Homologs in group_1733

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12095 FBDBKF_12095 90.3 Morganella morganii S1 typA ribosome-dependent GTPase TypA
EHELCC_14210 EHELCC_14210 90.3 Morganella morganii S2 typA ribosome-dependent GTPase TypA
NLDBIP_15305 NLDBIP_15305 90.3 Morganella morganii S4 typA ribosome-dependent GTPase TypA
LHKJJB_15305 LHKJJB_15305 90.3 Morganella morganii S3 typA ribosome-dependent GTPase TypA
HKOGLL_14425 HKOGLL_14425 90.3 Morganella morganii S5 typA ribosome-dependent GTPase TypA
F4V73_RS14550 F4V73_RS14550 88.3 Morganella psychrotolerans typA translational GTPase TypA

Distribution of the homologs in the orthogroup group_1733

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1733

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A3B4 0.0 1088 86 0 603 3 bipA Large ribosomal subunit assembly factor BipA Shigella flexneri
P0DTT0 0.0 1088 86 0 603 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli (strain K12)
P0A3B1 0.0 1088 86 0 603 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A3B3 0.0 1088 86 0 603 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O157:H7
P0A3B2 0.0 1088 86 0 603 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
H9L427 0.0 1087 86 0 604 1 bipA Large ribosomal subunit assembly factor BipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44910 0.0 1016 80 1 603 1 bipA Large ribosomal subunit assembly factor BipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57508 0.0 905 70 0 602 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9C8 0.0 899 68 0 602 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AC9 0.0 852 66 1 602 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O07631 0.0 692 55 0 594 2 bipA Large ribosomal subunit assembly factor BipA Bacillus subtilis (strain 168)
O25225 0.0 647 51 3 603 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZLZ3 0.0 644 51 3 603 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain J99 / ATCC 700824)
P72749 0.0 632 53 2 587 3 bipA Large ribosomal subunit assembly factor BipA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
F4K410 0.0 575 47 3 588 1 SVR3 Putative elongation factor TypA-like SVR3, chloroplastic Arabidopsis thaliana
A0L631 1.37e-53 196 30 17 508 3 lepA Elongation factor 4 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A9RFQ5 9.95e-52 193 28 23 616 3 PHYPADRAFT_158777 Translation factor GUF1 homolog, chloroplastic Physcomitrium patens
Q3MG20 1.18e-51 191 30 17 520 3 lepA Elongation factor 4 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YU48 3.26e-51 189 30 17 520 3 lepA Elongation factor 4 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1XK44 1.35e-50 187 30 17 505 3 lepA Elongation factor 4 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A6TSM4 1.38e-50 187 30 21 535 3 lepA Elongation factor 4 Alkaliphilus metalliredigens (strain QYMF)
B9GHA6 4.57e-50 187 30 17 505 3 POPTRDRAFT_815670 Translation factor GUF1 homolog, chloroplastic Populus trichocarpa
B0C9R9 6.31e-50 186 31 19 524 3 lepA Elongation factor 4 Acaryochloris marina (strain MBIC 11017)
A5B4D2 9.52e-50 186 30 17 505 3 VITISV_013255 Translation factor GUF1 homolog, chloroplastic Vitis vinifera
Q3AF13 2.06e-49 184 30 17 518 3 lepA Elongation factor 4 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0JQT7 2.19e-49 184 31 18 507 3 lepA Elongation factor 4 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q2GJV7 3.02e-49 184 30 19 517 3 lepA Elongation factor 4 Anaplasma phagocytophilum (strain HZ)
O27131 5.16e-49 185 28 16 514 3 fusA Elongation factor 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A8MFA6 5.27e-49 183 31 18 501 3 lepA Elongation factor 4 Alkaliphilus oremlandii (strain OhILAs)
Q9X1V8 6.61e-49 183 31 19 543 3 lepA Elongation factor 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A4J7F8 7.2e-49 182 30 19 508 3 lepA Elongation factor 4 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q73HR8 8.4e-49 182 30 18 506 3 lepA Elongation factor 4 Wolbachia pipientis wMel
B7IYH2 1.29e-48 182 30 22 561 3 lepA Elongation factor 4 Bacillus cereus (strain G9842)
B1WWD8 1.32e-48 182 31 19 507 3 lepA Elongation factor 4 Crocosphaera subtropica (strain ATCC 51142 / BH68)
C0R5S3 1.34e-48 182 30 18 506 3 lepA Elongation factor 4 Wolbachia sp. subsp. Drosophila simulans (strain wRi)
O67618 2.24e-48 181 28 19 556 1 lepA Elongation factor 4 Aquifex aeolicus (strain VF5)
B7K3Z7 3.56e-48 181 30 19 524 3 lepA Elongation factor 4 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q3SVT1 3.77e-48 181 30 20 516 3 lepA Elongation factor 4 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q182F4 5.39e-48 180 30 17 493 3 lepA Elongation factor 4 Clostridioides difficile (strain 630)
B7KJX0 6.8e-48 180 30 19 534 3 lepA Elongation factor 4 Gloeothece citriformis (strain PCC 7424)
Q1LTI1 6.94e-48 180 29 17 509 3 lepA Elongation factor 4 Baumannia cicadellinicola subsp. Homalodisca coagulata
B8I3E6 8.21e-48 180 30 20 510 3 lepA Elongation factor 4 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q7U5L9 8.53e-48 180 30 19 520 3 lepA Elongation factor 4 Parasynechococcus marenigrum (strain WH8102)
Q0VP16 1.33e-47 179 29 18 516 3 lepA Elongation factor 4 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q818E4 1.42e-47 179 30 21 559 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A4XKA0 1.44e-47 179 30 15 504 3 lepA Elongation factor 4 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B7HCU5 1.6e-47 179 30 21 559 3 lepA Elongation factor 4 Bacillus cereus (strain B4264)
A8FFD6 1.85e-47 179 29 21 553 3 lepA Elongation factor 4 Bacillus pumilus (strain SAFR-032)
Q2JWR1 1.95e-47 179 30 15 478 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-3-3Ab)
Q2IIA6 2.07e-47 179 29 19 520 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q112D2 2.13e-47 179 29 17 520 3 lepA Elongation factor 4 Trichodesmium erythraeum (strain IMS101)
P56865 2.18e-47 179 29 17 506 3 lepA Elongation factor 4 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A7HCF3 2.4e-47 178 28 16 514 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain Fw109-5)
Q11AY3 2.42e-47 179 31 23 523 3 lepA Elongation factor 4 Chelativorans sp. (strain BNC1)
Q892Q6 2.61e-47 178 30 18 484 3 lepA Elongation factor 4 Clostridium tetani (strain Massachusetts / E88)
Q01SV7 2.88e-47 178 30 16 508 3 lepA Elongation factor 4 Solibacter usitatus (strain Ellin6076)
Q9KD76 2.94e-47 178 30 19 502 3 lepA Elongation factor 4 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2JQ51 2.98e-47 178 30 16 478 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6HDK2 3.09e-47 178 29 20 559 3 lepA Elongation factor 4 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M2 3.09e-47 178 29 20 559 3 lepA Elongation factor 4 Bacillus cereus (strain ZK / E33L)
C1ESL3 3.09e-47 178 29 20 559 3 lepA Elongation factor 4 Bacillus cereus (strain 03BB102)
A0RIT7 3.09e-47 178 29 20 559 3 lepA Elongation factor 4 Bacillus thuringiensis (strain Al Hakam)
P74751 3.2e-47 178 30 20 533 3 lepA Elongation factor 4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q81LR7 3.77e-47 178 30 20 559 3 lepA Elongation factor 4 Bacillus anthracis
C3P8M5 3.77e-47 178 30 20 559 3 lepA Elongation factor 4 Bacillus anthracis (strain A0248)
B9MJZ5 4.15e-47 178 29 14 503 3 lepA Elongation factor 4 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q7W5J4 4.31e-47 177 29 17 506 3 lepA Elongation factor 4 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD30 4.31e-47 177 29 17 506 3 lepA Elongation factor 4 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q730L6 6.48e-47 177 29 21 561 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 10987 / NRS 248)
C3L5S2 6.55e-47 177 29 20 559 3 lepA Elongation factor 4 Bacillus anthracis (strain CDC 684 / NRRL 3495)
B3CPV1 7.83e-47 177 29 17 520 3 lepA Elongation factor 4 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
B9RHQ5 8.85e-47 178 29 17 509 3 RCOM_1767360 Translation factor GUF1 homolog, chloroplastic Ricinus communis
Q2KWY3 9.98e-47 177 29 17 513 3 lepA Elongation factor 4 Bordetella avium (strain 197N)
A4VIX2 1.04e-46 177 29 17 506 3 lepA Elongation factor 4 Stutzerimonas stutzeri (strain A1501)
Q65H50 1.14e-46 177 28 20 559 3 lepA Elongation factor 4 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q89BJ8 1.31e-46 176 30 20 518 3 lepA Elongation factor 4 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8JAF3 1.31e-46 176 28 18 515 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B7HPL8 1.56e-46 176 29 20 559 3 lepA Elongation factor 4 Bacillus cereus (strain AH187)
B7JNV1 1.56e-46 176 29 20 559 3 lepA Elongation factor 4 Bacillus cereus (strain AH820)
A9VHU6 1.59e-46 176 29 19 547 3 lepA Elongation factor 4 Bacillus mycoides (strain KBAB4)
Q3ALG5 1.6e-46 176 30 19 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9605)
B9IY86 1.99e-46 176 29 20 559 3 lepA Elongation factor 4 Bacillus cereus (strain Q1)
Q30Q17 2.12e-46 176 29 19 507 3 lepA Elongation factor 4 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5WHG5 2.14e-46 176 30 18 504 3 lepA Elongation factor 4 Shouchella clausii (strain KSM-K16)
A5FY07 2.17e-46 176 27 21 593 3 lepA Elongation factor 4 Acidiphilium cryptum (strain JF-5)
Q5KWZ3 3.1e-46 176 28 21 553 3 lepA Elongation factor 4 Geobacillus kaustophilus (strain HTA426)
C1DQS0 3.1e-46 175 28 16 506 3 lepA Elongation factor 4 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q5GRW9 3.34e-46 175 28 18 519 3 lepA Elongation factor 4 Wolbachia sp. subsp. Brugia malayi (strain TRS)
B8CQJ7 3.41e-46 175 27 23 568 3 lepA Elongation factor 4 Shewanella piezotolerans (strain WP3 / JCM 13877)
B4UDQ7 3.8e-46 175 29 18 520 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain K)
Q8RFD1 3.92e-46 175 30 18 510 3 lepA Elongation factor 4 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
C4LBZ6 4.06e-46 175 29 19 518 3 lepA Elongation factor 4 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A9BE39 4.3e-46 175 29 18 525 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9211)
Q5E312 4.88e-46 175 27 22 570 3 lepA Elongation factor 4 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2GGA6 4.9e-46 175 31 18 506 3 lepA Elongation factor 4 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B2J0M4 4.9e-46 175 29 19 522 3 lepA Elongation factor 4 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A7GHI0 4.98e-46 175 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM7 4.98e-46 175 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Okra / Type B1)
Q8DM20 5.63e-46 174 29 17 508 3 lepA Elongation factor 4 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1QR19 6.06e-46 175 29 19 507 3 lepA Elongation factor 4 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A7Z6W5 6.09e-46 175 28 20 554 3 lepA Elongation factor 4 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9PKX6 6.37e-46 174 27 18 516 3 lepA Elongation factor 4 Chlamydia muridarum (strain MoPn / Nigg)
Q9FNM5 7.07e-46 176 30 21 506 1 At5g08650 Translation factor GUF1 homolog, chloroplastic Arabidopsis thaliana
Q7MHN6 7.98e-46 174 28 18 513 3 lepA Elongation factor 4 Vibrio vulnificus (strain YJ016)
Q8DC78 7.98e-46 174 28 18 513 3 lepA Elongation factor 4 Vibrio vulnificus (strain CMCP6)
A5G4G3 8.05e-46 174 29 19 529 3 lepA Elongation factor 4 Geotalea uraniireducens (strain Rf4)
A5I644 8.06e-46 174 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL9 8.06e-46 174 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain ATCC 19397 / Type A)
C1FVU4 8.14e-46 174 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Kyoto / Type A2)
Q5JFZ3 8.21e-46 176 28 20 555 3 fusA Elongation factor 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B1JRC5 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667U9 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKE6 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R400 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD74 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pestis
B2KA49 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C557 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT7 9.33e-46 174 27 19 568 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4XSC1 1.06e-45 174 29 18 507 3 lepA Elongation factor 4 Pseudomonas mendocina (strain ymp)
Q5L659 1.08e-45 174 27 17 516 3 lepA Elongation factor 4 Chlamydia abortus (strain DSM 27085 / S26/3)
Q2NJE6 1.08e-45 174 29 13 502 3 lepA Elongation factor 4 Aster yellows witches'-broom phytoplasma (strain AYWB)
Q3YYU7 1.18e-45 174 28 17 506 3 lepA Elongation factor 4 Shigella sonnei (strain Ss046)
Q4FUV9 1.46e-45 173 27 23 568 3 lepA Elongation factor 4 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QDV6 1.49e-45 173 27 23 568 3 lepA Elongation factor 4 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A4Y4K2 1.52e-45 173 26 22 608 3 lepA Elongation factor 4 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C4K3Z1 1.57e-45 173 28 17 507 3 lepA Elongation factor 4 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
C1D7L2 1.57e-45 173 28 16 503 3 lepA Elongation factor 4 Laribacter hongkongensis (strain HLHK9)
Q2RKX8 1.62e-45 173 30 17 513 3 lepA Elongation factor 4 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1QX26 1.64e-45 173 29 19 519 3 lepA Elongation factor 4 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4TKY0 1.72e-45 173 28 16 508 3 lepA Elongation factor 4 Yersinia pestis (strain Pestoides F)
Q46GZ6 1.94e-45 173 29 18 525 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL2A)
B1KZP1 2.09e-45 173 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Loch Maree / Type A3)
Q15R31 2.23e-45 173 26 20 567 3 lepA Elongation factor 4 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B1ZC10 2.44e-45 173 28 21 591 3 lepA Elongation factor 4 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A2C0M8 2.48e-45 173 29 18 525 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL1A)
Q9I5G8 2.54e-45 173 27 18 536 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HR9 2.54e-45 173 27 18 536 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYX5 2.54e-45 173 27 18 536 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain LESB58)
P37949 2.63e-45 173 28 20 554 3 lepA Elongation factor 4 Bacillus subtilis (strain 168)
A1RMC9 2.69e-45 172 26 23 608 3 lepA Elongation factor 4 Shewanella sp. (strain W3-18-1)
A8G3D2 2.95e-45 172 29 17 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9215)
B1KI55 3.12e-45 172 26 23 609 3 lepA Elongation factor 4 Shewanella woodyi (strain ATCC 51908 / MS32)
A5GMR2 3.18e-45 172 29 19 520 3 lepA Elongation factor 4 Synechococcus sp. (strain WH7803)
A6WKQ5 3.47e-45 172 26 22 608 3 lepA Elongation factor 4 Shewanella baltica (strain OS185)
A3D1V4 3.47e-45 172 26 22 608 3 lepA Elongation factor 4 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A2CBG9 3.58e-45 172 29 18 519 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9303)
A9L5N4 3.91e-45 172 26 22 608 3 lepA Elongation factor 4 Shewanella baltica (strain OS195)
B8EBQ4 3.91e-45 172 26 22 608 3 lepA Elongation factor 4 Shewanella baltica (strain OS223)
A4IR35 4.01e-45 172 28 21 553 3 lepA Elongation factor 4 Geobacillus thermodenitrificans (strain NG80-2)
A5D3X6 4.04e-45 172 30 19 506 3 lepA Elongation factor 4 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P60792 4.04e-45 172 29 14 504 3 lepA Elongation factor 4 Onion yellows phytoplasma (strain OY-M)
Q7VJZ1 4.48e-45 172 29 18 505 3 lepA Elongation factor 4 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2Y873 4.5e-45 172 27 20 566 3 lepA Elongation factor 4 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B5FAH2 4.55e-45 172 27 21 570 3 lepA Elongation factor 4 Aliivibrio fischeri (strain MJ11)
A3DF29 4.6e-45 172 29 15 483 3 lepA Elongation factor 4 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A6Q241 5e-45 172 28 17 506 3 lepA Elongation factor 4 Nitratiruptor sp. (strain SB155-2)
Q3J8D2 5.49e-45 172 28 17 508 3 lepA Elongation factor 4 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q7NGX4 6.27e-45 172 30 16 505 3 lepA Elongation factor 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B9M4U5 6.39e-45 172 28 20 568 3 lepA Elongation factor 4 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A6VAK9 7.05e-45 171 27 18 536 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain PA7)
Q39US7 7.41e-45 171 29 19 528 3 lepA Elongation factor 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q3KMV7 8.18e-45 171 27 16 498 3 lepA Elongation factor 4 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q7V8S4 8.31e-45 171 29 18 519 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9313)
A2BPP8 8.59e-45 171 28 17 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain AS9601)
C3L3H1 8.93e-45 171 30 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain 657 / Type Ba4)
B0BB51 9.29e-45 171 27 16 498 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9H2 9.29e-45 171 27 16 498 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B0K3Y4 1.01e-44 171 29 19 511 3 lepA Elongation factor 4 Thermoanaerobacter sp. (strain X514)
B8HLK8 1.01e-44 171 29 17 505 3 lepA Elongation factor 4 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A7GT14 1.07e-44 171 29 21 560 3 lepA Elongation factor 4 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q07YZ4 1.12e-44 171 27 24 608 3 lepA Elongation factor 4 Shewanella frigidimarina (strain NCIMB 400)
A1U2V8 1.12e-44 171 28 14 480 3 lepA Elongation factor 4 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
C3LR06 1.15e-44 171 29 19 509 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain M66-2)
Q9KPB0 1.15e-44 171 29 19 509 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5G3 1.15e-44 171 29 19 509 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q5NLP5 1.23e-44 171 29 18 514 3 lepA Elongation factor 4 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
O84067 1.28e-44 171 27 16 498 3 lepA Elongation factor 4 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q823H7 1.31e-44 171 27 17 517 3 lepA Elongation factor 4 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B5EB36 1.41e-44 171 28 21 576 3 lepA Elongation factor 4 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A3PBD8 1.55e-44 171 29 16 506 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9301)
Q1I5V6 1.56e-44 171 28 18 507 3 lepA Elongation factor 4 Pseudomonas entomophila (strain L48)
Q3SH47 1.67e-44 171 30 17 509 3 lepA Elongation factor 4 Thiobacillus denitrificans (strain ATCC 25259)
Q72KV2 1.84e-44 171 29 21 531 3 lepA Elongation factor 4 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A5W8F4 2.07e-44 170 28 18 508 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3AWX3 2.26e-44 170 30 20 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9902)
Q88MY7 2.4e-44 170 28 18 508 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q12KH9 2.42e-44 170 26 23 609 3 lepA Elongation factor 4 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9M3J8 2.58e-44 170 26 19 565 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C (strain 053442)
A6SXR0 2.63e-44 170 28 16 505 3 lepA Elongation factor 4 Janthinobacterium sp. (strain Marseille)
B6EKN1 2.68e-44 170 29 21 510 3 lepA Elongation factor 4 Aliivibrio salmonicida (strain LFI1238)
B1X3K4 3.04e-44 170 31 19 476 3 lepA Translation factor GUF1 homolog, organellar chromatophore Paulinella chromatophora
A5ULM6 3.06e-44 171 28 14 465 3 fusA Elongation factor 2 Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q0AWL9 3.1e-44 170 29 19 511 3 lepA Elongation factor 4 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9K055 3.1e-44 169 26 19 565 3 lepA Elongation factor 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6D217 3.38e-44 169 27 19 568 3 lepA Elongation factor 4 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1IXW5 3.5e-44 169 30 20 507 3 lepA Elongation factor 4 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A9III9 3.63e-44 169 28 17 506 3 lepA Elongation factor 4 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q97JJ6 3.88e-44 169 29 18 506 3 lepA Elongation factor 4 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6TCI3 3.99e-44 169 27 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q2NS11 4.4e-44 169 28 16 506 3 lepA Elongation factor 4 Sodalis glossinidius (strain morsitans)
Q0AF67 4.43e-44 169 27 21 570 3 lepA Elongation factor 4 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A0KGF0 4.5e-44 169 27 25 619 3 lepA Elongation factor 4 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1KT27 4.73e-44 169 26 19 565 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B7GKC4 4.94e-44 169 28 21 552 3 lepA Elongation factor 4 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5SKA7 5.22e-44 169 29 20 530 1 lepA Elongation factor 4 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B0TAD2 5.49e-44 169 30 18 502 3 lepA Elongation factor 4 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q9Z8I4 6.13e-44 169 28 17 517 3 lepA Elongation factor 4 Chlamydia pneumoniae
A1SSM6 6.18e-44 169 28 19 482 3 lepA Elongation factor 4 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q31CB8 6.32e-44 169 28 17 525 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9312)
Q0HSI9 7.04e-44 169 26 23 608 3 lepA Elongation factor 4 Shewanella sp. (strain MR-7)
Q0HG96 7.04e-44 169 26 23 608 3 lepA Elongation factor 4 Shewanella sp. (strain MR-4)
B4RK41 7.49e-44 169 27 17 513 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P9 7.49e-44 169 27 17 513 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q98DV1 7.66e-44 169 29 21 517 3 lepA Elongation factor 4 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O51115 8.32e-44 169 29 17 502 3 lepA Elongation factor 4 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9JV65 8.34e-44 168 26 19 565 3 lepA Elongation factor 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0TNS2 8.5e-44 168 29 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A1S3X9 9.53e-44 168 27 22 568 3 lepA Elongation factor 4 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A7ZCJ3 9.91e-44 168 27 18 564 3 lepA Elongation factor 4 Campylobacter concisus (strain 13826)
Q8RB72 9.93e-44 168 30 19 508 3 lepA Elongation factor 4 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2GD00 1.09e-43 168 30 15 461 3 lepA Elongation factor 4 Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q1H2L5 1.11e-43 168 28 16 480 3 lepA1 Elongation factor 4 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B5XNG8 1.18e-43 168 27 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae (strain 342)
A7MH13 1.25e-43 168 27 15 505 3 lepA Elongation factor 4 Cronobacter sakazakii (strain ATCC BAA-894)
Q0SRD8 1.27e-43 168 29 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain SM101 / Type A)
Q8XIS6 1.27e-43 168 29 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain 13 / Type A)
B9F2U5 1.31e-43 169 28 20 519 3 Os02g0157700 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. japonica
Q21IH3 1.49e-43 168 27 19 513 3 lepA Elongation factor 4 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B0UFE0 1.62e-43 167 28 22 596 3 lepA Elongation factor 4 Methylobacterium sp. (strain 4-46)
A0KZN4 1.63e-43 167 26 23 608 3 lepA Elongation factor 4 Shewanella sp. (strain ANA-3)
B8ENL1 1.69e-43 167 29 20 517 3 lepA Elongation factor 4 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B7VK81 1.8e-43 167 26 17 565 3 lepA Elongation factor 4 Vibrio atlanticus (strain LGP32)
A8EY28 1.86e-43 167 28 23 538 3 lepA Elongation factor 4 Rickettsia canadensis (strain McKiel)
B0KA85 1.95e-43 167 29 20 512 3 lepA Elongation factor 4 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q0BH06 2.21e-43 167 27 17 508 3 lepA Elongation factor 4 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YVM2 2.21e-43 167 27 17 508 3 lepA Elongation factor 4 Burkholderia ambifaria (strain MC40-6)
A3QBS5 2.23e-43 167 27 17 508 3 lepA Elongation factor 4 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A4JCQ9 2.23e-43 167 27 17 508 3 lepA Elongation factor 4 Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2SZV7 2.3e-43 167 29 17 509 3 lepA Elongation factor 4 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B3PLG4 2.34e-43 167 28 19 537 3 lepA Elongation factor 4 Cellvibrio japonicus (strain Ueda107)
Q7UX15 2.37e-43 167 29 17 498 3 lepA1 Elongation factor 4 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q87XF8 2.45e-43 167 28 18 506 3 lepA Elongation factor 4 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B7KR78 2.49e-43 167 27 21 592 3 lepA Elongation factor 4 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B5ZBD4 2.53e-43 167 29 22 513 3 lepA Elongation factor 4 Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q0SP76 2.78e-43 167 29 19 505 3 lepA Elongation factor 4 Borreliella afzelii (strain PKo)
A0RQX4 2.9e-43 167 28 18 517 3 lepA Elongation factor 4 Campylobacter fetus subsp. fetus (strain 82-40)
C4Z9E3 2.9e-43 167 30 18 503 3 lepA Elongation factor 4 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q2RNY6 2.91e-43 167 27 19 539 3 lepA Elongation factor 4 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7N1X3 3.28e-43 167 29 19 509 3 lepA Elongation factor 4 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1V9C5 3.28e-43 167 28 17 510 3 lepA Elongation factor 4 Phytoplasma australiense
A5VB59 3.3e-43 167 28 19 518 3 lepA Elongation factor 4 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A4WDE0 3.52e-43 167 27 15 505 3 lepA Elongation factor 4 Enterobacter sp. (strain 638)
A4SRD4 3.57e-43 167 27 25 619 3 lepA Elongation factor 4 Aeromonas salmonicida (strain A449)
A7GZW3 3.77e-43 166 28 19 564 3 lepA Elongation factor 4 Campylobacter curvus (strain 525.92)
B0KV29 4.5e-43 166 28 18 508 3 lepA Elongation factor 4 Pseudomonas putida (strain GB-1)
P60789 4.55e-43 166 28 18 529 3 lepA Elongation factor 4 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8UIQ2 4.74e-43 166 28 18 519 3 lepA Elongation factor 4 Agrobacterium fabrum (strain C58 / ATCC 33970)
B8BYH3 4.79e-43 167 26 18 604 3 THAPSDRAFT_40001 Translation factor GUF1 homolog, mitochondrial Thalassiosira pseudonana
B5EQB5 4.87e-43 166 29 17 506 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9J8 4.87e-43 166 29 17 506 3 lepA Elongation factor 4 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q13VM6 5.37e-43 166 28 17 509 3 lepA Elongation factor 4 Paraburkholderia xenovorans (strain LB400)
C6DC02 5.62e-43 166 28 16 508 3 lepA Elongation factor 4 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1AWP9 5.72e-43 166 28 18 511 3 lepA Elongation factor 4 Ruthia magnifica subsp. Calyptogena magnifica
A8GI27 6.24e-43 166 27 19 568 3 lepA Elongation factor 4 Serratia proteamaculans (strain 568)
Q4L6T4 6.33e-43 166 28 22 549 3 lepA Elongation factor 4 Staphylococcus haemolyticus (strain JCSC1435)
P60930 6.57e-43 166 27 15 507 3 lepA Elongation factor 4 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8EH83 6.64e-43 166 25 22 608 3 lepA Elongation factor 4 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3J4P0 7.44e-43 166 29 16 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
C6DZ67 7.45e-43 166 29 21 537 3 lepA Elongation factor 4 Geobacter sp. (strain M21)
A8FSD4 7.46e-43 166 26 23 609 3 lepA Elongation factor 4 Shewanella sediminis (strain HAW-EB3)
A7I1F0 7.99e-43 166 29 19 504 3 lepA Elongation factor 4 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2SXT6 8.58e-43 166 27 17 508 3 lepA Elongation factor 4 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2LTN3 9.12e-43 166 29 15 497 3 lepA Elongation factor 4 Syntrophus aciditrophicus (strain SB)
Q1BXU3 9.27e-43 166 27 18 511 3 lepA Elongation factor 4 Burkholderia orbicola (strain AU 1054)
B1JYB1 9.27e-43 166 27 18 511 3 lepA Elongation factor 4 Burkholderia orbicola (strain MC0-3)
A0K5V7 9.27e-43 166 27 18 511 3 lepA Elongation factor 4 Burkholderia cenocepacia (strain HI2424)
B1J4D8 9.32e-43 166 28 18 508 3 lepA Elongation factor 4 Pseudomonas putida (strain W619)
A5GRE6 9.63e-43 166 28 18 519 3 lepA Elongation factor 4 Synechococcus sp. (strain RCC307)
Q39I75 9.73e-43 165 27 19 514 3 lepA Elongation factor 4 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9HM85 9.89e-43 167 28 14 477 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R8C8 9.89e-43 167 28 14 477 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B9E6X5 1.23e-42 165 30 20 506 3 lepA Elongation factor 4 Macrococcus caseolyticus (strain JCSC5402)
B8AI54 1.41e-42 166 28 20 515 3 OsI_05919 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. indica
Q7VL73 1.41e-42 165 27 17 506 3 lepA Elongation factor 4 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0ICF2 1.45e-42 165 28 19 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9311)
A5WCD6 1.46e-42 165 28 21 510 3 lepA Elongation factor 4 Psychrobacter sp. (strain PRwf-1)
B9KNH9 1.5e-42 165 29 16 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q1GIV5 1.59e-42 165 29 20 514 3 lepA Elongation factor 4 Ruegeria sp. (strain TM1040)
C3PMX3 1.61e-42 165 28 22 524 3 lepA Elongation factor 4 Rickettsia africae (strain ESF-5)
C5JRK2 1.69e-42 166 28 20 575 3 GUF1 Translation factor GUF1, mitochondrial Blastomyces gilchristii (strain SLH14081)
C5GRI9 1.69e-42 166 28 20 575 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
O25122 1.72e-42 165 27 18 551 3 lepA Elongation factor 4 Helicobacter pylori (strain ATCC 700392 / 26695)
Q254E1 2.13e-42 164 27 17 517 3 lepA Elongation factor 4 Chlamydia felis (strain Fe/C-56)
A1CLD7 2.15e-42 165 28 19 548 3 guf1 Translation factor guf1, mitochondrial Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q0A8Z4 2.21e-42 165 28 19 509 3 lepA Elongation factor 4 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3YSC2 2.32e-42 164 30 19 506 3 lepA Elongation factor 4 Ehrlichia canis (strain Jake)
Q8DTF3 2.32e-42 164 28 23 555 3 lepA Elongation factor 4 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A9ADE0 2.55e-42 164 27 17 508 3 lepA Elongation factor 4 Burkholderia multivorans (strain ATCC 17616 / 249)
Q24SR6 2.58e-42 164 30 17 481 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain Y51)
B8FUP2 2.58e-42 164 30 17 481 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C5BRN3 2.8e-42 164 28 19 513 3 lepA Elongation factor 4 Teredinibacter turnerae (strain ATCC 39867 / T7901)
A1JKK1 2.85e-42 164 28 16 508 3 lepA Elongation factor 4 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6HPI9 3.09e-42 165 28 21 578 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain H143)
Q63S94 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain K96243)
A3NBT1 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 668)
Q3JQ75 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1710b)
A3NXL8 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1106a)
A1V6B9 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain SAVP1)
Q62LT1 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain ATCC 23344)
A2S9Z3 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10229)
A3MM44 3.13e-42 164 26 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10247)
A3PHQ9 3.39e-42 164 29 16 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q47WP3 3.54e-42 164 27 22 573 3 lepA Elongation factor 4 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B1XTL2 3.84e-42 164 27 18 516 3 lepA Elongation factor 4 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q831Z0 4.08e-42 164 30 18 509 3 lepA Elongation factor 4 Enterococcus faecalis (strain ATCC 700802 / V583)
C5BAI0 4.18e-42 164 28 16 509 3 lepA Elongation factor 4 Edwardsiella ictaluri (strain 93-146)
A2RL76 4.2e-42 164 29 21 559 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain MG1363)
Q4FNH3 4.71e-42 164 28 16 507 3 lepA Elongation factor 4 Pelagibacter ubique (strain HTCC1062)
Q02Z80 6.56e-42 163 29 21 559 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain SK11)
Q5FHQ1 6.62e-42 163 29 17 506 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Gardel)
Q7VDF7 6.68e-42 163 28 18 519 3 lepA Elongation factor 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q5HBH4 6.81e-42 163 29 17 506 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Welgevonden)
Q92SU3 6.9e-42 163 28 20 516 3 lepA Elongation factor 4 Rhizobium meliloti (strain 1021)
B4RVA8 7.22e-42 163 28 20 508 3 lepA Elongation factor 4 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q0BRZ7 7.27e-42 163 27 17 508 3 lepA Elongation factor 4 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B2USI5 7.51e-42 163 28 18 507 3 lepA Elongation factor 4 Helicobacter pylori (strain Shi470)
Q92IQ1 7.62e-42 163 28 23 524 3 lepA Elongation factor 4 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B0TIV5 8.39e-42 162 27 24 609 3 lepA Elongation factor 4 Shewanella halifaxensis (strain HAW-EB4)
A1W018 9.12e-42 162 25 19 568 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PNR1 9.12e-42 162 25 19 568 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FM79 9.12e-42 162 25 19 568 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
C0NZL9 9.14e-42 163 28 20 575 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
A7H311 9.62e-42 162 25 19 568 3 lepA Elongation factor 4 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A7IEG8 9.73e-42 162 29 19 508 3 lepA Elongation factor 4 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B6JJT7 9.82e-42 162 29 18 508 3 lepA Elongation factor 4 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B6IUG3 9.9e-42 162 28 21 544 3 lepA Elongation factor 4 Rhodospirillum centenum (strain ATCC 51521 / SW)
A2BV79 1e-41 162 27 18 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9515)
C3K6G8 1.01e-41 162 28 18 507 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain SBW25)
Q5HU70 1.02e-41 162 25 19 568 3 lepA Elongation factor 4 Campylobacter jejuni (strain RM1221)
B2GBR9 1.13e-41 162 28 20 518 3 lepA Elongation factor 4 Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q17X87 1.14e-41 162 27 17 510 3 lepA Elongation factor 4 Helicobacter acinonychis (strain Sheeba)
Q6F9B9 1.19e-41 162 27 18 512 3 lepA Elongation factor 4 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B6JKS8 1.25e-41 162 28 17 510 3 lepA Elongation factor 4 Helicobacter pylori (strain P12)
Q9ZDQ1 1.25e-41 162 29 21 517 3 lepA Elongation factor 4 Rickettsia prowazekii (strain Madrid E)
Q662S4 1.25e-41 162 29 18 503 3 lepA Elongation factor 4 Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q68X95 1.32e-41 162 28 20 515 3 lepA Elongation factor 4 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q608M4 1.33e-41 162 28 18 509 3 lepA Elongation factor 4 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A6RGX9 1.33e-41 163 28 20 575 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain NAm1 / WU24)
A8GRF6 1.39e-41 162 28 23 524 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Sheila Smith)
B0BWV5 1.39e-41 162 28 23 524 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Iowa)
C4K153 1.39e-41 162 28 24 526 3 lepA Elongation factor 4 Rickettsia peacockii (strain Rustic)
B6K6L6 1.5e-41 162 29 18 497 3 guf1 Translation factor guf1, mitochondrial Schizosaccharomyces japonicus (strain yFS275 / FY16936)
A0Q453 1.63e-41 162 27 19 545 3 lepA Elongation factor 4 Francisella tularensis subsp. novicida (strain U112)
Q9CGI8 1.83e-41 162 29 23 565 3 lepA Elongation factor 4 Lactococcus lactis subsp. lactis (strain IL1403)
Q4KHT3 1.84e-41 162 28 18 507 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B3ESU2 1.97e-41 162 28 17 505 3 lepA Elongation factor 4 Amoebophilus asiaticus (strain 5a2)
Q47EG0 2.05e-41 162 27 19 511 3 lepA Elongation factor 4 Dechloromonas aromatica (strain RCB)
B8IMT0 2.05e-41 162 28 23 603 3 lepA Elongation factor 4 Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q87LN7 2.15e-41 161 27 19 512 3 lepA Elongation factor 4 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A9MGX5 2.23e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3KHM1 2.45e-41 161 28 18 507 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain Pf0-1)
A0Q1R8 2.46e-41 161 28 17 499 3 lepA Elongation factor 4 Clostridium novyi (strain NT)
A4WX88 2.5e-41 161 29 16 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q8CP13 2.54e-41 161 28 21 549 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW2 2.54e-41 161 28 21 549 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A4G6S1 2.59e-41 161 28 16 510 3 lepA Elongation factor 4 Herminiimonas arsenicoxydans
A1K601 2.89e-41 161 28 15 505 3 lepA Elongation factor 4 Azoarcus sp. (strain BH72)
B2VI44 2.98e-41 161 29 17 508 3 lepA Elongation factor 4 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1ARG8 3.09e-41 161 29 20 531 3 lepA Elongation factor 4 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B2JFK0 3.17e-41 161 28 17 509 3 lepA Elongation factor 4 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A6VLV6 3.17e-41 161 27 17 506 3 lepA Elongation factor 4 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q3A445 3.38e-41 161 28 16 514 3 lepA Elongation factor 4 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5WVI1 3.41e-41 161 27 18 509 3 lepA Elongation factor 4 Legionella pneumophila (strain Lens)
B5RD51 3.48e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q1CUF5 3.5e-41 161 27 17 510 3 lepA Elongation factor 4 Helicobacter pylori (strain HPAG1)
Q2G550 3.62e-41 161 28 19 510 3 lepA Elongation factor 4 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
C4L433 3.67e-41 161 30 20 513 3 lepA Elongation factor 4 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q1GRH5 3.74e-41 161 26 21 553 3 lepA Elongation factor 4 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q48EV0 3.87e-41 160 28 18 505 3 lepA Elongation factor 4 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P0A1W4 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1W5 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella typhi
B4TS16 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella schwarzengrund (strain CVM19633)
B4T1G0 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella newport (strain SL254)
B4TE17 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella heidelberg (strain SL476)
B5QTV0 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella enteritidis PT4 (strain P125109)
B5FRC7 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella dublin (strain CT_02021853)
Q57LC8 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella choleraesuis (strain SC-B67)
B5F1G3 3.94e-41 161 28 20 548 3 lepA Elongation factor 4 Salmonella agona (strain SL483)
Q1MQF3 3.96e-41 161 28 16 506 3 lepA Elongation factor 4 Lawsonia intracellularis (strain PHE/MN1-00)
A8GW16 4.03e-41 161 27 20 518 3 lepA Elongation factor 4 Rickettsia bellii (strain OSU 85-389)
A8H1C5 4.11e-41 160 27 24 609 3 lepA Elongation factor 4 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8Y742 4.13e-41 161 29 18 511 3 lepA Elongation factor 4 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE32 4.13e-41 161 29 18 511 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ1 4.13e-41 161 29 18 511 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain F2365)
C1KVC6 4.13e-41 161 29 18 511 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5ZUD2 4.18e-41 161 27 18 509 3 lepA Elongation factor 4 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ID24 4.18e-41 161 27 18 509 3 lepA Elongation factor 4 Legionella pneumophila (strain Corby)
Q5X443 4.18e-41 161 27 18 509 3 lepA Elongation factor 4 Legionella pneumophila (strain Paris)
Q9PQG7 4.3e-41 160 28 22 513 3 lepA Elongation factor 4 Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIW2 4.3e-41 160 28 22 513 3 lepA Elongation factor 4 Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q4UKS2 4.35e-41 160 27 24 574 3 lepA Elongation factor 4 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2W0F9 4.44e-41 160 27 18 508 3 lepA Elongation factor 4 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3CRQ1 4.58e-41 160 27 18 506 3 lepA Elongation factor 4 Orientia tsutsugamushi (strain Ikeda)
A5CE57 4.71e-41 160 27 18 506 3 lepA Elongation factor 4 Orientia tsutsugamushi (strain Boryong)
B0VCT7 4.93e-41 160 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AYE)
A3M7P5 4.93e-41 160 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWQ2 4.93e-41 160 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ACICU)
B7I580 4.93e-41 160 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB0057)
B7GYS7 4.93e-41 160 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB307-0294)
C0M8H9 5.17e-41 160 30 20 507 3 lepA Elongation factor 4 Streptococcus equi subsp. equi (strain 4047)
B6I5E3 5.27e-41 160 29 16 505 3 lepA Elongation factor 4 Escherichia coli (strain SE11)
Q31R08 5.37e-41 160 29 20 522 3 lepA Elongation factor 4 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q31HP5 5.5e-41 160 28 18 507 3 lepA Elongation factor 4 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2SEJ6 5.51e-41 160 28 17 509 3 lepA Elongation factor 4 Francisella tularensis subsp. mediasiatica (strain FSC147)
A7MZB0 5.72e-41 160 27 20 510 3 lepA Elongation factor 4 Vibrio campbellii (strain ATCC BAA-1116)
C0PYG5 6.03e-41 160 28 20 548 3 lepA Elongation factor 4 Salmonella paratyphi C (strain RKS4594)
A5UFI9 6.2e-41 160 28 16 479 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittGG)
A5UBC2 6.2e-41 160 28 16 479 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittEE)
Q4QPM8 6.2e-41 160 28 16 479 3 lepA Elongation factor 4 Haemophilus influenzae (strain 86-028NP)
B4U3G9 6.21e-41 160 30 20 507 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
P61878 6.27e-41 162 27 16 548 3 fusA Elongation factor 2 Pyrococcus woesei
P61877 6.27e-41 162 27 16 548 3 fusA Elongation factor 2 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q92BN4 6.5e-41 160 29 18 511 3 lepA Elongation factor 4 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C8VPJ1 6.62e-41 161 27 22 587 3 guf1 Translation factor guf1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q49Y26 6.94e-41 160 29 19 506 3 lepA Elongation factor 4 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CXD0 7.01e-41 160 30 19 506 3 lepA Elongation factor 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4ZPD8 7.03e-41 160 28 18 505 3 lepA Elongation factor 4 Pseudomonas syringae pv. syringae (strain B728a)
Q65VN2 7.25e-41 160 27 17 508 3 lepA Elongation factor 4 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5FLU8 7.52e-41 160 30 18 513 3 lepA Elongation factor 4 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
P43729 7.66e-41 160 28 16 479 3 lepA Elongation factor 4 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7V2Q1 7.72e-41 160 28 18 519 3 lepA Elongation factor 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
C1GX39 7.81e-41 160 28 21 575 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
Q5NEF8 7.98e-41 160 27 16 507 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FW1 7.98e-41 160 27 16 507 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain FSC 198)
B5ZAB8 8.34e-41 160 28 18 507 3 lepA Elongation factor 4 Helicobacter pylori (strain G27)
Q88VN0 9.41e-41 160 29 16 498 3 lepA1 Elongation factor 4 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q0C5X0 9.58e-41 160 29 19 504 3 lepA Elongation factor 4 Hyphomonas neptunium (strain ATCC 15444)
A0AIS8 1.02e-40 160 29 18 511 3 lepA Elongation factor 4 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A4J080 1.08e-40 159 27 16 507 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q9ZM93 1.09e-40 159 28 21 549 3 lepA Elongation factor 4 Helicobacter pylori (strain J99 / ATCC 700824)
B0VTM2 1.18e-40 159 27 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain SDF)
C1C7G9 1.19e-40 159 28 23 549 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain 70585)
B5E4T8 1.19e-40 159 28 23 549 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 19F (strain G54)
Q2SL35 1.2e-40 159 27 16 479 3 lepA Elongation factor 4 Hahella chejuensis (strain KCTC 2396)
O93632 1.32e-40 160 26 13 461 3 fusA Elongation factor 2 Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A7I4X4 1.35e-40 160 28 13 473 3 fusA Elongation factor 2 Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
P60788 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Shigella flexneri
Q0T1T6 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Shigella flexneri serotype 5b (strain 8401)
Q31XR8 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Shigella boydii serotype 4 (strain Sb227)
B2TYI0 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LUZ5 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP82 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain SMS-3-5 / SECEC)
B7N6F7 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60785 1.42e-40 159 28 17 506 1 lepA Elongation factor 4 Escherichia coli (strain K12)
B1IVQ8 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60786 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TER9 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A379 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O9:H4 (strain HS)
B1XB43 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain K12 / DH10B)
C4ZYJ2 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain K12 / MC4100 / BW2952)
B7NRM2 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z143 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60787 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O157:H7
B7LDG2 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain 55989 / EAEC)
A7ZQ13 1.42e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R8G3 1.47e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain UTI89 / UPEC)
A1AE99 1.47e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O1:K1 / APEC
B7MYK1 1.47e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O81 (strain ED1a)
B7MIQ4 1.47e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH09 1.47e-40 159 28 17 506 3 lepA Elongation factor 4 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1D6M1 1.48e-40 159 29 16 486 3 lepA Elongation factor 4 Myxococcus xanthus (strain DK1622)
Q58448 1.68e-40 160 27 14 465 3 fusA Elongation factor 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6MEF3 1.75e-40 159 28 19 515 3 lepA Elongation factor 4 Protochlamydia amoebophila (strain UWE25)
B0TW33 1.76e-40 159 27 16 509 3 lepA Elongation factor 4 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B3PYC6 1.92e-40 159 28 19 509 3 lepA Elongation factor 4 Rhizobium etli (strain CIAT 652)
Q0BP65 2e-40 159 28 17 509 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5X6 2e-40 159 28 17 509 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain LVS)
A7N9A4 2e-40 159 28 17 509 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0SRL4 2.16e-40 159 28 19 525 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S8S7 2.16e-40 159 28 19 525 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B4U6M2 2.18e-40 159 27 16 510 3 lepA Elongation factor 4 Hydrogenobaculum sp. (strain Y04AAS1)
Q9A9F4 2.24e-40 159 28 18 515 3 lepA Elongation factor 4 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5N390 2.35e-40 159 29 20 522 3 lepA Elongation factor 4 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B5BAS8 2.54e-40 159 27 20 548 3 lepA Elongation factor 4 Salmonella paratyphi A (strain AKU_12601)
Q5PNC0 2.54e-40 159 27 20 548 3 lepA Elongation factor 4 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5ZXQ5 2.56e-40 159 28 19 509 3 lepA Elongation factor 4 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
P57806 2.61e-40 158 28 18 480 3 lepA Elongation factor 4 Pasteurella multocida (strain Pm70)
Q5FUC2 2.67e-40 158 28 19 508 3 lepA Elongation factor 4 Gluconobacter oxydans (strain 621H)
B4F049 2.69e-40 158 27 19 509 3 lepA Elongation factor 4 Proteus mirabilis (strain HI4320)
B8H2Z7 2.7e-40 158 28 18 515 3 lepA Elongation factor 4 Caulobacter vibrioides (strain NA1000 / CB15N)
Q2KDL5 2.71e-40 159 27 20 519 3 lepA Elongation factor 4 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B8DIZ5 2.89e-40 158 28 12 473 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q7NWC7 2.9e-40 158 28 16 503 3 lepA Elongation factor 4 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P60790 3.17e-40 158 29 16 510 3 lepA Elongation factor 4 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q3IDL4 3.28e-40 158 28 19 508 3 lepA Elongation factor 4 Pseudoalteromonas translucida (strain TAC 125)
B1IC02 3.4e-40 158 29 23 551 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Hungary19A-6)
B5XLC6 3.48e-40 158 28 23 557 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M49 (strain NZ131)
Q049W8 3.62e-40 158 29 17 509 3 lepA Elongation factor 4 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9R4 3.62e-40 158 29 17 509 3 lepA Elongation factor 4 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9RV84 3.77e-40 158 29 22 568 3 lepA Elongation factor 4 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14240
Feature type CDS
Gene typA
Product ribosome-dependent GTPase TypA
Location 3158166 - 3160001 (strand: -1)
Length 1836 (nucleotides) / 611 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1733
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF21018 TypA/BipA C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1217 Signal transduction mechanisms (T) T Predicted membrane GTPase TypA/BipA involved in stress response

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06207 GTP-binding protein - -

Protein Sequence

MPEANFVIENLRNIAIIAHVDHGKTTIVDKLLQQSGTFGERETVAERVMDSNDLERERGITILAKNTAIKWNDYRINIVDTPGHADFGGEVERVMSMVDSVLLLVDAMDGPMPQTRFVTQKAFANNLKPIVVINKVDRPGARPDWVVDQVFDLFVNLGATDEQLDFPIIYASALNGIAGTDYNDMADDMTPLYEAIVKYVEPPKVDLEGTFQMQISQLDYNNYLGVIGIGRIKRGKVKPNQQVTIIDSEGNTRNGKVGKVLGHLGLERIDVDVAEAGDIIAITGLGELNISDTICEVGAVEALPALAVDEPTVSMYFCVNTSPFCGREGKFVTSRQILDRLKKELVHNVALRVEETEDPDAFRVSGRGELHLSVLIENMRREGYELAVSRPKVIFREIDGRKQEPFEQVTIDIEEQHQGDVMQAMGERKGEMRDMQPDGKGRVRLDYIIPSRGLIGFRTEFMTMTSGTGLLYATFSHYDDVRPGEIGRRNNGVMISNGQGKAVAYALYSLQDRGKLFVTHGAEVYEGQVIGIHTRSNDLTVNCLTGKKLTNMRASGTDEATTLTPHIKQTLEQALEFIDDDELVEVTPQSIRLRKRHLSENDRRRAYRSKD

Flanking regions ( +/- flanking 50bp)

TTGTTTAGTCTCTCGTCTAAAGCGTGTACAATAACACGCTTATTTCTACAATGCCTGAGGCAAATTTTGTGATCGAAAACTTGCGTAATATCGCCATCATCGCCCACGTTGACCATGGTAAAACTACTATTGTCGATAAATTACTACAGCAATCTGGCACGTTCGGTGAACGTGAAACCGTTGCTGAGCGCGTGATGGACTCTAATGATCTCGAAAGAGAGCGCGGAATTACTATTCTTGCGAAAAATACAGCGATTAAATGGAATGACTATCGTATTAATATCGTAGATACCCCAGGACACGCCGACTTCGGTGGTGAGGTAGAACGCGTTATGTCTATGGTAGACAGCGTTCTATTGCTGGTTGACGCGATGGATGGCCCAATGCCACAAACTCGCTTTGTGACACAAAAAGCGTTTGCTAACAACTTAAAACCTATTGTTGTTATCAACAAAGTTGACCGTCCAGGTGCACGCCCTGATTGGGTTGTTGATCAGGTCTTTGATCTGTTTGTTAACTTAGGTGCGACTGACGAACAACTGGATTTCCCAATTATCTATGCATCAGCATTAAATGGTATTGCGGGAACAGATTATAATGACATGGCTGATGATATGACTCCATTATATGAAGCTATCGTCAAATATGTAGAGCCGCCAAAAGTCGATCTGGAGGGGACCTTCCAGATGCAGATTTCTCAGTTAGATTATAATAACTATCTGGGTGTTATCGGTATTGGCCGTATTAAGCGCGGTAAAGTAAAACCTAATCAACAAGTGACTATCATCGATAGCGAAGGTAATACCCGCAACGGTAAAGTAGGTAAAGTATTAGGTCATTTAGGCTTAGAGCGTATCGATGTTGACGTTGCAGAAGCTGGCGACATCATTGCGATTACAGGTTTAGGTGAATTAAATATTTCTGATACGATTTGCGAAGTAGGTGCTGTGGAAGCATTACCTGCATTAGCCGTTGATGAGCCTACTGTTAGCATGTATTTCTGTGTTAATACATCACCATTCTGTGGTCGTGAAGGTAAGTTTGTTACTTCTCGTCAGATTTTAGATCGTCTGAAAAAAGAGTTAGTTCATAACGTAGCACTGCGTGTTGAAGAGACTGAAGATCCAGATGCATTCCGTGTATCAGGTCGTGGTGAATTACACCTATCAGTACTGATTGAAAATATGCGCCGTGAAGGTTACGAATTAGCCGTATCTCGTCCGAAAGTTATCTTCCGCGAGATTGATGGTCGTAAACAAGAGCCTTTCGAACAAGTCACTATCGATATTGAAGAGCAGCACCAAGGTGATGTGATGCAAGCGATGGGTGAGCGTAAAGGTGAAATGCGCGACATGCAACCAGATGGTAAAGGACGTGTACGTTTAGACTACATTATCCCTAGCCGTGGTTTAATTGGCTTCCGTACTGAGTTTATGACGATGACATCAGGTACTGGTTTACTGTACGCAACATTCAGTCATTATGACGATGTGCGCCCAGGTGAAATCGGTCGTCGTAATAATGGTGTGATGATCTCTAATGGTCAGGGTAAAGCCGTTGCTTACGCGCTATATAGCTTACAAGATCGTGGTAAGTTATTTGTTACTCATGGTGCAGAAGTTTATGAAGGCCAAGTTATTGGTATTCATACTCGCTCTAATGACTTAACAGTAAACTGCTTAACAGGTAAAAAACTGACAAATATGCGTGCTTCTGGTACGGATGAAGCGACAACGCTGACGCCACATATCAAGCAAACATTAGAACAAGCATTAGAGTTTATTGATGATGATGAATTAGTGGAAGTGACTCCACAATCTATTCGTTTACGTAAACGTCATCTCTCAGAAAACGATCGTCGTCGTGCTTATCGTAGCAAAGACTAATTTGTTATTCTGATAATATAATTCTTAGGGCGCGTTAAGCGCCCTGAGTT