Homologs in group_1583

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10330 FBDBKF_10330 91.0 Morganella morganii S1 uspA universal stress protein UspA
EHELCC_14665 EHELCC_14665 91.0 Morganella morganii S2 uspA universal stress protein UspA
NLDBIP_14495 NLDBIP_14495 91.0 Morganella morganii S4 uspA universal stress protein UspA
LHKJJB_14850 LHKJJB_14850 91.0 Morganella morganii S3 uspA universal stress protein UspA
HKOGLL_13470 HKOGLL_13470 91.0 Morganella morganii S5 uspA universal stress protein UspA
F4V73_RS14030 F4V73_RS14030 91.0 Morganella psychrotolerans uspA universal stress protein UspA

Distribution of the homologs in the orthogroup group_1583

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1583

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AED4 5.4e-92 265 88 0 144 3 uspA Universal stress protein A Shigella sonnei
P0AED3 5.4e-92 265 88 0 144 3 uspA Universal stress protein A Shigella flexneri
P0AED0 5.4e-92 265 88 0 144 1 uspA Universal stress protein A Escherichia coli (strain K12)
P0AED1 5.4e-92 265 88 0 144 3 uspA Universal stress protein A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AED2 5.4e-92 265 88 0 144 3 uspA Universal stress protein A Escherichia coli O157:H7
Q8ZLD7 7.51e-92 265 87 0 144 3 uspA Universal stress protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z268 1.95e-91 264 87 0 144 3 uspA Universal stress protein A Salmonella typhi
Q8ZA49 8.52e-91 263 87 0 143 3 uspA Universal stress protein A Yersinia pestis
P60004 3.16e-90 261 89 0 143 3 uspA Universal stress protein A Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P44880 1.58e-66 201 67 0 140 1 uspA Universal stress protein A homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CLE9 4.09e-65 197 65 0 140 3 uspA Universal stress protein A homolog Pasteurella multocida (strain Pm70)
Q7VLK1 1.45e-53 168 56 0 140 3 uspA Universal stress protein A homolog Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q89A25 1.64e-42 140 46 1 140 3 uspA Universal stress protein A Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9RM66 2.58e-31 112 40 2 143 3 uspC Universal stress protein C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X560 2.25e-27 102 37 2 143 3 uspC Universal stress protein C Escherichia coli O157:H7
Q8FGN7 1.26e-26 100 36 2 143 3 uspC Universal stress protein C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z5U4 5.19e-26 98 40 2 125 3 uspC Universal stress protein C Salmonella typhi
P46888 1.06e-25 97 36 2 143 2 uspC Universal stress protein C Escherichia coli (strain K12)
P67089 1.39e-25 97 36 0 141 3 uspD Universal stress protein D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67090 1.39e-25 97 36 0 141 3 uspD Universal stress protein D Escherichia coli O157:H7
P0AAB9 1.45e-25 97 36 0 141 3 uspD Universal stress protein D Shigella flexneri
P0AAB8 1.45e-25 97 36 0 141 2 uspD Universal stress protein D Escherichia coli (strain K12)
Q83AC1 2.49e-13 65 34 6 149 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q49YE0 0.000116 43 27 1 111 3 SSP1056 Putative universal stress protein SSP1056 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P45680 0.000581 41 24 4 142 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14880
Feature type CDS
Gene uspA
Product universal stress protein UspA
Location 3303320 - 3303754 (strand: -1)
Length 435 (nucleotides) / 144 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1583
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06149 universal stress protein A - -

Protein Sequence

MAYKHILVAVDLSPESNVLVQKAVSMAKPYNAKVSLIHVDVNYSDLYTGLIDVNLGDMQQRITDETRNALKDLSDNSGYEIQETLSGSGDLGQVLVDAIKKYDMDLVVCGHHQDFWSKLMSSARQLINTVHVDMLIVPLKDDEE

Flanking regions ( +/- flanking 50bp)

GGCGTAATAGCCTTTCCGACCGATTAATCAGCTTATGGAAGGAGTTTACGATGGCTTATAAGCATATTCTAGTTGCAGTTGATTTATCCCCTGAGAGCAACGTCTTGGTGCAGAAAGCTGTATCTATGGCAAAACCCTATAATGCCAAAGTTTCCTTAATTCACGTTGATGTTAACTACTCTGATCTGTATACCGGTTTAATTGATGTTAACCTTGGTGATATGCAACAACGCATCACTGATGAAACACGTAATGCACTAAAAGATCTCTCTGATAACTCAGGTTATGAGATCCAAGAAACACTCAGTGGTAGCGGGGATTTAGGCCAAGTTCTTGTTGATGCGATTAAAAAATACGATATGGACTTAGTGGTTTGTGGTCATCACCAAGATTTCTGGAGCAAATTGATGTCATCAGCACGTCAACTAATTAATACCGTTCATGTTGATATGTTAATTGTTCCTCTGAAAGATGATGAAGAGTAATCAACTGATTATTTAAGCAAAAAAAATGCCTGCTTATGCAGGTATTTTTT