Homologs in group_1773

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12095 FBDBKF_12095 100.0 Morganella morganii S1 typA ribosome-dependent GTPase TypA
NLDBIP_15305 NLDBIP_15305 100.0 Morganella morganii S4 typA ribosome-dependent GTPase TypA
LHKJJB_15305 LHKJJB_15305 100.0 Morganella morganii S3 typA ribosome-dependent GTPase TypA
HKOGLL_14425 HKOGLL_14425 100.0 Morganella morganii S5 typA ribosome-dependent GTPase TypA
F4V73_RS14550 F4V73_RS14550 94.4 Morganella psychrotolerans typA translational GTPase TypA
PMI_RS14240 PMI_RS14240 90.3 Proteus mirabilis HI4320 typA ribosome-dependent GTPase TypA

Distribution of the homologs in the orthogroup group_1773

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1773

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A3B4 0.0 1084 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Shigella flexneri
P0DTT0 0.0 1084 85 0 602 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli (strain K12)
P0A3B1 0.0 1084 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A3B3 0.0 1084 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O157:H7
P0A3B2 0.0 1084 85 0 602 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
H9L427 0.0 1075 85 0 603 1 bipA Large ribosomal subunit assembly factor BipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44910 0.0 1018 80 1 605 1 bipA Large ribosomal subunit assembly factor BipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9C8 0.0 902 69 0 602 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57508 0.0 901 70 0 600 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AC9 0.0 846 67 1 597 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O07631 0.0 672 54 0 594 2 bipA Large ribosomal subunit assembly factor BipA Bacillus subtilis (strain 168)
Q9ZLZ3 0.0 649 52 2 601 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain J99 / ATCC 700824)
O25225 0.0 648 52 2 601 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain ATCC 700392 / 26695)
P72749 0.0 613 52 1 585 3 bipA Large ribosomal subunit assembly factor BipA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
F4K410 0.0 562 47 3 590 1 SVR3 Putative elongation factor TypA-like SVR3, chloroplastic Arabidopsis thaliana
A0L631 5.93e-53 194 30 17 510 3 lepA Elongation factor 4 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A6TSM4 2.42e-50 187 31 20 502 3 lepA Elongation factor 4 Alkaliphilus metalliredigens (strain QYMF)
Q3MG20 1.01e-49 185 30 17 516 3 lepA Elongation factor 4 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YU48 1.54e-49 184 30 17 516 3 lepA Elongation factor 4 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8MFA6 4.58e-49 183 31 20 503 3 lepA Elongation factor 4 Alkaliphilus oremlandii (strain OhILAs)
Q182F4 4.88e-49 183 30 17 498 3 lepA Elongation factor 4 Clostridioides difficile (strain 630)
B1XK44 7.45e-49 182 30 17 506 3 lepA Elongation factor 4 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B1WWD8 1.36e-48 182 31 20 521 3 lepA Elongation factor 4 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q9X1V8 1.44e-48 182 33 18 504 3 lepA Elongation factor 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B7KJX0 3.61e-48 181 30 20 538 3 lepA Elongation factor 4 Gloeothece citriformis (strain PCC 7424)
B0C9R9 9.67e-48 179 30 18 521 3 lepA Elongation factor 4 Acaryochloris marina (strain MBIC 11017)
A4J7F8 1.72e-47 179 31 19 505 3 lepA Elongation factor 4 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
P74751 3.26e-47 178 30 18 533 3 lepA Elongation factor 4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A3DF29 3.71e-47 178 30 15 480 3 lepA Elongation factor 4 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B0JQT7 4.1e-47 178 30 18 519 3 lepA Elongation factor 4 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B9GHA6 5.15e-47 179 30 18 512 3 POPTRDRAFT_815670 Translation factor GUF1 homolog, chloroplastic Populus trichocarpa
Q73HR8 5.23e-47 177 30 17 507 3 lepA Elongation factor 4 Wolbachia pipientis wMel
A4XKA0 5.71e-47 177 28 16 504 3 lepA Elongation factor 4 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B7K3Z7 5.79e-47 177 30 21 526 3 lepA Elongation factor 4 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9KD76 6.11e-47 177 30 18 503 3 lepA Elongation factor 4 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3AF13 6.71e-47 177 29 16 504 3 lepA Elongation factor 4 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q4FUV9 1.05e-46 176 28 22 565 3 lepA Elongation factor 4 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B9MJZ5 1.11e-46 176 28 15 503 3 lepA Elongation factor 4 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
C0R5S3 1.54e-46 176 29 17 507 3 lepA Elongation factor 4 Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q2JWR1 1.71e-46 176 31 18 485 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-3-3Ab)
Q8RB72 1.71e-46 176 31 19 508 3 lepA Elongation factor 4 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B8I3E6 2.43e-46 176 31 21 504 3 lepA Elongation factor 4 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A6Q241 2.45e-46 176 29 17 506 3 lepA Elongation factor 4 Nitratiruptor sp. (strain SB155-2)
Q5SKA7 2.48e-46 176 30 17 490 1 lepA Elongation factor 4 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q2JQ51 2.54e-46 176 31 17 481 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q5KWZ3 2.68e-46 176 30 19 509 3 lepA Elongation factor 4 Geobacillus kaustophilus (strain HTA426)
Q97JJ6 3.54e-46 175 29 17 502 3 lepA Elongation factor 4 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q112D2 6.3e-46 174 29 16 519 3 lepA Elongation factor 4 Trichodesmium erythraeum (strain IMS101)
A9RFQ5 6.31e-46 176 28 20 607 3 PHYPADRAFT_158777 Translation factor GUF1 homolog, chloroplastic Physcomitrium patens
B2J0M4 6.48e-46 174 30 19 517 3 lepA Elongation factor 4 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8DM20 8.12e-46 174 30 18 506 3 lepA Elongation factor 4 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O27131 1.22e-45 175 26 12 502 3 fusA Elongation factor 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A2CBG9 1.72e-45 173 29 16 520 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9303)
Q8RFD1 1.84e-45 173 30 19 501 3 lepA Elongation factor 4 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q818E4 2e-45 173 30 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCU5 2.02e-45 173 30 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain B4264)
B3ESU2 2.13e-45 173 30 18 507 3 lepA Elongation factor 4 Amoebophilus asiaticus (strain 5a2)
Q5WHG5 2.16e-45 173 29 22 552 3 lepA Elongation factor 4 Shouchella clausii (strain KSM-K16)
O28385 2.22e-45 174 28 13 465 3 fusA Elongation factor 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q30Q17 2.27e-45 173 29 19 507 3 lepA Elongation factor 4 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P60792 2.3e-45 173 29 19 531 3 lepA Elongation factor 4 Onion yellows phytoplasma (strain OY-M)
Q1QDV6 2.47e-45 172 28 19 541 3 lepA Elongation factor 4 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B8HLK8 2.8e-45 172 29 19 519 3 lepA Elongation factor 4 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q72KV2 2.99e-45 172 30 17 490 3 lepA Elongation factor 4 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B0SRL4 3.26e-45 172 29 19 509 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S8S7 3.26e-45 172 29 19 509 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q1LTI1 3.4e-45 172 28 16 506 3 lepA Elongation factor 4 Baumannia cicadellinicola subsp. Homalodisca coagulata
O51115 3.55e-45 172 29 18 508 3 lepA Elongation factor 4 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A9VHU6 3.67e-45 172 30 21 547 3 lepA Elongation factor 4 Bacillus mycoides (strain KBAB4)
C5JRK2 4.13e-45 173 28 19 571 3 GUF1 Translation factor GUF1, mitochondrial Blastomyces gilchristii (strain SLH14081)
C5GRI9 4.13e-45 173 28 19 571 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
Q21IH3 4.17e-45 172 28 19 513 3 lepA Elongation factor 4 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C6HPI9 4.21e-45 173 28 20 570 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain H143)
Q7V8S4 4.33e-45 172 29 16 520 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9313)
Q5GRW9 4.37e-45 172 28 18 519 3 lepA Elongation factor 4 Wolbachia sp. subsp. Brugia malayi (strain TRS)
B0K3Y4 4.76e-45 172 29 19 510 3 lepA Elongation factor 4 Thermoanaerobacter sp. (strain X514)
B7IYH2 4.97e-45 172 29 20 547 3 lepA Elongation factor 4 Bacillus cereus (strain G9842)
Q7VJZ1 5.54e-45 172 29 20 526 3 lepA Elongation factor 4 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A4IR35 5.97e-45 172 29 23 557 3 lepA Elongation factor 4 Geobacillus thermodenitrificans (strain NG80-2)
Q81LR7 6.35e-45 172 31 22 549 3 lepA Elongation factor 4 Bacillus anthracis
C3P8M5 6.35e-45 172 31 22 549 3 lepA Elongation factor 4 Bacillus anthracis (strain A0248)
B3CPV1 6.86e-45 171 29 18 520 3 lepA Elongation factor 4 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A7Z6W5 7.17e-45 171 29 17 508 3 lepA Elongation factor 4 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9HM85 7.67e-45 173 28 14 514 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R8C8 7.67e-45 173 28 14 514 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q6HDK2 1.02e-44 171 30 20 546 3 lepA Elongation factor 4 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M2 1.02e-44 171 30 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain ZK / E33L)
C1ESL3 1.02e-44 171 30 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain 03BB102)
A0RIT7 1.02e-44 171 30 20 546 3 lepA Elongation factor 4 Bacillus thuringiensis (strain Al Hakam)
Q2NJE6 1.08e-44 171 28 19 541 3 lepA Elongation factor 4 Aster yellows witches'-broom phytoplasma (strain AYWB)
B0KA85 1.16e-44 171 29 20 511 3 lepA Elongation factor 4 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q2GGA6 1.19e-44 171 30 17 504 3 lepA Elongation factor 4 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C3L5S2 1.22e-44 171 30 21 547 3 lepA Elongation factor 4 Bacillus anthracis (strain CDC 684 / NRRL 3495)
O67618 1.32e-44 171 28 17 511 1 lepA Elongation factor 4 Aquifex aeolicus (strain VF5)
Q0SP76 1.71e-44 170 30 18 504 3 lepA Elongation factor 4 Borreliella afzelii (strain PKo)
A1CLD7 1.87e-44 171 29 17 544 3 guf1 Translation factor guf1, mitochondrial Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A6RGX9 2.01e-44 171 28 19 570 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain NAm1 / WU24)
A8FFD6 2.11e-44 170 29 18 505 3 lepA Elongation factor 4 Bacillus pumilus (strain SAFR-032)
C0NZL9 2.13e-44 171 28 20 570 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
Q0VP16 2.21e-44 170 29 19 526 3 lepA Elongation factor 4 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1D7L2 2.52e-44 170 29 18 503 3 lepA Elongation factor 4 Laribacter hongkongensis (strain HLHK9)
B9IY86 2.55e-44 170 29 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain Q1)
Q63S94 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain K96243)
A3NBT1 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 668)
Q3JQ75 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1710b)
A3NXL8 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1106a)
A1V6B9 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia mallei (strain SAVP1)
Q62LT1 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia mallei (strain ATCC 23344)
A2S9Z3 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10229)
A3MM44 2.57e-44 170 28 20 509 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10247)
B7HPL8 2.68e-44 170 30 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain AH187)
B7JNV1 2.68e-44 170 30 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain AH820)
O25122 2.72e-44 170 28 17 503 3 lepA Elongation factor 4 Helicobacter pylori (strain ATCC 700392 / 26695)
B8JAF3 3.08e-44 169 28 17 505 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2W0F9 3.13e-44 169 28 17 502 3 lepA Elongation factor 4 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A5B4D2 3.22e-44 171 29 16 515 3 VITISV_013255 Translation factor GUF1 homolog, chloroplastic Vitis vinifera
Q892Q6 3.34e-44 169 29 16 481 3 lepA Elongation factor 4 Clostridium tetani (strain Massachusetts / E88)
A7GT14 3.97e-44 169 30 21 547 3 lepA Elongation factor 4 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A5FY07 4.13e-44 169 27 21 591 3 lepA Elongation factor 4 Acidiphilium cryptum (strain JF-5)
Q1QX26 4.95e-44 169 28 18 515 3 lepA Elongation factor 4 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
C1GX39 5.25e-44 170 28 18 568 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
C4Z9E3 5.3e-44 169 28 22 555 3 lepA Elongation factor 4 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A7GHI0 5.34e-44 169 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM7 5.34e-44 169 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Okra / Type B1)
Q730L6 5.47e-44 169 30 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q2GJV7 6.66e-44 169 29 19 507 3 lepA Elongation factor 4 Anaplasma phagocytophilum (strain HZ)
Q2SXT6 6.77e-44 169 28 17 504 3 lepA Elongation factor 4 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B7GKC4 6.8e-44 169 29 22 548 3 lepA Elongation factor 4 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A1AWP9 7.14e-44 168 28 18 508 3 lepA Elongation factor 4 Ruthia magnifica subsp. Calyptogena magnifica
Q7U5L9 7.46e-44 169 30 19 520 3 lepA Elongation factor 4 Parasynechococcus marenigrum (strain WH8102)
Q13VM6 7.77e-44 168 29 18 507 3 lepA Elongation factor 4 Paraburkholderia xenovorans (strain LB400)
A8G3D2 7.81e-44 168 29 18 524 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9215)
Q39US7 7.89e-44 168 28 19 529 3 lepA Elongation factor 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B9RHQ5 8.83e-44 169 28 17 510 3 RCOM_1767360 Translation factor GUF1 homolog, chloroplastic Ricinus communis
A5D3X6 1.01e-43 168 30 19 508 3 lepA Elongation factor 4 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5I644 1.03e-43 168 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL9 1.03e-43 168 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain ATCC 19397 / Type A)
A2BPP8 1.04e-43 168 29 18 524 3 lepA Elongation factor 4 Prochlorococcus marinus (strain AS9601)
A7I1F0 1.08e-43 168 27 21 596 3 lepA Elongation factor 4 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q0AF67 1.12e-43 168 28 17 508 3 lepA Elongation factor 4 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1I5V6 1.27e-43 168 28 18 511 3 lepA Elongation factor 4 Pseudomonas entomophila (strain L48)
C1DQS0 1.27e-43 168 27 17 508 3 lepA Elongation factor 4 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q2IIA6 1.29e-43 168 29 18 505 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q7NGX4 1.31e-43 168 30 15 504 3 lepA Elongation factor 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A6SXR0 1.42e-43 167 29 18 503 3 lepA Elongation factor 4 Janthinobacterium sp. (strain Marseille)
B0TAD2 1.43e-43 168 31 17 499 3 lepA Elongation factor 4 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
C1FVU4 1.46e-43 167 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Kyoto / Type A2)
Q9K055 1.55e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P56865 1.65e-43 167 29 19 509 3 lepA Elongation factor 4 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q662S4 1.65e-43 167 30 19 507 3 lepA Elongation factor 4 Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
B2SZV7 1.75e-43 167 29 18 507 3 lepA Elongation factor 4 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A9M3J8 1.75e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C (strain 053442)
Q65H50 1.79e-43 167 29 18 504 3 lepA Elongation factor 4 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2LTN3 1.88e-43 167 30 15 499 3 lepA Elongation factor 4 Syntrophus aciditrophicus (strain SB)
A3PBD8 1.92e-43 167 29 17 508 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9301)
A7ZCJ3 1.98e-43 167 27 18 566 3 lepA Elongation factor 4 Campylobacter concisus (strain 13826)
A5ULM6 2e-43 169 27 13 462 3 fusA Elongation factor 2 Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
C6DZ67 2.04e-43 167 29 20 527 3 lepA Elongation factor 4 Geobacter sp. (strain M21)
Q7W5J4 2.32e-43 167 29 19 509 3 lepA Elongation factor 4 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD30 2.32e-43 167 29 19 509 3 lepA Elongation factor 4 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1V9C5 2.37e-43 167 27 19 530 3 lepA Elongation factor 4 Phytoplasma australiense
Q2RKX8 2.5e-43 167 29 16 510 3 lepA Elongation factor 4 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1CUF5 2.7e-43 167 28 17 503 3 lepA Elongation factor 4 Helicobacter pylori (strain HPAG1)
B4RK41 2.79e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P9 2.79e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KT27 2.82e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q01SV7 2.88e-43 167 30 15 509 3 lepA Elongation factor 4 Solibacter usitatus (strain Ellin6076)
P60789 3.2e-43 167 28 16 506 3 lepA Elongation factor 4 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B1KI55 3.26e-43 167 27 22 609 3 lepA Elongation factor 4 Shewanella woodyi (strain ATCC 51908 / MS32)
Q9JV65 3.27e-43 167 28 16 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2KWY3 3.27e-43 167 29 17 506 3 lepA Elongation factor 4 Bordetella avium (strain 197N)
Q9FNM5 3.31e-43 168 29 18 503 1 At5g08650 Translation factor GUF1 homolog, chloroplastic Arabidopsis thaliana
B1KZP1 3.38e-43 167 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain Loch Maree / Type A3)
Q2RNY6 3.54e-43 167 26 19 552 3 lepA Elongation factor 4 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B4UDQ7 3.71e-43 166 28 17 505 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain K)
A5GMR2 4.09e-43 166 29 18 518 3 lepA Elongation factor 4 Synechococcus sp. (strain WH7803)
B5FAH2 4.25e-43 166 27 21 567 3 lepA Elongation factor 4 Aliivibrio fischeri (strain MJ11)
A9BE39 4.27e-43 166 29 17 520 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9211)
Q2Y873 4.69e-43 166 28 19 506 3 lepA Elongation factor 4 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5NLP5 4.75e-43 166 29 21 525 3 lepA Elongation factor 4 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A1D5Z0 5.2e-43 167 27 19 593 3 guf1 Translation factor guf1, mitochondrial Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
C4LBZ6 5.71e-43 166 29 18 517 3 lepA Elongation factor 4 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q4L6T4 5.85e-43 166 27 24 592 3 lepA Elongation factor 4 Staphylococcus haemolyticus (strain JCSC1435)
Q3ALG5 5.95e-43 166 29 19 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9605)
A6TCI3 5.95e-43 166 28 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B8BYH3 6.06e-43 167 26 18 596 3 THAPSDRAFT_40001 Translation factor GUF1 homolog, mitochondrial Thalassiosira pseudonana
Q9I5G8 6.07e-43 166 27 17 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HR9 6.07e-43 166 27 17 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYX5 6.07e-43 166 27 17 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain LESB58)
A0KGF0 6.16e-43 166 28 25 625 3 lepA Elongation factor 4 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A5N6L8 6.3e-43 166 28 16 516 3 lepA Elongation factor 4 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B1XTL2 6.35e-43 166 28 17 506 3 lepA Elongation factor 4 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q17X87 6.4e-43 166 28 18 503 3 lepA Elongation factor 4 Helicobacter acinonychis (strain Sheeba)
A4VIX2 6.56e-43 166 28 18 508 3 lepA Elongation factor 4 Stutzerimonas stutzeri (strain A1501)
P37949 6.59e-43 166 29 18 504 3 lepA Elongation factor 4 Bacillus subtilis (strain 168)
Q3SH47 6.89e-43 166 28 20 564 3 lepA Elongation factor 4 Thiobacillus denitrificans (strain ATCC 25259)
Q88MY7 7.45e-43 166 28 18 510 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A7MH13 7.75e-43 166 28 15 505 3 lepA Elongation factor 4 Cronobacter sakazakii (strain ATCC BAA-894)
A6VAK9 7.82e-43 166 27 18 512 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain PA7)
C0SHD5 8.02e-43 166 27 17 568 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides brasiliensis (strain Pb03)
C8VPJ1 8.51e-43 166 28 21 585 3 guf1 Translation factor guf1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B5EB36 8.79e-43 166 29 20 527 3 lepA Elongation factor 4 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B6JKS8 9.17e-43 166 28 17 503 3 lepA Elongation factor 4 Helicobacter pylori (strain P12)
B2USI5 1.13e-42 165 28 17 505 3 lepA Elongation factor 4 Helicobacter pylori (strain Shi470)
A5W8F4 1.19e-42 165 28 18 510 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JRC5 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667U9 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKE6 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R400 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD74 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pestis
B2KA49 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C557 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT7 1.2e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q31R08 1.2e-42 165 30 20 520 3 lepA Elongation factor 4 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C5BRN3 1.27e-42 165 28 18 512 3 lepA Elongation factor 4 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q2GD00 1.29e-42 165 30 17 497 3 lepA Elongation factor 4 Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q11AY3 1.29e-42 165 29 20 521 3 lepA Elongation factor 4 Chelativorans sp. (strain BNC1)
A0RQX4 1.38e-42 165 28 17 504 3 lepA Elongation factor 4 Campylobacter fetus subsp. fetus (strain 82-40)
C3LR06 1.4e-42 165 28 18 506 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain M66-2)
Q9KPB0 1.4e-42 165 28 18 506 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5G3 1.4e-42 165 28 18 506 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5G4G3 1.55e-42 165 28 16 508 3 lepA Elongation factor 4 Geotalea uraniireducens (strain Rf4)
C3L3H1 1.6e-42 165 29 19 503 3 lepA Elongation factor 4 Clostridium botulinum (strain 657 / Type Ba4)
B0KV29 1.61e-42 165 28 18 510 3 lepA Elongation factor 4 Pseudomonas putida (strain GB-1)
B8ENL1 1.62e-42 165 29 19 504 3 lepA Elongation factor 4 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A4TKY0 1.69e-42 165 28 17 509 3 lepA Elongation factor 4 Yersinia pestis (strain Pestoides F)
B5ZBD4 1.74e-42 164 29 21 509 3 lepA Elongation factor 4 Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A2BV79 1.97e-42 164 27 17 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9515)
Q87XF8 1.99e-42 164 28 19 508 3 lepA Elongation factor 4 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XSC1 2.09e-42 164 28 18 510 3 lepA Elongation factor 4 Pseudomonas mendocina (strain ymp)
A4Y4K2 2.24e-42 164 27 23 610 3 lepA Elongation factor 4 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B3PLG4 2.26e-42 164 28 17 512 3 lepA Elongation factor 4 Cellvibrio japonicus (strain Ueda107)
A1U2V8 2.38e-42 164 28 16 481 3 lepA Elongation factor 4 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q46GZ6 2.54e-42 164 28 18 524 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL2A)
Q0BH06 2.84e-42 164 28 19 508 3 lepA Elongation factor 4 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YVM2 2.84e-42 164 28 19 508 3 lepA Elongation factor 4 Burkholderia ambifaria (strain MC40-6)
A2C0M8 2.85e-42 164 28 18 524 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL1A)
Q24SR6 3.35e-42 164 30 16 476 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain Y51)
B8FUP2 3.35e-42 164 30 16 476 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q3J8D2 3.52e-42 164 27 17 510 3 lepA Elongation factor 4 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A5WCD6 3.72e-42 164 28 21 513 3 lepA Elongation factor 4 Psychrobacter sp. (strain PRwf-1)
Q49Y26 3.89e-42 164 27 21 589 3 lepA Elongation factor 4 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A4WDE0 4.01e-42 164 28 15 505 3 lepA Elongation factor 4 Enterobacter sp. (strain 638)
Q3AWX3 4.04e-42 164 29 19 517 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9902)
A1RMC9 4.26e-42 163 27 24 610 3 lepA Elongation factor 4 Shewanella sp. (strain W3-18-1)
B9M4U5 4.46e-42 163 28 18 511 3 lepA Elongation factor 4 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B1J4D8 4.64e-42 163 28 18 511 3 lepA Elongation factor 4 Pseudomonas putida (strain W619)
Q0TNS2 4.79e-42 163 27 16 516 3 lepA Elongation factor 4 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0Q1R8 4.89e-42 163 29 17 512 3 lepA Elongation factor 4 Clostridium novyi (strain NT)
Q9ZM93 4.93e-42 163 28 18 503 3 lepA Elongation factor 4 Helicobacter pylori (strain J99 / ATCC 700824)
A4JCQ9 5.09e-42 163 28 19 505 3 lepA Elongation factor 4 Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9L5N4 5.12e-42 163 27 25 611 3 lepA Elongation factor 4 Shewanella baltica (strain OS195)
B8EBQ4 5.12e-42 163 27 25 611 3 lepA Elongation factor 4 Shewanella baltica (strain OS223)
Q0BRZ7 5.14e-42 163 26 23 592 3 lepA Elongation factor 4 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q5N390 5.22e-42 163 30 20 520 3 lepA Elongation factor 4 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q39I75 5.45e-42 163 28 18 510 3 lepA Elongation factor 4 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3YSC2 5.57e-42 163 29 17 510 3 lepA Elongation factor 4 Ehrlichia canis (strain Jake)
A6WKQ5 6.1e-42 163 27 25 611 3 lepA Elongation factor 4 Shewanella baltica (strain OS185)
A3D1V4 6.1e-42 163 27 25 611 3 lepA Elongation factor 4 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B5ZAB8 6.25e-42 163 28 17 503 3 lepA Elongation factor 4 Helicobacter pylori (strain G27)
Q1BXU3 6.81e-42 163 28 19 505 3 lepA Elongation factor 4 Burkholderia orbicola (strain AU 1054)
B1JYB1 6.81e-42 163 28 19 505 3 lepA Elongation factor 4 Burkholderia orbicola (strain MC0-3)
A0K5V7 6.81e-42 163 28 19 505 3 lepA Elongation factor 4 Burkholderia cenocepacia (strain HI2424)
Q0SRD8 7.27e-42 163 27 16 516 3 lepA Elongation factor 4 Clostridium perfringens (strain SM101 / Type A)
Q8XIS6 7.27e-42 163 27 16 516 3 lepA Elongation factor 4 Clostridium perfringens (strain 13 / Type A)
Q3YYU7 7.47e-42 163 28 15 505 3 lepA Elongation factor 4 Shigella sonnei (strain Ss046)
B3E9R0 8.17e-42 162 27 16 506 3 lepA Elongation factor 4 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q58448 8.4e-42 164 27 13 464 3 fusA Elongation factor 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A9ADE0 8.43e-42 162 28 18 508 3 lepA Elongation factor 4 Burkholderia multivorans (strain ATCC 17616 / 249)
Q31CB8 8.45e-42 162 29 18 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9312)
A4SRD4 9.85e-42 162 27 24 618 3 lepA Elongation factor 4 Aeromonas salmonicida (strain A449)
A9III9 9.94e-42 162 29 16 506 3 lepA Elongation factor 4 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B9E6X5 1.06e-41 162 29 24 553 3 lepA Elongation factor 4 Macrococcus caseolyticus (strain JCSC5402)
Q5E312 1.06e-41 162 27 21 569 3 lepA Elongation factor 4 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EKN1 1.14e-41 162 28 23 567 3 lepA Elongation factor 4 Aliivibrio salmonicida (strain LFI1238)
A1ARG8 1.23e-41 162 28 18 515 3 lepA Elongation factor 4 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A4G6S1 1.32e-41 162 28 15 507 3 lepA Elongation factor 4 Herminiimonas arsenicoxydans
A7I4X4 1.33e-41 164 29 15 474 3 fusA Elongation factor 2 Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q15R31 1.4e-41 162 26 17 523 3 lepA Elongation factor 4 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2SL35 1.4e-41 162 28 16 481 3 lepA Elongation factor 4 Hahella chejuensis (strain KCTC 2396)
A7HCF3 1.74e-41 162 27 15 504 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain Fw109-5)
A5FLU8 1.75e-41 162 28 17 511 3 lepA Elongation factor 4 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B6H2S6 1.86e-41 162 27 19 586 3 guf1 Translation factor guf1, mitochondrial Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B7VK81 1.9e-41 162 26 18 565 3 lepA Elongation factor 4 Vibrio atlanticus (strain LGP32)
C1GGI6 1.99e-41 162 27 17 568 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides brasiliensis (strain Pb18)
B8CQJ7 2.03e-41 161 28 18 510 3 lepA Elongation factor 4 Shewanella piezotolerans (strain WP3 / JCM 13877)
B5XNG8 2.19e-41 161 28 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae (strain 342)
Q7VDF7 2.29e-41 161 27 17 524 3 lepA Elongation factor 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A7GZW3 2.31e-41 161 28 19 566 3 lepA Elongation factor 4 Campylobacter curvus (strain 525.92)
Q6F9B9 2.42e-41 161 27 17 512 3 lepA Elongation factor 4 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1SSM6 2.43e-41 161 28 19 482 3 lepA Elongation factor 4 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q59P53 2.58e-41 162 28 21 586 3 GUF1 Translation factor GUF1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1QR19 2.61e-41 161 29 21 531 3 lepA Elongation factor 4 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q7MHN6 2.78e-41 161 27 16 521 3 lepA Elongation factor 4 Vibrio vulnificus (strain YJ016)
Q8DC78 2.78e-41 161 27 16 521 3 lepA Elongation factor 4 Vibrio vulnificus (strain CMCP6)
Q4WYV0 2.9e-41 162 27 20 593 3 guf1 Translation factor guf1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0V3J4 2.97e-41 162 27 14 516 3 GUF1 Translation factor GUF1, mitochondrial Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q1GIV5 3.35e-41 161 29 19 512 3 lepA Elongation factor 4 Ruegeria sp. (strain TM1040)
C3K6G8 3.39e-41 161 28 19 515 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain SBW25)
Q5JFZ3 3.59e-41 162 26 19 554 3 fusA Elongation factor 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q7VL73 3.9e-41 160 27 16 506 3 lepA Elongation factor 4 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8DTF3 3.92e-41 161 28 20 549 3 lepA Elongation factor 4 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C4L433 3.94e-41 161 29 21 554 3 lepA Elongation factor 4 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A5VB59 4.29e-41 160 28 21 530 3 lepA Elongation factor 4 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q92BN4 4.92e-41 160 30 18 505 3 lepA Elongation factor 4 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HBH4 5.33e-41 160 28 16 504 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Welgevonden)
Q5FHQ1 5.87e-41 160 28 16 504 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Gardel)
Q3J4P0 6.03e-41 160 29 18 516 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q7N1X3 6.04e-41 160 28 18 509 3 lepA Elongation factor 4 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A0M6M2 6.1e-41 160 29 18 508 3 lepA Elongation factor 4 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q9Z8I4 6.39e-41 160 28 20 516 3 lepA Elongation factor 4 Chlamydia pneumoniae
Q8Y742 6.39e-41 160 29 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE32 6.39e-41 160 29 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ1 6.39e-41 160 29 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain F2365)
C1KVC6 6.39e-41 160 29 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain CLIP80459)
Q7UX15 7.13e-41 160 28 19 553 3 lepA1 Elongation factor 4 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B9F2U5 7.61e-41 161 28 17 489 3 Os02g0157700 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. japonica
B2JFK0 8.14e-41 160 28 17 506 3 lepA Elongation factor 4 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q47WP3 8.77e-41 160 28 22 564 3 lepA Elongation factor 4 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3KMV7 8.96e-41 160 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q9PKX6 9.05e-41 160 27 20 515 3 lepA Elongation factor 4 Chlamydia muridarum (strain MoPn / Nigg)
Q1H2L5 9.05e-41 160 28 17 482 3 lepA1 Elongation factor 4 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C1F2I3 9.18e-41 160 30 15 479 3 lepA Elongation factor 4 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q9PQG7 1e-40 159 29 20 510 3 lepA Elongation factor 4 Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIW2 1e-40 159 29 20 510 3 lepA Elongation factor 4 Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A8EY28 1.03e-40 159 29 20 504 3 lepA Elongation factor 4 Rickettsia canadensis (strain McKiel)
B0BB51 1.07e-40 159 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9H2 1.07e-40 159 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q8CP13 1.09e-40 159 27 22 591 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW2 1.09e-40 159 27 22 591 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0XZZ2 1.09e-40 160 27 20 593 3 guf1 Translation factor guf1, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
B8AI54 1.13e-40 160 28 19 493 3 OsI_05919 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. indica
A8FSD4 1.14e-40 159 26 22 609 3 lepA Elongation factor 4 Shewanella sediminis (strain HAW-EB3)
Q7V2Q1 1.14e-40 159 27 18 522 3 lepA Elongation factor 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q831Z0 1.15e-40 159 30 18 509 3 lepA Elongation factor 4 Enterococcus faecalis (strain ATCC 700802 / V583)
P65274 1.17e-40 159 29 22 552 3 lepA Elongation factor 4 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65273 1.17e-40 159 29 22 552 3 lepA Elongation factor 4 Streptococcus agalactiae serotype III (strain NEM316)
Q3K1F9 1.17e-40 159 29 22 552 3 lepA Elongation factor 4 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q4KHT3 1.17e-40 159 28 20 515 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O84067 1.19e-40 159 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q0ICF2 1.25e-40 159 29 20 518 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9311)
Q07YZ4 1.25e-40 159 27 23 610 3 lepA Elongation factor 4 Shewanella frigidimarina (strain NCIMB 400)
A1S3X9 1.4e-40 159 28 18 505 3 lepA Elongation factor 4 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B9KNH9 1.48e-40 159 29 18 516 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3SVT1 1.75e-40 159 28 21 529 3 lepA Elongation factor 4 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A5GRE6 1.77e-40 159 28 17 519 3 lepA Elongation factor 4 Synechococcus sp. (strain RCC307)
B1ZC10 1.81e-40 159 27 21 600 3 lepA Elongation factor 4 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
C4YIT6 1.87e-40 159 27 20 574 3 GUF1 Translation factor GUF1, mitochondrial Candida albicans (strain WO-1)
Q9ZDQ1 2.03e-40 159 28 20 529 3 lepA Elongation factor 4 Rickettsia prowazekii (strain Madrid E)
Q1IXW5 2.03e-40 159 31 16 476 3 lepA Elongation factor 4 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A0AIS8 2.03e-40 159 29 18 505 3 lepA Elongation factor 4 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6D217 2.17e-40 159 27 18 561 3 lepA Elongation factor 4 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O93640 2.25e-40 160 28 13 473 3 fusA Elongation factor 2 Methanosarcina thermophila
A3PHQ9 2.37e-40 159 29 18 516 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q2NS11 2.46e-40 158 28 22 558 3 lepA Elongation factor 4 Sodalis glossinidius (strain morsitans)
B5XLC6 2.47e-40 159 30 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M49 (strain NZ131)
Q3KHM1 2.62e-40 158 28 18 511 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain Pf0-1)
Q0AWL9 2.84e-40 158 28 16 506 3 lepA Elongation factor 4 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q89BJ8 2.88e-40 158 27 19 526 3 lepA Elongation factor 4 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q88VN0 2.97e-40 158 29 16 495 3 lepA1 Elongation factor 4 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P60794 3.29e-40 158 27 15 506 3 lepA Elongation factor 4 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q12KH9 3.29e-40 158 27 23 611 3 lepA Elongation factor 4 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q28LR4 3.34e-40 158 29 21 514 3 lepA Elongation factor 4 Jannaschia sp. (strain CCS1)
B9WBR8 3.48e-40 159 27 19 581 3 GUF1 Translation factor GUF1, mitochondrial Candida dubliniensis (strain CD36 / ATCC MYA-646 / CBS 7987 / NCPF 3949 / NRRL Y-17841)
Q4ZPD8 3.64e-40 158 28 19 507 3 lepA Elongation factor 4 Pseudomonas syringae pv. syringae (strain B728a)
B0VTM2 3.64e-40 158 27 17 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain SDF)
Q48EV0 3.76e-40 158 28 19 507 3 lepA Elongation factor 4 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P60930 3.86e-40 158 27 16 508 3 lepA Elongation factor 4 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C3PMX3 3.95e-40 158 27 19 511 3 lepA Elongation factor 4 Rickettsia africae (strain ESF-5)
Q1IV51 4.31e-40 158 29 15 474 3 lepA Elongation factor 4 Koribacter versatilis (strain Ellin345)
B4U3G9 4.53e-40 158 30 25 556 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C7NYH7 4.62e-40 159 28 12 475 3 fusA Elongation factor 2 Halomicrobium mukohataei (strain ATCC 700874 / DSM 12286 / JCM 9738 / NCIMB 13541)
C0M8H9 4.62e-40 158 30 25 556 3 lepA Elongation factor 4 Streptococcus equi subsp. equi (strain 4047)
Q6G8Y3 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain MSSA476)
Q6GGB6 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain MRSA252)
P65272 4.78e-40 158 27 23 591 1 lepA Elongation factor 4 Staphylococcus aureus (strain N315)
P65271 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YT42 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITB2 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH9)
A6U257 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain JH1)
A7X2Y7 4.78e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NWA7 4.83e-40 158 27 23 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain MW2)
A3QBS5 4.85e-40 157 27 17 509 3 lepA Elongation factor 4 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q98DV1 5.22e-40 157 28 18 520 3 lepA Elongation factor 4 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C1N1Y2 5.37e-40 159 28 17 508 3 MICPUCDRAFT_51778 Translation factor GUF1 homolog, chloroplastic Micromonas pusilla (strain CCMP1545)
B1X3K4 5.39e-40 157 30 19 478 3 lepA Translation factor GUF1 homolog, organellar chromatophore Paulinella chromatophora
A8Z4C4 5.63e-40 157 27 24 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300 / TCH1516)
A6QHC7 5.63e-40 157 27 24 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain Newman)
Q5HFH6 5.63e-40 157 27 24 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain COL)
Q2FXY7 5.63e-40 157 27 24 591 1 lepA Elongation factor 4 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGD9 5.63e-40 157 27 24 591 3 lepA Elongation factor 4 Staphylococcus aureus (strain USA300)
Q820H8 6.37e-40 157 28 18 512 3 lepA Elongation factor 4 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B9DSE0 6.66e-40 157 31 21 508 3 lepA Elongation factor 4 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A6VLV6 6.67e-40 157 27 16 521 3 lepA Elongation factor 4 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q2U3T4 6.72e-40 158 28 15 515 3 guf1 Translation factor guf1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q576S5 6.85e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella abortus biovar 1 (strain 9-941)
Q2YJP8 6.85e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella abortus (strain 2308)
B2SC25 6.85e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella abortus (strain S19)
Q8FV17 6.92e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella suis biovar 1 (strain 1330)
A9WW49 6.92e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VVU4 6.92e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MCW5 6.92e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8YDB8 7.33e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMH8 7.33e-40 157 28 20 518 3 lepA Elongation factor 4 Brucella melitensis biotype 2 (strain ATCC 23457)
Q2SSF7 7.67e-40 157 27 21 532 3 lepA Elongation factor 4 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q5M4M2 7.76e-40 157 29 24 555 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
C4K3Z1 7.96e-40 157 28 16 507 3 lepA Elongation factor 4 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q03KW7 7.99e-40 157 29 24 555 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M008 7.99e-40 157 29 24 555 3 lepA Elongation factor 4 Streptococcus thermophilus (strain CNRZ 1066)
B0VCT7 8.18e-40 157 28 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AYE)
A3M7P5 8.18e-40 157 28 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWQ2 8.18e-40 157 28 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ACICU)
B7I580 8.18e-40 157 28 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB0057)
B7GYS7 8.18e-40 157 28 18 510 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB307-0294)
A1W018 8.83e-40 157 26 17 562 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PNR1 8.83e-40 157 26 17 562 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FM79 8.83e-40 157 26 17 562 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P9WK97 9.03e-40 157 29 19 487 1 lepA Elongation factor 4 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK96 9.03e-40 157 29 19 487 3 lepA Elongation factor 4 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U598 9.03e-40 157 29 19 487 3 lepA Elongation factor 4 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AQW9 9.03e-40 157 29 19 487 3 lepA Elongation factor 4 Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KL96 9.03e-40 157 29 19 487 3 lepA Elongation factor 4 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65270 9.03e-40 157 29 19 487 3 lepA Elongation factor 4 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q65VN2 9.37e-40 157 26 15 507 3 lepA Elongation factor 4 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B3RXR7 9.78e-40 157 29 22 526 3 TRIADDRAFT_56304 Translation factor GUF1 homolog, mitochondrial Trichoplax adhaerens
Q3IDL4 9.79e-40 157 27 18 506 3 lepA Elongation factor 4 Pseudoalteromonas translucida (strain TAC 125)
Q3A445 9.93e-40 157 28 15 505 3 lepA Elongation factor 4 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q464Z3 1.01e-39 158 26 17 551 3 fusA Elongation factor 2 Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8EH83 1.01e-39 157 26 23 612 3 lepA Elongation factor 4 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5HU70 1.02e-39 157 25 18 565 3 lepA Elongation factor 4 Campylobacter jejuni (strain RM1221)
Q5WVI1 1.05e-39 157 27 21 553 3 lepA Elongation factor 4 Legionella pneumophila (strain Lens)
A9KKU4 1.09e-39 157 29 17 503 3 lepA Elongation factor 4 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q5ZUD2 1.1e-39 157 27 21 553 3 lepA Elongation factor 4 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5ID24 1.1e-39 157 27 21 553 3 lepA Elongation factor 4 Legionella pneumophila (strain Corby)
Q5X443 1.1e-39 157 27 21 553 3 lepA Elongation factor 4 Legionella pneumophila (strain Paris)
A2RL76 1.1e-39 157 30 20 513 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain MG1363)
Q0HSI9 1.11e-39 156 26 22 610 3 lepA Elongation factor 4 Shewanella sp. (strain MR-7)
Q0HG96 1.11e-39 156 26 22 610 3 lepA Elongation factor 4 Shewanella sp. (strain MR-4)
A0Q453 1.14e-39 156 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. novicida (strain U112)
Q9CGI8 1.18e-39 157 30 20 513 3 lepA Elongation factor 4 Lactococcus lactis subsp. lactis (strain IL1403)
B2SEJ6 1.19e-39 156 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. mediasiatica (strain FSC147)
A4WX88 1.22e-39 156 29 20 519 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B2GBR9 1.25e-39 157 28 18 499 3 lepA Elongation factor 4 Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q0CS42 1.33e-39 157 27 15 515 3 guf1 Translation factor guf1, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q02Z80 1.47e-39 156 30 20 513 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain SK11)
Q0A8Z4 1.48e-39 157 28 19 509 3 lepA Elongation factor 4 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A9A9U4 1.51e-39 157 26 14 467 3 fusA Elongation factor 2 Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q6MTR6 1.55e-39 156 27 22 534 3 lepA Elongation factor 4 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q608M4 1.59e-39 156 30 14 402 3 lepA Elongation factor 4 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P0DC23 1.61e-39 156 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC22 1.61e-39 156 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A1BHJ8 1.63e-39 156 28 17 520 3 lepA Elongation factor 4 Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q7M8H5 1.68e-39 156 28 19 513 3 lepA Elongation factor 4 Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
C6DC02 1.7e-39 156 28 16 506 3 lepA Elongation factor 4 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q68X95 1.7e-39 156 28 19 513 3 lepA Elongation factor 4 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A6H1S4 1.85e-39 156 28 20 516 3 lepA Elongation factor 4 Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B8DIZ5 1.88e-39 156 28 14 476 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B3QZT9 1.92e-39 156 27 16 507 3 lepA Elongation factor 4 Phytoplasma mali (strain AT)
B4F049 2.04e-39 156 28 20 504 3 lepA Elongation factor 4 Proteus mirabilis (strain HI4320)
A9KF98 2.11e-39 156 27 17 512 3 lepA Elongation factor 4 Coxiella burnetii (strain Dugway 5J108-111)
Q92IQ1 2.13e-39 155 27 20 511 3 lepA Elongation factor 4 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1GRH5 2.34e-39 155 27 21 556 3 lepA Elongation factor 4 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5CE57 2.34e-39 155 26 19 516 3 lepA Elongation factor 4 Orientia tsutsugamushi (strain Boryong)
Q9A9F4 2.38e-39 155 28 17 514 3 lepA Elongation factor 4 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5NEF8 2.6e-39 155 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FW1 2.6e-39 155 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain FSC 198)
B8H2Z7 2.61e-39 155 28 17 514 3 lepA Elongation factor 4 Caulobacter vibrioides (strain NA1000 / CB15N)
A0KZN4 2.66e-39 155 26 22 610 3 lepA Elongation factor 4 Shewanella sp. (strain ANA-3)
C0MDV7 2.78e-39 155 29 22 551 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain H70)
B7KR78 2.81e-39 155 26 21 599 3 lepA Elongation factor 4 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q47EG0 2.82e-39 155 27 18 510 3 lepA Elongation factor 4 Dechloromonas aromatica (strain RCB)
O93632 2.82e-39 157 26 13 461 3 fusA Elongation factor 2 Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q8UIQ2 3e-39 155 27 18 516 3 lepA Elongation factor 4 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8K9Q9 3.06e-39 155 27 15 515 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A6VGV5 3.13e-39 157 26 13 467 3 fusA Elongation factor 2 Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
C5BAI0 3.14e-39 155 28 15 502 3 lepA Elongation factor 4 Edwardsiella ictaluri (strain 93-146)
A6WYK4 3.19e-39 155 29 20 521 3 lepA Elongation factor 4 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A8GRF6 3.37e-39 155 27 20 511 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Sheila Smith)
B0BWV5 3.37e-39 155 27 20 511 3 lepA Elongation factor 4 Rickettsia rickettsii (strain Iowa)
C5M6K8 3.62e-39 155 27 20 579 3 GUF1 Translation factor GUF1, mitochondrial Candida tropicalis (strain ATCC MYA-3404 / T1)
A8GW16 4.12e-39 155 28 19 506 3 lepA Elongation factor 4 Rickettsia bellii (strain OSU 85-389)
O93637 4.15e-39 156 27 13 461 3 fusA Elongation factor 2 Methanococcoides methylutens
B0UFE0 4.21e-39 155 27 23 594 3 lepA Elongation factor 4 Methylobacterium sp. (strain 4-46)
B0USR9 4.31e-39 155 27 14 476 3 lepA Elongation factor 4 Histophilus somni (strain 2336)
Q0I4Z1 4.31e-39 155 27 14 476 3 lepA Elongation factor 4 Histophilus somni (strain 129Pt)
Q99ZV8 4.58e-39 155 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M1
Q6KHP1 4.75e-39 155 27 13 502 3 lepA Elongation factor 4 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q6LXI2 4.78e-39 156 26 13 467 3 fusA Elongation factor 2 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q4UIN6 4.86e-39 156 26 20 608 3 TA16990 Translation factor GUF1 homolog, mitochondrial Theileria annulata
Q72E76 5.15e-39 155 29 14 473 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A5DG70 5.15e-39 155 27 20 578 3 GUF1 Translation factor GUF1, mitochondrial Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A5UFI9 5.18e-39 155 28 15 481 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittGG)
A5UBC2 5.18e-39 155 28 15 481 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittEE)
Q4QPM8 5.18e-39 155 28 15 481 3 lepA Elongation factor 4 Haemophilus influenzae (strain 86-028NP)
A4J080 5.2e-39 154 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. tularensis (strain WY96-3418)
A2QU25 5.22e-39 155 28 15 514 3 guf1 Translation factor guf1, mitochondrial Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q1J6V6 5.27e-39 155 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q48TU0 5.39e-39 155 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JLY8 5.39e-39 155 29 24 554 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q0BP65 5.41e-39 154 28 20 518 3 lepA Elongation factor 4 Francisella tularensis subsp. holarctica (strain OSU18)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14210
Feature type CDS
Gene typA
Product ribosome-dependent GTPase TypA
Location 60841 - 62661 (strand: 1)
Length 1821 (nucleotides) / 606 (amino acids)
In genomic island -

Contig

Accession ZDB_224
Length 134704 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1773
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF21018 TypA/BipA C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1217 Signal transduction mechanisms (T) T Predicted membrane GTPase TypA/BipA involved in stress response

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06207 GTP-binding protein - -

Protein Sequence

MSIEKLRNIAIIAHVDHGKTTLVDKLLQQSGTFDERSKPEERVMDSGDLERERGITILAKNTAITWNDYHINIVDTPGHADFGGEVERVMSMVDSVLLLVDAMDGPMPQTRFVTQKAFANGLKPIVVINKIDRPGARPDWVIDQVFDLFDNLGATDEQLDFPIIYASALNGIAGTDYNDMADDMTPLYEAIVKYVEPPQVDLDGPFQMQISQLDYNNYLGVIGIGRIKRGKVKPNQQVTVIDAEGKTRNGKIGKVLGHLGLDRIETEVAEAGDIIALTGLGELNISDTICDTNCVEALKPLAVDEPTVSMYFCVNTSPFCGKEGKYVTSRQILDRLKKELVHNVALRVEETEDPDAFRVSGRGELHLSVLIENMRREGFELAVSRPRVIFRDIDGRKQEPFEQVTLDIEEQHQGDVMMALGERKGELRDMMPDGKGRVRLDYSIPSRGLIGFRTEFMTMTSGTGLLYATFSHYDDVKQGEIGRRQNGVMISNGQGKAVAYALYSLQDRGKLFVGHGTEVYEGQLIGIHSRSNDLTVNCLTGKKLTNMRASGTDEATTLTPFIEKTLEQALEFIDDDELVEVTPKSIRLRKRHLTENDRKRAHRSKD

Flanking regions ( +/- flanking 50bp)

ATGCTATCTGTGACGTAATTCCCATCCATTAACGAAAACGGTACAAGTCTTTGTCTATCGAGAAATTAAGAAATATTGCCATCATCGCTCACGTTGACCATGGCAAGACCACGCTGGTCGATAAATTATTACAGCAGTCCGGTACGTTTGATGAGCGTTCAAAACCGGAAGAGCGTGTAATGGACTCCGGCGATCTGGAAAGAGAGCGCGGCATTACTATTCTTGCAAAAAATACCGCGATTACGTGGAACGACTATCACATCAACATCGTTGACACCCCGGGGCACGCCGATTTCGGTGGTGAAGTAGAACGTGTGATGTCCATGGTTGACAGCGTACTGCTGCTGGTAGATGCGATGGACGGTCCTATGCCGCAGACCCGCTTTGTAACGCAGAAAGCGTTTGCAAACGGTCTGAAACCAATCGTCGTTATCAACAAAATTGACCGTCCGGGCGCACGTCCTGACTGGGTTATCGACCAGGTGTTTGACCTGTTTGACAACCTCGGCGCAACTGACGAGCAGCTCGACTTCCCTATCATTTATGCATCTGCGCTGAATGGTATCGCGGGCACCGATTATAACGATATGGCGGATGACATGACCCCGCTGTACGAAGCTATCGTTAAGTATGTTGAGCCGCCTCAGGTTGACCTCGACGGCCCGTTCCAGATGCAGATCTCCCAGCTCGATTACAACAACTATTTAGGTGTTATCGGGATTGGCCGCATCAAGCGCGGTAAAGTCAAACCAAACCAGCAGGTTACTGTTATCGATGCGGAAGGTAAAACCCGTAACGGTAAAATCGGTAAGGTTCTCGGACATTTAGGTCTGGACCGTATCGAAACGGAAGTTGCTGAAGCCGGTGATATCATCGCGCTGACCGGTCTGGGTGAACTGAATATCTCAGATACTATCTGTGACACCAACTGTGTTGAAGCATTAAAACCACTGGCCGTTGATGAACCGACCGTCAGCATGTATTTCTGCGTTAACACCTCACCATTCTGCGGTAAAGAAGGGAAATATGTGACTTCCCGTCAGATCCTTGACCGTCTGAAGAAAGAGCTGGTTCACAACGTGGCACTGCGCGTTGAAGAAACTGAAGACCCGGATGCATTCCGTGTGTCAGGCCGTGGTGAGCTGCACTTATCTGTTCTGATCGAAAACATGCGCCGTGAAGGTTTTGAGCTGGCGGTATCCCGTCCGCGCGTTATCTTCCGCGATATTGACGGCCGTAAACAGGAGCCGTTCGAGCAGGTGACTCTGGATATTGAAGAACAGCACCAGGGTGACGTGATGATGGCACTGGGTGAGCGTAAAGGCGAACTGCGTGACATGATGCCGGATGGCAAAGGCCGCGTACGTCTGGATTACAGCATCCCGAGCCGTGGTCTGATTGGTTTCCGTACTGAATTCATGACCATGACTTCCGGTACCGGTTTACTGTATGCCACATTCAGTCACTATGATGATGTTAAACAGGGTGAAATCGGCCGCCGTCAGAACGGTGTGATGATTTCCAACGGTCAGGGTAAAGCAGTTGCATACGCACTGTACAGCCTGCAGGATCGCGGTAAGCTGTTTGTCGGTCACGGTACTGAAGTGTATGAAGGCCAGCTGATCGGTATTCACTCACGTTCAAACGACCTGACAGTTAACTGCCTGACCGGTAAGAAACTGACCAACATGCGTGCATCCGGTACTGATGAAGCGACCACACTGACGCCGTTTATCGAGAAAACCCTGGAACAGGCGTTAGAATTTATCGATGACGACGAATTAGTGGAAGTAACGCCGAAGTCTATCCGTCTGCGTAAACGCCACCTGACTGAAAACGACCGCAAACGCGCACACCGCAGCAAAGATTAATCTCTGCCGGTTGTTTTGATTCATGCCACTCAGGGCGCCTCCGGGCGCCC