 2 134 3 FPV046 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Fowlpox virus (strain NVSL)
Q83QT8 5.43e-06 51 22 8 270 3 arnA Bifunctional polymyxin resistance protein ArnA Shigella flexneri
Q65WA7 6.71e-06 50 24 11 238 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q21Y60 1.15e-05 50 25 11 243 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P26149 1.27e-05 50 26 8 193 1 Hsd3b2 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2 Mus musculus
A0A1B4XBH2 1.38e-05 50 25 8 236 3 sdnI GDP-mannose 4,6-dehydratase sdnI Sordaria araneosa
Q8DE09 1.6e-05 49 23 18 347 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain CMCP6)
O49213 1.7e-05 49 21 13 355 1 GER1 GDP-L-fucose synthase 1 Arabidopsis thaliana
O25511 1.77e-05 49 22 5 208 1 pseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) Helicobacter pylori (strain ATCC 700392 / 26695)
Q87T56 1.82e-05 49 26 15 249 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8DZE7 1.85e-05 49 22 9 303 2 sdr42e1 Short-chain dehydrogenase/reductase family 42E member 1 Danio rerio
Q7MPN6 2.02e-05 49 23 18 347 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain YJ016)
P22071 2.47e-05 49 26 8 193 1 Hsd3b1 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1 Rattus norvegicus
Q61767 2.57e-05 49 27 9 197 1 Hsd3b4 NADPH-dependent 3-keto-steroid reductase Hsd3b4 Mus musculus
A0A7H0DNE2 3.54e-05 48 27 9 200 2 OPG174 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Monkeypox virus
P26670 3.87e-05 48 27 9 200 2 OPG174 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Vaccinia virus (strain Western Reserve)
P21097 4.16e-05 48 27 9 200 2 OPG174 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Vaccinia virus (strain Copenhagen)
O57245 4.47e-05 48 27 9 200 2 OPG174 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase Vaccinia virus (strain Ankara)
Q64421 4.84e-05 48 25 7 193 2 HSD3B2 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2 Mesocricetus auratus
Q0KBD2 5.07e-05 48 31 10 215 1 denD D-erythronate dehydrogenase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5QKR8 5.13e-05 48 24 4 187 3 pseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9D665 7.59e-05 47 23 12 311 1 Sdr42e1 Short-chain dehydrogenase/reductase family 42E member 1 Mus musculus
Q3ZBE9 0.000107 47 22 14 306 2 NSDHL Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Bos taurus
Q5PPL3 0.000131 47 22 9 297 2 Nsdhl Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Rattus norvegicus
Q4R7R1 0.000138 47 22 12 311 2 SDR42E1 Short-chain dehydrogenase/reductase family 42E member 1 Macaca fascicularis
Q0P8W4 0.000182 46 26 3 130 1 pseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q58461 0.000205 46 25 6 189 3 MJ1061 Uncharacterized membrane protein MJ1061 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0DX23 0.000219 46 22 12 355 1 NUT96_16600 3-beta-hydroxysteroid dehydrogenase Klebsiella aerogenes
P55579 0.000247 46 24 10 238 3 NGR_a02350 Uncharacterized protein y4nG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9LMU0 0.000282 45 20 10 350 1 GER2 Putative GDP-L-fucose synthase 2 Arabidopsis thaliana
Q32L94 0.000332 45 22 12 311 2 SDR42E1 Short-chain dehydrogenase/reductase family 42E member 1 Bos taurus
G5EER4 0.000356 45 20 9 357 1 ger-1 GDP-L-fucose synthase Caenorhabditis elegans
P26397 0.000411 45 25 8 229 1 rfbG CDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56623 0.000826 44 20 10 341 3 galE UDP-glucose 4-epimerase Vibrio cholerae

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15765
Feature type CDS
Gene -
Product NAD-dependent epimerase
Location 3500964 - 3501974 (strand: -1)
Length 1011 (nucleotides) / 336 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_249
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01370 NAD dependent epimerase/dehydratase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0451 Cell wall/membrane/envelope biogenesis (M) M Nucleoside-diphosphate-sugar epimerase

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG049099 NAD-dependent epimerase VF0561 Immune modulation

Protein Sequence

MKYLVTGAAGFIGFHLIKKLIQQGETVVGIDNLNDYYDVALKEARLNLLNQLDNFSFSFIDLADREKIAQLFEIEKFDRVIHLAAQAGVRYSLINPFSYADSNLTGFLTILEGCRHNNVKHLVYASSSSVYGLNDELPFSPHDQANHPVSLYAATKKANELMAHSYSHLYGIPTTGLRFFTVYGPWGRPDMALFKFTKAIINNQPIDIYNHGEMKRDFTYVEDIVEGVTRIADVIPTAQQDWKVSTGTPADSSAPYKVYNIGNGSPVNLMDYISALEIHLGKKADKNMLPMQPGDVYTTWADTEDLFKATGYKPQTSVDEGVKQFVDWYKNYYQVK

Flanking regions ( +/- flanking 50bp)

TCGAGACCTCTTTGGTAACGATTAATTAATAGAAACGGATTAATTACGTAATGAAATATTTAGTCACAGGTGCTGCTGGATTTATTGGTTTTCATCTAATAAAAAAACTGATCCAGCAGGGTGAAACCGTTGTTGGTATTGATAACCTTAATGATTATTATGATGTTGCTTTAAAAGAAGCTAGACTTAATCTTTTAAATCAACTAGATAATTTCTCTTTTTCTTTTATTGATTTAGCTGATAGAGAAAAAATTGCTCAATTATTTGAGATTGAGAAATTTGATAGGGTTATTCATTTAGCTGCACAAGCTGGTGTTAGATATTCACTAATTAATCCGTTTTCTTACGCTGATAGTAATTTAACTGGTTTTCTAACTATTTTAGAAGGGTGCCGACACAATAACGTTAAGCATCTTGTTTATGCATCATCAAGTTCAGTCTATGGCTTAAATGATGAATTGCCATTTTCTCCTCATGATCAGGCTAATCATCCTGTTTCTTTATATGCAGCCACTAAAAAAGCTAATGAATTAATGGCGCATAGCTATTCTCATTTATATGGTATTCCGACTACTGGATTACGTTTTTTCACAGTCTATGGCCCTTGGGGACGCCCCGATATGGCATTATTTAAATTTACTAAAGCCATTATTAACAATCAGCCTATAGATATCTATAACCATGGTGAAATGAAACGTGATTTCACTTATGTTGAAGATATTGTAGAAGGTGTTACACGTATTGCTGATGTGATCCCTACAGCCCAGCAAGATTGGAAAGTAAGTACAGGTACTCCAGCAGATAGTTCTGCACCCTATAAGGTTTATAATATTGGTAATGGATCTCCGGTAAATTTAATGGATTACATTAGTGCATTAGAAATACATTTAGGTAAAAAAGCAGATAAAAATATGTTACCAATGCAACCCGGTGATGTGTACACCACATGGGCAGATACTGAGGATTTATTTAAAGCAACTGGCTATAAACCTCAAACAAGCGTTGATGAAGGTGTAAAACAGTTCGTTGATTGGTATAAAAACTATTATCAAGTAAAATAAATAATGCTCAATATCGTCTTATTTGAACCCGAAATTCCACCGAATACGGG