Homologs in group_2092

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15380 FBDBKF_15380 58.3 Morganella morganii S1 fadR DNA-binding transcriptional regulator, FadR family
EHELCC_15740 EHELCC_15740 58.3 Morganella morganii S2 fadR DNA-binding transcriptional regulator, FadR family
NLDBIP_16630 NLDBIP_16630 58.3 Morganella morganii S4 fadR DNA-binding transcriptional regulator, FadR family
LHKJJB_16175 LHKJJB_16175 58.3 Morganella morganii S3 fadR DNA-binding transcriptional regulator, FadR family
HKOGLL_15945 HKOGLL_15945 58.3 Morganella morganii S5 fadR DNA-binding transcriptional regulator, FadR family
F4V73_RS17765 F4V73_RS17765 58.8 Morganella psychrotolerans - FadR/GntR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2092

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2092

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31475 9.33e-80 241 51 0 225 4 yieP Uncharacterized HTH-type transcriptional regulator YieP Escherichia coli (strain K12)
P31460 1.64e-22 94 29 3 208 1 dgoR Galactonate operon transcriptional repressor Escherichia coli (strain K12)
P0CL10 2.28e-10 62 27 6 218 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W823 2.28e-10 62 27 6 218 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain SL1344)
P0A2S3 2.28e-10 62 27 6 218 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhi
P0ACL9 2.83e-10 62 28 6 217 1 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli (strain K12)
P0ACM0 2.83e-10 62 28 6 217 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACM1 2.83e-10 62 28 6 217 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O157:H7
G0E1Z6 3.91e-08 55 29 7 179 3 nanR HTH-type transcriptional repressor NanR Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
Q9X9E0 3.92e-08 55 27 8 225 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
A4WF39 1.34e-07 54 28 7 219 3 nanR HTH-type transcriptional repressor NanR Enterobacter sp. (strain 638)
A7MJD3 2.02e-07 53 26 9 230 3 nanR HTH-type transcriptional repressor NanR Cronobacter sakazakii (strain ATCC BAA-894)
P67735 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67736 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella typhi
B5BGP6 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella paratyphi A (strain AKU_12601)
C0PZN5 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella paratyphi C (strain RKS4594)
Q5PJS9 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RET8 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0L3 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella enteritidis PT4 (strain P125109)
Q57JC8 2.69e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella choleraesuis (strain SC-B67)
A9MNY5 2.93e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4T751 3.55e-07 53 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella newport (strain SL254)
P39161 4.77e-07 52 26 7 209 4 uxuR Uxu operon transcriptional regulator Escherichia coli (strain K12)
B4TWJ1 4.85e-07 52 26 10 231 3 nanR HTH-type transcriptional repressor NanR Salmonella schwarzengrund (strain CVM19633)
F8VI19 6.14e-07 52 28 7 179 3 nanR HTH-type transcriptional repressor NanR Salmonella bongori (strain ATCC 43975 / DSM 13772 / NCTC 12419)
P42239 6.48e-07 52 25 5 217 4 ycbG Uncharacterized HTH-type transcriptional regulator YcbG Bacillus subtilis (strain 168)
P0ACL8 1.79e-06 50 28 9 226 3 lldR Putative L-lactate dehydrogenase operon regulatory protein Shigella flexneri
P0ACL7 1.79e-06 50 28 9 226 2 lldR Putative L-lactate dehydrogenase operon regulatory protein Escherichia coli (strain K12)
Q32BB3 6.69e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Shigella dysenteriae serotype 1 (strain Sd197)
B7NDK4 7.21e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NKT7 7.28e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6I1U4 7.35e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain SE11)
Q8X4W4 7.35e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O157:H7
B7LHT2 7.35e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain 55989 / EAEC)
P0A8W1 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Shigella flexneri
Q31W95 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Shigella boydii serotype 4 (strain Sb227)
P0A8W0 7.7e-06 49 25 6 177 1 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain K12)
B1IQQ3 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XHJ9 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain K12 / DH10B)
C4ZSW4 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0T8 7.7e-06 49 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O8 (strain IAI1)
Q1R6B4 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli (strain UTI89 / UPEC)
Q8FD57 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCP0 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGC0 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O1:K1 / APEC
B7N0Z9 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O81 (strain ED1a)
B7MBY8 7.99e-06 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3YX22 8.07e-06 48 26 5 178 3 nanR HTH-type transcriptional repressor NanR Shigella sonnei (strain Ss046)
E0T5H9 1.51e-05 48 28 6 178 3 nanR HTH-type transcriptional repressor NanR Edwardsiella tarda (strain FL6-60)
B7UJV9 1.54e-05 48 25 6 177 3 nanR HTH-type transcriptional repressor NanR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
D2TP58 1.7e-05 48 27 7 181 3 nanR HTH-type transcriptional repressor NanR Citrobacter rodentium (strain ICC168)
P0ACL4 2.48e-05 47 26 9 228 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 2.48e-05 47 26 9 228 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 2.48e-05 47 26 9 228 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7
P67742 3.17e-05 47 26 6 224 4 BQ2027_MB0601 Uncharacterized HTH-type transcriptional regulator Mb0601 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG5 3.17e-05 47 26 6 224 1 mce2R HTH-type transcriptional regulator Mce2R Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMG4 3.17e-05 47 26 6 224 3 mce2R HTH-type transcriptional regulator Mce2R Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O31761 7.71e-05 46 34 0 69 4 ymfC Uncharacterized HTH-type transcriptional regulator YmfC Bacillus subtilis (strain 168)
Q7N3Z5 8.95e-05 45 27 5 165 3 fadR Fatty acid metabolism regulator protein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q083H2 0.000311 44 26 7 187 3 fadR Fatty acid metabolism regulator protein Shewanella frigidimarina (strain NCIMB 400)
P31453 0.000572 43 43 0 58 4 yidP Uncharacterized HTH-type transcriptional regulator YidP Escherichia coli (strain K12)
Q87N05 0.000607 43 46 1 50 3 fadR Fatty acid metabolism regulator protein Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8H5C1 0.000674 43 26 6 178 3 fadR Fatty acid metabolism regulator protein Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q7MJP0 0.000717 43 46 1 50 3 fadR Fatty acid metabolism regulator protein Vibrio vulnificus (strain YJ016)
Q8DAG8 0.000717 43 46 1 50 3 fadR Fatty acid metabolism regulator protein Vibrio vulnificus (strain CMCP6)
A1S6X3 0.001 42 25 7 194 3 fadR Fatty acid metabolism regulator protein Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C3LNK4 0.001 43 46 1 50 3 fadR Fatty acid metabolism regulator protein Vibrio cholerae serotype O1 (strain M66-2)
Q9KQU8 0.001 43 46 1 50 1 fadR Fatty acid metabolism regulator protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z2 0.001 43 46 1 50 3 fadR Fatty acid metabolism regulator protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15090
Feature type CDS
Gene -
Product FadR/GntR family transcriptional regulator
Location 3349328 - 3350014 (strand: 1)
Length 687 (nucleotides) / 228 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2092
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00392 Bacterial regulatory proteins, gntR family
PF07729 FCD domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2186 Transcription (K) K DNA-binding transcriptional regulator, FadR family

Protein Sequence

MQLSEQRSASQKNLSYIVAEKLGKQILSGYYEPESLLPGEIELAELLSVSRTVIREAIKMLAGKGMLLPRPRIGTRVTPMQNWNLLDNDLLNWWIDSGEFNKVSHYFHHVRLAIEPQACYLAALHASETQKESLLFLATEMQLLKDNFNRQHWLDIDTQFHYLIYQASGNPFFASFGSLFLSAYKKYFDLIVGNETVQPETHNQIVQAIIEGDGNRARDLCLILLIND

Flanking regions ( +/- flanking 50bp)

TATTACTCACGTAATATAGAAAGCAAATTATGGTAAAGGTAACTATTATTATGCAACTAAGCGAACAACGCTCAGCATCCCAAAAAAATCTTTCTTATATTGTTGCTGAAAAGCTAGGTAAACAAATACTTTCTGGATACTACGAACCTGAATCTTTATTACCTGGTGAGATAGAACTCGCTGAACTACTTTCAGTCAGTCGAACTGTTATTCGTGAAGCAATAAAAATGCTTGCTGGAAAAGGTATGTTACTACCTCGGCCAAGAATAGGTACTCGAGTTACGCCAATGCAAAATTGGAATCTATTAGATAATGATTTACTTAATTGGTGGATAGATAGCGGTGAATTTAATAAGGTGAGTCATTATTTCCATCATGTTCGTTTAGCAATAGAACCTCAAGCCTGTTATTTAGCTGCATTACATGCTTCAGAGACACAAAAAGAGTCGCTATTATTTCTAGCTACAGAAATGCAGCTACTCAAAGATAACTTTAACCGTCAGCATTGGTTAGATATTGATACACAATTTCACTATCTAATCTATCAAGCCAGTGGCAATCCATTTTTTGCTTCTTTTGGTTCTCTTTTTCTATCTGCCTACAAAAAATATTTTGATTTAATTGTTGGCAATGAAACAGTACAGCCTGAAACTCATAATCAAATTGTACAAGCGATTATAGAAGGAGATGGAAATAGAGCGCGTGATCTTTGTTTAATACTATTAATAAATGACTGAGTATTTTTAATACGATTTTATTGTCTTTTTGTTTATACTGGCTAATAAGC