Homologs in group_149

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02620 FBDBKF_02620 83.9 Morganella morganii S1 dadA Glycine/D-amino acid oxidase (deaminating)
EHELCC_03090 EHELCC_03090 83.9 Morganella morganii S2 dadA Glycine/D-amino acid oxidase (deaminating)
NLDBIP_00370 NLDBIP_00370 83.9 Morganella morganii S4 dadA Glycine/D-amino acid oxidase (deaminating)
LHKJJB_01665 LHKJJB_01665 83.9 Morganella morganii S3 dadA Glycine/D-amino acid oxidase (deaminating)
HKOGLL_01705 HKOGLL_01705 83.9 Morganella morganii S5 dadA Glycine/D-amino acid oxidase (deaminating)
F4V73_RS05080 F4V73_RS05080 83.5 Morganella psychrotolerans - FAD-binding oxidoreductase
PMI_RS10590 PMI_RS10590 57.6 Proteus mirabilis HI4320 - FAD-dependent oxidoreductase
PMI_RS13060 PMI_RS13060 27.6 Proteus mirabilis HI4320 - FAD-dependent oxidoreductase
PMI_RS15210 PMI_RS15210 24.8 Proteus mirabilis HI4320 - TIGR03364 family FAD-dependent oxidoreductase

Distribution of the homologs in the orthogroup group_149

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_149

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9UL12 8.82e-16 84 23 19 460 1 SARDH Sarcosine dehydrogenase, mitochondrial Homo sapiens
Q99LB7 4.69e-15 81 23 17 460 1 Sardh Sarcosine dehydrogenase, mitochondrial Mus musculus
Q64380 5.64e-15 81 23 17 460 1 Sardh Sarcosine dehydrogenase, mitochondrial Rattus norvegicus
Q52671 3.67e-14 77 22 17 463 3 soxB Sarcosine oxidase subunit beta Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9AGP3 1.75e-12 72 23 11 417 1 soxB Sarcosine oxidase subunit beta Arthrobacter sp.
Q8GAI3 4.16e-12 72 23 7 280 1 abo 4-methylaminobutanoate oxidase (formaldehyde-forming) Paenarthrobacter nicotinovorans
P40875 2.51e-11 68 23 11 417 1 soxB Sarcosine oxidase subunit beta Corynebacterium sp. (strain P-1)
P33642 1.05e-10 66 23 19 421 3 thiO Glycine oxidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q50LF2 3.68e-10 65 24 7 282 1 soxB Sarcosine oxidase subunit beta Corynebacterium sp. (strain U-96)
Q63342 9.94e-10 64 20 10 428 1 Dmgdh Dimethylglycine dehydrogenase, mitochondrial Rattus norvegicus
Q88Q83 1.8e-09 62 21 12 409 1 thiO Glycine oxidase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9DBT9 4.2e-09 62 19 11 444 1 Dmgdh Dimethylglycine dehydrogenase, mitochondrial Mus musculus
Q9P0Z9 7.2e-09 61 20 13 424 1 PIPOX Peroxisomal sarcosine oxidase Homo sapiens
Q9D826 1.07e-08 60 22 18 431 1 Pipox Peroxisomal sarcosine oxidase Mus musculus
O87388 3.26e-08 59 23 9 422 3 soxB Sarcosine oxidase subunit beta Rhizobium meliloti (strain 1021)
P40873 4.06e-08 58 21 7 265 1 soxA Monomeric sarcosine oxidase Arthrobacter sp. (strain TE1826)
Q89T28 1.85e-07 57 26 5 197 3 dadA D-amino acid dehydrogenase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9AGP8 1.87e-07 57 22 16 444 1 dmg Dimethylglycine oxidase Arthrobacter globiformis
Q9UI17 2.92e-07 57 19 13 430 1 DMGDH Dimethylglycine dehydrogenase, mitochondrial Homo sapiens
P40859 4.62e-07 55 22 7 259 1 soxA Monomeric sarcosine oxidase Bacillus sp. (strain B-0618)
Q18006 5.67e-07 55 21 18 445 3 C15B12.1 Putative sarcosine oxidase Caenorhabditis elegans
C0PBF8 4.43e-06 52 28 2 112 1 DAO D-amino-acid oxidase Zea mays
B1JHH1 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669J9 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLT6 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pestis (strain Pestoides F)
Q1CI06 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R633 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pestis bv. Antiqua (strain Angola)
P58526 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pestis
B2K770 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6L1 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FH13 4.61e-06 52 21 8 256 3 solA N-methyl-L-tryptophan oxidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C3LT39 1.81e-05 50 20 4 279 3 dadA D-amino acid dehydrogenase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTV1 1.81e-05 50 20 4 279 3 dadA D-amino acid dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3D0 2.25e-05 50 20 5 282 3 dadA D-amino acid dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q2IZZ7 3.03e-05 50 21 8 301 3 dadA D-amino acid dehydrogenase Rhodopseudomonas palustris (strain HaA2)
Q29RU9 3.44e-05 49 19 12 421 2 PIPOX Peroxisomal sarcosine oxidase Bos taurus
Q7TSQ8 3.53e-05 50 26 6 224 1 Pdpr Pyruvate dehydrogenase phosphatase regulatory subunit, mitochondrial Mus musculus
Q7W641 6.7e-05 48 24 14 375 3 dadA D-amino acid dehydrogenase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P37906 0.000135 47 23 8 222 1 puuB Gamma-glutamylputrescine oxidoreductase Escherichia coli (strain K12)
B9JI94 0.000326 46 25 5 175 3 dadA D-amino acid dehydrogenase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q6FFR5 0.000361 46 22 12 376 3 dadA D-amino acid dehydrogenase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4FR09 0.000547 46 32 2 82 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q999 0.000566 46 32 2 82 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P75063 0.000781 45 25 4 180 1 glpD Glycerol 3-phosphate oxidase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P44732 0.000814 45 24 9 220 4 ordL Probable oxidoreductase OrdL Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14000
Feature type CDS
Gene -
Product FAD-dependent oxidoreductase
Location 3107558 - 3108979 (strand: -1)
Length 1422 (nucleotides) / 473 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_149
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF01266 FAD dependent oxidoreductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0665 Amino acid transport and metabolism (E) E Glycine/D-amino acid oxidase (deaminating)

Protein Sequence

MNISRRKLLLGVGAAGVLAGGAALVPMVRRDGKFVEAKSRASFVEGTQGALPKEADVVIIGAGIQGIMTAINLAERGMSVTILEKGQIAGEQSGRAYSQIISYQTSPEIFPLHHYGKILWRGMNEKIGADTSYRTQGRVEALADEKALDKAQAWIKTAKEAAGFDTPLNTRIIKGEELSNRLVGAQTPWTVAAFEEDSGSVDPETGTPALARYAKQIGVKIYTNCAVRGIETAGGKISDVVSEKGAIKTSQVVLAGGIWSRLFMGNMGIDIPTLNVYLSQQRVSGVPGAPRGNVHLPNGIHFREQADGTYAVAPRIFTSSIVKDSFLLGPKFMHLLGGGELPLEFSIGEDLFNSFKMPTSWNLDEKTPFEQFRVATATQNTQHLDAVFQRMKTEFPVFEKSEVVERWGAVVSPTFDELPIISEVKEYPGLVINTATVWGMTEGPAAGEVTADIVMGKKPVIDPTPFSLDRFKK

Flanking regions ( +/- flanking 50bp)

AAAATAATCTAATAACAATATAAATAGTAAGACTATTACTGAGGTAAAAGATGAACATTTCAAGGAGAAAGCTACTTTTAGGTGTTGGTGCTGCGGGCGTTTTAGCAGGTGGTGCGGCTTTAGTTCCAATGGTTCGCCGTGACGGCAAATTTGTGGAAGCTAAATCAAGAGCATCATTTGTTGAAGGTACGCAAGGGGCTCTTCCTAAAGAAGCAGATGTAGTGATTATTGGTGCCGGTATTCAAGGGATCATGACCGCTATTAACCTTGCTGAACGTGGTATGAGTGTCACTATCTTAGAAAAGGGTCAGATTGCCGGTGAGCAATCAGGCCGTGCATACAGCCAAATTATTAGTTACCAAACATCGCCAGAAATCTTCCCATTACACCATTATGGGAAAATATTATGGCGTGGCATGAATGAGAAAATTGGTGCGGATACCAGTTATCGTACTCAAGGTCGTGTAGAAGCGCTGGCAGATGAAAAAGCATTAGATAAAGCTCAAGCGTGGATCAAAACAGCTAAAGAAGCGGCAGGTTTTGATACACCATTAAATACTCGCATCATTAAAGGTGAAGAGCTATCAAATCGCTTAGTCGGTGCTCAAACGCCATGGACTGTTGCTGCATTTGAAGAAGATTCAGGCTCTGTTGATCCTGAAACAGGCACACCTGCACTCGCTCGTTATGCCAAACAAATCGGTGTGAAAATTTATACCAACTGTGCAGTAAGAGGTATTGAAACTGCGGGTGGTAAAATCTCTGATGTGGTGAGTGAGAAAGGGGCGATTAAAACGTCTCAAGTTGTACTCGCTGGGGGTATCTGGTCGCGTTTATTTATGGGCAATATGGGTATTGATATCCCAACGCTCAATGTATATCTATCACAACAACGTGTCTCAGGGGTTCCTGGTGCACCACGTGGTAATGTGCATTTACCTAATGGTATTCATTTCCGCGAACAAGCGGATGGTACTTATGCCGTTGCACCACGTATCTTTACGAGTTCAATAGTCAAAGATAGCTTCCTGCTAGGGCCTAAATTTATGCACTTATTAGGTGGCGGAGAGTTACCGTTGGAATTCTCTATTGGTGAAGATCTATTTAATTCATTTAAAATGCCGACCTCTTGGAATTTAGATGAAAAAACACCATTCGAACAATTCCGAGTTGCCACGGCAACACAAAATACGCAACACTTAGATGCTGTTTTCCAAAGAATGAAAACAGAATTCCCAGTATTTGAAAAATCAGAAGTTGTTGAACGTTGGGGTGCCGTTGTGAGTCCAACATTTGATGAATTACCTATCATTTCTGAGGTCAAAGAATACCCAGGCTTAGTGATTAACACGGCAACAGTGTGGGGTATGACAGAAGGCCCGGCAGCGGGTGAAGTGACCGCTGATATTGTCATGGGCAAGAAACCTGTTATTGATCCAACGCCGTTTAGTTTGGATCGTTTTAAGAAGTAAACCCTTGTTTTACTGTAATTAAACACATTAAGGAGTTTTCATGCGCTATA