Homologs in group_1699

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11850 FBDBKF_11850 74.6 Morganella morganii S1 astC Acetylornithine/succinyldiaminopimelate/putrescin e aminotransferase
EHELCC_14455 EHELCC_14455 74.6 Morganella morganii S2 astC Acetylornithine/succinyldiaminopimelate/putrescin e aminotransferase
NLDBIP_15550 NLDBIP_15550 74.6 Morganella morganii S4 astC Acetylornithine/succinyldiaminopimelate/putrescin e aminotransferase
LHKJJB_15060 LHKJJB_15060 74.6 Morganella morganii S3 astC Acetylornithine/succinyldiaminopimelate/putrescin e aminotransferase
HKOGLL_14180 HKOGLL_14180 74.6 Morganella morganii S5 astC Acetylornithine/succinyldiaminopimelate/putrescin e aminotransferase
F4V73_RS14800 F4V73_RS14800 74.1 Morganella psychrotolerans - aspartate aminotransferase family protein

Distribution of the homologs in the orthogroup group_1699

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1699

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N9E5 0.0 632 74 0 397 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P59324 0.0 614 72 0 398 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Yersinia pestis
Q8Z1Z3 0.0 590 68 0 397 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Salmonella typhi
P18335 0.0 588 68 0 399 1 argD Acetylornithine/succinyldiaminopimelate aminotransferase Escherichia coli (strain K12)
P59317 0.0 588 68 0 399 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X4S6 0.0 587 68 0 399 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Escherichia coli O157:H7
P40732 0.0 586 68 0 397 1 argD Acetylornithine/succinyldiaminopimelate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P59321 0.0 580 68 0 399 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Shigella flexneri
Q9KNW2 0.0 517 59 0 397 3 argD Acetylornithine aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O30508 0.0 517 60 0 399 1 aruC Succinylornithine transaminase/acetylornithine aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7N584 0.0 515 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LQ44 0.0 515 60 0 402 3 astC Succinylornithine transaminase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3Z295 0.0 514 59 0 402 3 astC Succinylornithine transaminase Shigella sonnei (strain Ss046)
B1LDY3 0.0 514 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain SMS-3-5 / SECEC)
B7NT29 0.0 513 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6IBG8 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain SE11)
P77581 0.0 511 59 0 402 1 astC Succinylornithine transaminase Escherichia coli (strain K12)
B1IPI2 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XGK9 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain K12 / DH10B)
C4ZZA4 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1G0 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O8 (strain IAI1)
A7ZML6 0.0 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q321P0 1.12e-180 511 59 0 402 3 astC Succinylornithine transaminase Shigella boydii serotype 4 (strain Sb227)
B2U3D0 1.12e-180 511 59 0 402 3 astC Succinylornithine transaminase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7USC9 1.6e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A8A0U0 1.62e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O9:H4 (strain HS)
P59323 1.98e-180 510 57 0 401 3 argD Acetylornithine aminotransferase Vibrio vulnificus (strain CMCP6)
Q1RB45 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain UTI89 / UPEC)
Q8FGZ9 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TH82 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABS9 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O1:K1 / APEC
B7MVM7 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O81 (strain ED1a)
B7MAV9 2.11e-180 511 59 0 402 3 astC Succinylornithine transaminase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q7MH19 2.52e-180 510 57 0 401 3 argD Acetylornithine aminotransferase Vibrio vulnificus (strain YJ016)
B5YQ35 4.17e-179 507 58 0 402 3 astC Succinylornithine transaminase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X598 4.17e-179 507 58 0 402 3 astC Succinylornithine transaminase Escherichia coli O157:H7
Q885K0 4.39e-179 507 60 0 393 3 argD1 Acetylornithine aminotransferase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P59320 8.84e-179 506 59 0 397 3 argD Acetylornithine aminotransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B7L6M2 3.75e-178 505 58 0 402 3 astC Succinylornithine transaminase Escherichia coli (strain 55989 / EAEC)
A1JS45 1.89e-177 503 58 1 404 3 astC Succinylornithine transaminase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P59319 2.04e-177 503 59 0 398 3 argD Acetylornithine aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P57600 2.17e-177 503 56 1 404 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P59086 2.65e-176 500 57 0 395 3 argD Acetylornithine/succinyldiaminopimelate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A8AHE0 4.26e-176 499 60 0 387 3 astC Succinylornithine transaminase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7FIL6 9.59e-175 496 58 1 404 3 astC Succinylornithine transaminase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q87L20 9.64e-175 496 57 0 398 3 argD Acetylornithine aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q66B21 1.52e-174 496 58 1 404 3 astC Succinylornithine transaminase Yersinia pseudotuberculosis serotype I (strain IP32953)
A9QZ63 2.13e-174 496 58 1 404 3 astC Succinylornithine transaminase Yersinia pestis bv. Antiqua (strain Angola)
Q8D0D7 2.13e-174 496 58 1 404 3 astC Succinylornithine transaminase Yersinia pestis
Q1C8B1 2.13e-174 496 58 1 404 3 astC Succinylornithine transaminase Yersinia pestis bv. Antiqua (strain Antiqua)
Q9CNT1 1.6e-173 493 60 0 392 3 argD Acetylornithine aminotransferase Pasteurella multocida (strain Pm70)
B5RB01 2.96e-172 490 60 0 396 3 astC Succinylornithine transaminase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWJ0 2.96e-172 490 60 0 396 3 astC Succinylornithine transaminase Salmonella enteritidis PT4 (strain P125109)
C0Q6X9 3.27e-172 490 60 0 396 3 astC Succinylornithine transaminase Salmonella paratyphi C (strain RKS4594)
B4TGE0 3.27e-172 490 60 0 396 3 astC Succinylornithine transaminase Salmonella heidelberg (strain SL476)
Q8ZPV2 4.9e-172 489 59 0 396 2 astC Succinylornithine transaminase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N278 5.29e-172 489 60 0 396 3 astC Succinylornithine transaminase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FJD8 5.41e-172 489 60 0 396 3 astC Succinylornithine transaminase Salmonella dublin (strain CT_02021853)
Q8Z6F9 6.8e-172 489 60 0 396 3 astC Succinylornithine transaminase Salmonella typhi
B5F846 1.08e-171 488 59 0 396 3 astC Succinylornithine transaminase Salmonella agona (strain SL483)
B5BA72 1.32e-171 488 59 0 396 3 astC Succinylornithine transaminase Salmonella paratyphi A (strain AKU_12601)
Q5PHC8 1.32e-171 488 59 0 396 3 astC Succinylornithine transaminase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57PX9 1.7e-171 488 59 0 396 3 astC Succinylornithine transaminase Salmonella choleraesuis (strain SC-B67)
B4T3Z4 3.67e-170 484 59 0 396 3 astC Succinylornithine transaminase Salmonella newport (strain SL254)
Q7N2G7 1.45e-165 473 55 0 399 3 astC Succinylornithine transaminase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9JYY4 1.75e-160 460 57 0 387 3 argD Acetylornithine aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JTX9 3.68e-158 454 56 0 390 3 argD Acetylornithine aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9PDF2 9.3e-129 379 48 4 392 3 argD Acetylornithine aminotransferase Xylella fastidiosa (strain 9a5c)
Q87DM8 1.51e-127 376 48 4 392 3 argD Acetylornithine aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PH31 4.03e-123 365 48 3 390 3 argD Acetylornithine aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
Q8R7C1 1.4e-119 355 44 3 392 3 argD Acetylornithine aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8P5Q4 2.03e-117 350 49 3 390 3 argD Acetylornithine aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q97GH9 2.19e-117 350 45 2 372 3 argD Acetylornithine aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8UI71 4.32e-114 342 48 3 371 3 argD Acetylornithine aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9AAL3 1.12e-109 330 45 3 390 3 argD1 Acetylornithine aminotransferase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9X2A5 6.12e-108 325 43 5 386 1 argD Acetylornithine aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q58131 2.56e-106 322 41 1 388 3 argD Acetylornithine aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q92SA0 4.04e-106 321 45 3 387 3 argD Acetylornithine aminotransferase Rhizobium meliloti (strain 1021)
Q98BB7 5.59e-106 321 45 3 368 3 argD Acetylornithine aminotransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P59318 1.01e-105 320 44 2 375 3 argD Acetylornithine aminotransferase Myxococcus xanthus
Q07907 1.1e-104 317 43 4 385 3 argD Acetylornithine aminotransferase Geobacillus stearothermophilus
Q6C846 5.12e-104 317 41 6 402 3 ARG8 Acetylornithine aminotransferase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
P63567 1.31e-103 315 44 3 375 3 argD Acetylornithine aminotransferase Brucella suis biovar 1 (strain 1330)
P63566 1.31e-103 315 44 3 375 3 argD Acetylornithine aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9K8V5 2.11e-103 314 42 3 386 3 argD Acetylornithine aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q89VE9 6.04e-103 313 44 3 384 3 argD1 Acetylornithine aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P30900 1.17e-102 312 41 3 384 3 argD Acetylornithine aminotransferase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P59322 1.89e-101 310 42 3 395 3 argD Acetylornithine aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7VSH3 3.83e-101 308 43 5 390 3 argD2 Acetylornithine aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WDN7 1.26e-100 307 44 5 390 3 argD2 Acetylornithine aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W2N9 1.53e-100 307 44 5 390 3 argD2 Acetylornithine aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P54752 1.77e-100 308 41 3 396 3 argD Acetylornithine aminotransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NN66 6.87e-100 305 42 3 385 3 argD Acetylornithine aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9A652 2.85e-99 304 42 4 385 3 argD2 Acetylornithine aminotransferase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P73133 3.28e-99 305 40 4 402 1 argD Acetylornithine aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q818W2 5.19e-99 303 42 2 372 3 argD Acetylornithine aminotransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81M98 6.51e-99 302 42 2 372 3 argD Acetylornithine aminotransferase Bacillus anthracis
O66442 1.17e-98 301 41 6 379 1 argD Acetylornithine aminotransferase Aquifex aeolicus (strain VF5)
P36839 1.54e-97 299 42 4 385 3 argD Acetylornithine aminotransferase Bacillus subtilis (strain 168)
Q75AW1 4.35e-96 296 40 10 428 3 ARG8 Acetylornithine aminotransferase, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q55DT8 9.97e-96 296 40 7 396 3 argD Probable acetylornithine aminotransferase, mitochondrial Dictyostelium discoideum
P18544 1.08e-95 295 41 9 398 1 ARG8 Acetylornithine aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9PIR7 2.24e-95 294 38 3 388 1 argD Acetylornithine aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5SHH5 2.46e-94 291 42 5 384 1 lysJ [LysW]-aminoadipate semialdehyde transaminase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q59928 4.06e-94 290 41 4 382 3 argD Acetylornithine aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O14433 5.27e-94 291 40 7 395 3 ARG8 Acetylornithine aminotransferase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q93R93 1.19e-93 289 42 5 384 1 lysJ [LysW]-aminoadipate semialdehyde transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8CUM9 1.07e-92 287 39 1 382 3 argD Acetylornithine aminotransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q882K8 2e-91 284 40 4 389 3 argD2 Acetylornithine aminotransferase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8FTN2 2.08e-91 284 42 11 393 3 argD Acetylornithine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O74548 3.25e-91 285 36 6 400 2 arg1 Probable acetylornithine aminotransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8Y6U4 1.41e-89 278 40 5 389 3 argD Acetylornithine aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7V0G0 2.02e-89 279 38 5 393 3 argD Acetylornithine aminotransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q9M8M7 2.69e-89 280 38 5 392 1 WIN1 Acetylornithine aminotransferase, chloroplastic/mitochondrial Arabidopsis thaliana
Q59282 2.78e-89 278 40 9 401 1 argD Acetylornithine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q92BC0 5.33e-89 277 40 5 388 3 argD Acetylornithine aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71Z79 8.01e-89 276 40 7 393 3 argD Acetylornithine aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q8TUZ5 5.93e-88 275 39 5 395 3 argD Acetylornithine aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q6FXA4 1.1e-87 275 41 12 402 3 ARG8 Acetylornithine aminotransferase, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9P3I3 4.53e-87 275 37 5 396 3 arg-8 Acetylornithine aminotransferase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7VAS9 5.16e-87 273 38 3 381 3 argD Acetylornithine aminotransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9CC12 8.03e-87 272 38 6 409 3 argD Acetylornithine aminotransferase Mycobacterium leprae (strain TN)
Q9CHD3 9.75e-87 271 41 8 382 3 argD Acetylornithine aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
O27392 1.23e-86 271 37 2 389 3 argD Acetylornithine aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P59316 1.45e-86 271 36 1 399 3 argD Acetylornithine aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P9WPZ7 3.12e-86 270 40 6 405 1 argD Acetylornithine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ6 3.12e-86 270 40 6 405 3 argD Acetylornithine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63569 3.12e-86 270 40 6 405 3 argD Acetylornithine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8XWN8 5.92e-86 270 40 4 390 3 argD Acetylornithine aminotransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O04866 1.4e-85 270 38 5 391 2 AG118 Acetylornithine aminotransferase, mitochondrial Alnus glutinosa
O30156 4.06e-85 267 38 3 380 3 argD Acetylornithine aminotransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7U5R5 1.3e-84 267 38 3 400 3 argD Acetylornithine aminotransferase Parasynechococcus marenigrum (strain WH8102)
Q8U0B4 1.49e-84 265 40 5 375 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q4JAP8 1.64e-84 266 38 4 386 1 lysJ [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A0QYS9 2.97e-84 265 39 7 399 1 argD Acetylornithine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6BUP9 3.37e-83 265 39 6 396 3 ARG8 Acetylornithine aminotransferase, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q7WKW5 3.55e-83 262 38 7 389 3 argD1 Acetylornithine aminotransferase 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W7H6 6.49e-83 261 38 7 389 3 argD1 Acetylornithine aminotransferase 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q82UP3 8.5e-83 261 38 5 387 3 argD Acetylornithine aminotransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5HP24 1.17e-82 260 39 7 371 3 argD Acetylornithine aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7VMS5 1.69e-82 261 38 5 384 3 argD Acetylornithine aminotransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8PX16 1.98e-82 260 38 7 405 3 argD Acetylornithine aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q4A0N2 3.59e-82 260 36 4 385 3 rocD1 Ornithine aminotransferase 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CSG1 3.82e-82 259 39 7 371 3 argD Acetylornithine aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q89LG2 4.59e-82 259 41 4 384 3 argD2 Acetylornithine aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7VTJ7 4.76e-82 259 38 7 389 3 argD1 Acetylornithine aminotransferase 1 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8TUE8 1.88e-81 258 37 7 398 3 argD Acetylornithine aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q49W96 2.45e-80 255 37 4 384 3 rocD2 Ornithine aminotransferase 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9RW75 2.23e-79 254 37 6 386 3 lysJ [LysW]-aminoadipate semialdehyde transaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q828A3 2.42e-79 253 39 7 383 3 argD Acetylornithine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q6GKC1 1.25e-78 251 37 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain MRSA252)
Q7V8L1 4.62e-78 250 37 3 382 3 argD Acetylornithine aminotransferase Prochlorococcus marinus (strain MIT 9313)
Q7MAE6 4.86e-78 249 38 8 377 3 argD Acetylornithine aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8NYM5 5.69e-78 249 37 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain MW2)
Q6GCU1 5.69e-78 249 37 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain MSSA476)
Q5HJI8 5.69e-78 249 37 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain COL)
Q9L1A4 6.16e-78 249 39 6 377 3 argD Acetylornithine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P60296 7.21e-78 249 36 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain N315)
P60295 7.21e-78 249 36 4 374 3 rocD1 Ornithine aminotransferase 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q976K0 4.85e-77 246 38 5 389 3 lysJ [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
P24087 7.25e-77 246 37 5 395 3 argD Acetylornithine aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH8 7.25e-77 246 37 5 395 3 argD Acetylornithine aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q5JFW3 7.39e-77 245 37 7 387 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q7SI94 2.13e-76 244 36 6 390 3 lysJ [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O59401 3.75e-76 243 38 6 379 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q6GID1 1.13e-75 243 36 4 380 3 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain MRSA252)
P60299 1.18e-75 243 36 4 380 3 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain MW2)
Q6GAW9 1.18e-75 243 36 4 380 3 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain MSSA476)
P60298 1.18e-75 243 36 4 380 1 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain N315)
P60297 1.18e-75 243 36 4 380 3 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHC8 1.18e-75 243 36 4 380 3 rocD2 Ornithine aminotransferase 2 Staphylococcus aureus (strain COL)
B9DIU0 2.99e-75 242 35 5 388 3 rocD Ornithine aminotransferase Staphylococcus carnosus (strain TM300)
P59315 2.05e-74 241 35 8 409 3 argD Acetylornithine aminotransferase Bifidobacterium longum (strain NCC 2705)
Q6CWC1 1.42e-73 239 35 11 407 1 CAR2 Ornithine aminotransferase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9LCS5 5.4e-73 236 37 9 406 3 argD Acetylornithine aminotransferase Streptomyces clavuligerus
Q9V1I4 1.07e-72 234 38 5 373 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q5HQK4 1.66e-72 235 35 4 380 3 rocD Ornithine aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CT82 1.91e-72 235 35 4 380 3 rocD Ornithine aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B9EAM9 2.7e-72 234 35 5 390 3 rocD Ornithine aminotransferase Macrococcus caseolyticus (strain JCSC5402)
C5D6R2 4e-72 234 36 5 386 3 rocD Ornithine aminotransferase Geobacillus sp. (strain WCH70)
C4L2E7 1.53e-71 233 35 4 382 3 rocD Ornithine aminotransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
C0ZBR4 1.6e-71 233 35 5 386 3 rocD Ornithine aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8EP32 1.64e-71 233 33 4 383 3 rocD Ornithine aminotransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C1EL61 4.54e-71 231 35 4 383 3 rocD Ornithine aminotransferase Bacillus cereus (strain 03BB102)
Q81TV3 1.05e-70 230 35 4 383 1 rocD Ornithine aminotransferase Bacillus anthracis
C3LBX0 1.05e-70 230 35 4 383 3 rocD Ornithine aminotransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P3K3 1.05e-70 230 35 4 383 3 rocD Ornithine aminotransferase Bacillus anthracis (strain A0248)
Q18040 1.18e-70 231 34 7 390 3 oatr-1 Probable ornithine aminotransferase, mitochondrial Caenorhabditis elegans
B9ITF9 2.71e-70 229 34 4 383 3 rocD Ornithine aminotransferase Bacillus cereus (strain Q1)
P07991 2.32e-69 228 35 11 402 1 CAR2 Ornithine aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P04181 3.51e-69 228 34 6 388 1 OAT Ornithine aminotransferase, mitochondrial Homo sapiens
Q81GP2 4.93e-69 226 34 4 383 3 rocD Ornithine aminotransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q07805 8.01e-69 226 33 6 388 2 OAT Ornithine aminotransferase Plasmodium falciparum (isolate CDC / Honduras)
Q6LFH8 8.01e-69 226 33 6 388 1 OAT Ornithine aminotransferase Plasmodium falciparum (isolate 3D7)
P04182 1.83e-68 226 34 6 388 1 Oat Ornithine aminotransferase, mitochondrial Rattus norvegicus
Q9K5Z2 1.86e-68 224 35 4 373 3 rocD Ornithine aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P38021 7.03e-68 223 34 5 386 1 rocD Ornithine aminotransferase Bacillus subtilis (strain 168)
P29758 1.4e-67 223 33 6 388 1 Oat Ornithine aminotransferase, mitochondrial Mus musculus
Q10G56 1.48e-67 224 33 5 390 2 OAT Ornithine aminotransferase, mitochondrial Oryza sativa subsp. japonica
Q7VSA0 1.64e-67 223 33 5 372 3 rocD Ornithine aminotransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1E4 1.64e-67 223 33 5 372 3 rocD Ornithine aminotransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WP51 1.64e-67 223 33 5 372 3 rocD Ornithine aminotransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7RT90 2.36e-67 222 32 4 387 1 OAT Ornithine aminotransferase Plasmodium yoelii yoelii
P49724 4.07e-67 222 34 7 385 1 Oat Ornithine aminotransferase, mitochondrial Drosophila ananassae
Q5JEW1 8.32e-67 221 34 11 409 1 TK2101 Ornithine aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O08321 1e-66 220 36 5 384 3 argD Acetylornithine aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q89RB7 5.05e-66 218 32 4 385 3 rocD Ornithine aminotransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3ZCF5 7.5e-66 219 34 6 388 2 OAT Ornithine aminotransferase, mitochondrial Bos taurus
Q9VW26 1.87e-65 218 33 8 385 2 Oat Ornithine aminotransferase, mitochondrial Drosophila melanogaster
Q9FNK4 3.51e-65 218 33 6 393 1 DELTA-OAT Ornithine aminotransferase, mitochondrial Arabidopsis thaliana
Q9I6M4 7.87e-65 216 34 11 406 1 davT 5-aminovalerate aminotransferase DavT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54JP5 1.19e-64 215 31 4 389 3 oatA Probable ornithine aminotransferase Dictyostelium discoideum
Q8ZV07 1.43e-64 214 37 9 367 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q4XWV5 4.1e-64 214 31 6 388 3 OAT Ornithine aminotransferase Plasmodium chabaudi chabaudi
P22256 5.23e-64 214 33 10 405 1 gabT 4-aminobutyrate aminotransferase GabT Escherichia coli (strain K12)
Q92413 8.12e-64 214 31 7 405 1 otaA Ornithine aminotransferase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9ZJ10 9.6e-64 207 46 2 231 3 argD Acetylornithine aminotransferase (Fragment) Bacillus amyloliquefaciens
Q9P7L5 7.95e-63 211 31 9 409 2 car2 Ornithine aminotransferase car2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P50457 1.44e-62 210 34 8 405 1 puuE 4-aminobutyrate aminotransferase PuuE Escherichia coli (strain K12)
P30268 5.42e-62 209 33 10 413 3 BpOF4_10225 Uncharacterized aminotransferase BpOF4_10225 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q31WW1 1.95e-61 208 36 9 388 3 patA Putrescine aminotransferase Shigella boydii serotype 4 (strain Sb227)
P94427 4.34e-61 206 32 8 409 3 gabT Probable 4-aminobutyrate aminotransferase Bacillus subtilis (strain 168)
Q0TD34 1.02e-60 206 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LF65 1.03e-60 206 36 9 381 3 patA Putrescine aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
A8A4N0 2.01e-60 205 35 9 388 3 patA Putrescine aminotransferase Escherichia coli O9:H4 (strain HS)
P42588 2.36e-60 205 35 9 388 1 patA Putrescine aminotransferase Escherichia coli (strain K12)
B1XG77 2.36e-60 205 35 9 388 3 patA Putrescine aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZQY9 2.36e-60 205 35 9 388 3 patA Putrescine aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R6Q7 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli (strain UTI89 / UPEC)
B6I445 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli (strain SE11)
A1AFZ3 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O1:K1 / APEC
B7N0M2 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O81 (strain ED1a)
B5YRB3 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAN1 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O157:H7
B7LH08 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli (strain 55989 / EAEC)
B7MB08 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIY0 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZRV6 2.85e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
A8APX8 3.01e-60 205 35 9 388 3 patA Putrescine aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1IRP4 3.1e-60 205 36 9 381 3 patA Putrescine aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A6TEB2 6.1e-60 204 36 9 372 3 patA Putrescine aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7ND61 6.57e-60 204 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4WEQ6 6.71e-60 204 36 9 387 3 patA Putrescine aminotransferase Enterobacter sp. (strain 638)
B5XTY7 7.77e-60 204 36 9 372 3 patA Putrescine aminotransferase Klebsiella pneumoniae (strain 342)
B7NJT8 9.01e-60 204 35 9 388 3 patA Putrescine aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q83JJ8 1.16e-59 203 35 9 381 3 patA Putrescine aminotransferase Shigella flexneri
Q0T0J2 1.16e-59 203 35 9 381 3 patA Putrescine aminotransferase Shigella flexneri serotype 5b (strain 8401)
Q8FDF5 1.51e-59 203 36 9 381 3 patA Putrescine aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7LQF8 1.53e-59 203 36 9 381 3 patA Putrescine aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MIU0 3.52e-59 202 34 9 388 3 patA Putrescine aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q88RB9 4.77e-59 201 33 9 400 1 davT 5-aminovalerate aminotransferase DavT Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3YXH0 5.48e-59 201 35 9 388 3 patA Putrescine aminotransferase Shigella sonnei (strain Ss046)
B5BG29 9.28e-59 201 35 9 388 3 patA Putrescine aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PC95 9.28e-59 201 35 9 388 3 patA Putrescine aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LZM2 1.37e-58 201 35 9 381 3 patA Putrescine aminotransferase Escherichia coli O8 (strain IAI1)
B5REH5 2.09e-58 200 35 9 388 3 patA Putrescine aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZ53 2.09e-58 200 35 9 388 3 patA Putrescine aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5FHV3 2.09e-58 200 35 9 388 3 patA Putrescine aminotransferase Salmonella dublin (strain CT_02021853)
Q8Z3L9 2.16e-58 200 35 9 388 3 patA Putrescine aminotransferase Salmonella typhi
B4TIU6 2.16e-58 200 35 9 388 3 patA Putrescine aminotransferase Salmonella heidelberg (strain SL476)
Q8ZLX7 5.63e-58 199 35 9 388 3 patA Putrescine aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TVV2 5.63e-58 199 35 9 388 3 patA Putrescine aminotransferase Salmonella schwarzengrund (strain CVM19633)
B4T688 5.63e-58 199 35 9 388 3 patA Putrescine aminotransferase Salmonella newport (strain SL254)
B5F6B4 5.63e-58 199 35 9 388 3 patA Putrescine aminotransferase Salmonella agona (strain SL483)
C0PYZ1 1.2e-57 198 35 9 388 3 patA Putrescine aminotransferase Salmonella paratyphi C (strain RKS4594)
Q57JP1 1.2e-57 198 35 9 388 3 patA Putrescine aminotransferase Salmonella choleraesuis (strain SC-B67)
O57878 1.01e-56 196 27 9 443 1 PH0138 Broad substrate specificity amino-acid racemase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A9N5Z8 1.12e-56 196 34 10 393 3 patA Putrescine aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q9YBY6 1.31e-56 193 33 7 375 3 lysJ Putative [LysW]-aminoadipate semialdehyde/glutamate semialdehyde transaminase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
H3ZR39 3.94e-56 194 30 8 412 1 OCC_10945 Leucine/methionine racemase Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
O50131 4.95e-56 194 33 12 410 1 PH1423 Ornithine aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A9MPU4 1.01e-55 193 34 9 388 3 patA Putrescine aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q6D6Y6 5.34e-55 191 36 10 383 3 patA Putrescine aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q88FI7 6.33e-55 190 34 12 411 1 PP_4108 2-aminoadipate transaminase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P40829 4.95e-54 188 32 12 425 3 gabT 4-aminobutyrate aminotransferase Mycobacterium leprae (strain TN)
Q17QF0 1.48e-53 189 30 11 440 2 AGXT2 Alanine--glyoxylate aminotransferase 2, mitochondrial Bos taurus
P33189 3.39e-53 186 32 10 402 3 yhxA Uncharacterized aminotransferase YhxA Bacillus subtilis (strain 168)
P56969 6.14e-52 182 31 8 374 3 AF_1815 Uncharacterized aminotransferase AF_1815 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A3UZK3 2.38e-50 179 30 8 415 1 pbfA (R)-1-hydroxy-2-aminoethylphosphonate ammonia-lyase Vibrio splendidus (strain 12B01)
Q9APM5 3.04e-50 178 29 10 424 1 tpa Taurine--pyruvate aminotransferase Bilophila wadsworthia
E5Y945 3.04e-50 178 29 10 424 1 tpa Taurine--pyruvate aminotransferase Bilophila wadsworthia (strain 3_1_6)
Q7M9K2 4.3e-50 177 31 12 426 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q84P54 4.43e-50 179 31 10 420 1 GABA-TP1 Gamma aminobutyrate transaminase 1, mitochondrial Solanum lycopersicum
Q9BYV1 4.53e-50 179 29 11 424 1 AGXT2 Alanine--glyoxylate aminotransferase 2, mitochondrial Homo sapiens
Q2FVJ6 4.87e-50 178 30 13 425 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5RFA3 4.98e-50 179 29 11 424 2 AGXT2 Alanine--glyoxylate aminotransferase 2, mitochondrial Pongo abelii
M1GRN3 1.22e-49 177 27 8 402 1 None Isoleucine 2-epimerase Lentilactobacillus buchneri
O58478 1.31e-49 177 29 11 417 1 PH0782 Alanine/serine racemase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q94CE5 3.5e-49 177 30 10 427 1 POP2 Gamma-aminobutyrate transaminase POP2, mitochondrial Arabidopsis thaliana
Q5JGG6 4.78e-49 175 29 11 435 1 TK1211 Leucine/methionine racemase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B8BBZ7 6.08e-49 176 30 10 415 3 OsI_28220 Probable gamma-aminobutyrate transaminase 3, mitochondrial Oryza sativa subsp. indica
Q84P53 9.08e-49 174 30 9 420 1 GABA-TP2 Gamma aminobutyrate transaminase 2 Solanum lycopersicum
Q3UEG6 9.4e-49 176 28 10 422 1 Agxt2 Alanine--glyoxylate aminotransferase 2, mitochondrial Mus musculus
Q6ZCF0 1.25e-48 175 31 10 406 3 Os08g0205900 Probable gamma-aminobutyrate transaminase 3, mitochondrial Oryza sativa subsp. japonica
O82521 2.76e-48 173 30 9 420 1 VAMT Vanillin aminotransferase Capsicum chinense
Q84P52 3.11e-48 174 30 10 417 1 GABA-TP3 Gamma aminobutyrate transaminase 3, chloroplastic Solanum lycopersicum
E1AQY3 3.62e-48 173 30 9 420 2 VAMT Vanillin aminotransferase Capsicum annuum
Q01K11 4.61e-48 174 31 11 406 3 OsI_17385 Gamma-aminobutyrate transaminase 1, mitochondrial Oryza sativa subsp. indica
D6R3B6 5.95e-48 172 30 9 420 1 PAMT Vanillin aminotransferase Capsicum frutescens
Q7XN11 6.35e-48 174 31 11 415 1 OSL2 Gamma-aminobutyrate transaminase 1, mitochondrial Oryza sativa subsp. japonica
Q64565 9.91e-48 173 27 11 433 1 Agxt2 Alanine--glyoxylate aminotransferase 2, mitochondrial Rattus norvegicus
A1B9Z3 5.21e-47 170 28 10 419 1 hpa/tpa Hypotaurine/taurine--pyruvate aminotransferase Paracoccus denitrificans (strain Pd 1222)
Q74CT9 6.87e-47 169 30 10 414 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q53196 1.14e-45 166 28 10 433 3 NGR_a01380 Uncharacterized aminotransferase y4uB Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7XN12 3.12e-45 166 31 11 405 2 Os04g0614500 Probable gamma-aminobutyrate transaminase 2, mitochondrial Oryza sativa subsp. japonica
Q01K12 3.12e-45 166 31 11 405 3 OsI_17384 Probable gamma-aminobutyrate transaminase 2, mitochondrial Oryza sativa subsp. indica
P53555 3.78e-45 164 29 11 431 1 bioK L-Lysine--8-amino-7-oxononanoate transaminase Bacillus subtilis (strain 168)
B7GHM5 4.15e-45 165 30 14 444 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6ZH29 6.43e-45 165 30 10 416 2 GABA-T Probable gamma-aminobutyrate transaminase 4 Oryza sativa subsp. japonica
D5AKY0 2.43e-44 162 30 12 400 2 tpa Taurine--pyruvate aminotransferase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P44951 2.87e-44 162 31 9 347 1 dat Diaminobutyrate--2-oxoglutarate aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQ79 7.1e-44 161 32 11 417 1 gabT 4-aminobutyrate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ78 7.1e-44 161 32 11 417 3 gabT 4-aminobutyrate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63505 7.1e-44 161 32 11 417 3 gabT 4-aminobutyrate aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q10174 2.7e-43 160 30 9 401 3 SPAC27F1.05c Uncharacterized aminotransferase C27F1.05c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q94AL9 7.55e-43 159 27 8 394 1 AGT3 Alanine--glyoxylate aminotransferase 2 homolog 2, mitochondrial Arabidopsis thaliana
P22805 9.9e-43 158 30 15 427 1 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Lysinibacillus sphaericus
Q9A3Q9 1.16e-42 158 30 11 405 1 aptA Omega-aminotransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O66557 1.7e-42 157 29 12 422 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Aquifex aeolicus (strain VF5)
Q7W979 6.21e-42 155 29 12 407 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHI8 6.21e-42 155 29 12 407 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8ESU8 6.44e-42 155 28 14 428 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9US34 1.85e-41 155 27 12 415 3 SPAC1039.07c Uncharacterized aminotransferase C1039.07c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A0J9X1Q5 3.26e-41 159 32 9 334 1 pigE Aminotransferase PigE Serratia sp. (strain FS14)
Q940M2 3.31e-41 154 27 9 412 1 AGT2 Alanine--glyoxylate aminotransferase 2 homolog 1, mitochondrial Arabidopsis thaliana
Q9AP34 5.21e-41 153 28 12 406 2 ectB Diaminobutyrate--2-oxoglutarate transaminase Sporosarcina pasteurii
P46395 1.03e-40 152 32 9 328 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q58696 1.03e-40 153 27 13 432 1 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P16932 1.34e-40 152 29 12 417 1 dgdA 2,2-dialkylglycine decarboxylase Burkholderia cepacia
P55628 1.53e-40 152 30 13 400 3 NGR_a01910 Uncharacterized aminotransferase y4qG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5WL78 2.24e-40 151 28 13 404 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Shouchella clausii (strain KSM-K16)
Q5YW77 7.51e-40 150 30 13 397 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Nocardia farcinica (strain IFM 10152)
Q9KED4 9.63e-40 150 27 11 405 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9Z3R2 9.63e-40 150 29 12 424 3 rhbA Diaminobutyrate--2-oxoglutarate aminotransferase Rhizobium meliloti (strain 1021)
E1WTS4 9.94e-40 154 33 9 322 3 bioB Biotin biosynthesis bifunctional protein BioAB Bacteroides fragilis (strain 638R)
Q829L4 1.22e-39 149 31 14 400 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9SR86 1.38e-39 150 27 10 395 2 At3g08860 Alanine--glyoxylate aminotransferase 2 homolog 3, mitochondrial Arabidopsis thaliana
P53656 1.4e-39 149 36 10 309 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Pseudescherichia vulneris
E1V7V7 1.64e-39 150 26 9 430 3 doeD Diaminobutyrate--2-oxoglutarate transaminase Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
O25627 1.83e-39 149 29 11 409 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q6QUY9 1.99e-39 149 30 13 404 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Streptomyces anulatus
Q9ZKM5 2.68e-39 149 29 11 411 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q64VX4 4.27e-39 152 33 9 322 3 bioB Biotin biosynthesis bifunctional protein BioAB Bacteroides fragilis (strain YCH46)
Q5LEY1 5.76e-39 152 33 9 322 3 bioB Biotin biosynthesis bifunctional protein BioAB Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
O53379 8.74e-39 148 30 7 347 1 Rv3329 Probable aminotransferase Rv3329 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P31893 1.32e-38 146 30 4 308 2 None Ornithine aminotransferase Vigna aconitifolia
Q5W267 1.41e-38 151 30 7 344 1 pigE Aminotransferase PigE Serratia sp. (strain ATCC 39006)
Q93RW1 1.9e-38 146 29 12 403 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P56744 3.04e-38 146 27 11 429 1 dat Diaminobutyrate--2-oxoglutarate aminotransferase Acinetobacter baumannii
P12677 3.14e-38 145 35 10 311 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8A7T2 4.57e-38 149 32 9 333 3 bioB Biotin biosynthesis bifunctional protein BioAB Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9KLC2 5.38e-38 144 29 13 411 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9I6J2 6.5e-38 145 28 15 421 1 spuC Putrescine--pyruvate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87NZ7 7.67e-38 144 27 11 410 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P9WQ81 8.08e-38 145 36 8 278 1 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ80 8.08e-38 145 36 8 278 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4X7 8.08e-38 145 36 8 278 1 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O06060 1.01e-37 144 27 13 403 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Marinococcus halophilus
E6SRG2 3.54e-37 146 32 10 329 3 bioB Biotin biosynthesis bifunctional protein BioAB Bacteroides helcogenes (strain ATCC 35417 / DSM 20613 / JCM 6297 / CCUG 15421 / P 36-108)
Q728P4 4.08e-37 144 29 11 413 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q31SA6 6.61e-37 142 31 12 406 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZEU7 7.05e-37 142 28 16 430 1 ectB Diaminobutyrate--2-oxoglutarate transaminase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q30WH2 1.17e-36 141 34 12 328 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P45488 1.68e-36 141 36 11 281 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Mycobacterium leprae (strain TN)
B1YJU8 3.18e-36 140 35 11 308 3 hemL2 Glutamate-1-semialdehyde 2,1-aminomutase 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9FCC2 3.83e-36 140 34 9 278 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6PR32 5.31e-36 139 27 14 408 3 ectB Diaminobutyrate--2-oxoglutarate transaminase Virgibacillus pantothenticus
Q6DEB1 6.86e-36 140 27 14 418 2 etnppl Ethanolamine-phosphate phospho-lyase Xenopus laevis
Q0AFV1 8.66e-36 139 32 8 310 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P44426 9.47e-36 139 30 13 396 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1WYL3 1.68e-35 138 31 9 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Halorhodospira halophila (strain DSM 244 / SL1)
P91408 3.11e-35 138 27 16 431 3 eppl-1 Ethanolamine-phosphate phospho-lyase homolog 1 Caenorhabditis elegans
B8CJG4 4.17e-35 137 30 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8K9P0 4.7e-35 137 31 12 336 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A8FS76 6.81e-35 136 30 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella sediminis (strain HAW-EB3)
A8H164 8.14e-35 136 29 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q89AK4 1.36e-34 135 36 11 283 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
C4L4J9 1.65e-34 135 33 8 300 3 hemL2 Glutamate-1-semialdehyde 2,1-aminomutase 2 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B0TIQ0 1.79e-34 135 29 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella halifaxensis (strain HAW-EB4)
O52250 1.95e-34 135 29 13 406 1 ectB Diaminobutyrate--2-oxoglutarate transaminase Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
Q8R1K4 1.99e-34 136 26 16 423 1 Phykpl 5-phosphohydroxy-L-lysine phospho-lyase Mus musculus
B3QSA6 2.03e-34 135 34 9 287 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
P57379 2.27e-34 135 29 15 377 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P12995 2.5e-34 135 34 10 300 1 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Escherichia coli (strain K12)
A0LIP3 1.17e-33 133 32 8 308 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B1KHF6 1.26e-33 133 29 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella woodyi (strain ATCC 51908 / MS32)
O34662 1.32e-33 133 26 11 406 3 yodT Uncharacterized aminotransferase YodT Bacillus subtilis (strain 168)
Q9VU95 2.07e-33 134 26 14 415 2 CG8745 Alanine--glyoxylate aminotransferase 2-like Drosophila melanogaster
A5N5Y1 2.76e-33 132 35 10 289 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZG0 2.76e-33 132 35 10 289 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Clostridium kluyveri (strain NBRC 12016)
Q7VHK3 3.13e-33 132 31 11 328 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7WF71 3.61e-33 132 35 12 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
C0ZAH4 4.24e-33 132 35 8 281 3 hemL2 Glutamate-1-semialdehyde 2,1-aminomutase 2 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q24VD4 5.65e-33 131 32 8 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Desulfitobacterium hafniense (strain Y51)
A4J6H0 5.94e-33 131 32 7 294 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8IUZ5 6.41e-33 131 26 17 434 1 PHYKPL 5-phosphohydroxy-L-lysine phospho-lyase Homo sapiens
B8G2L6 6.91e-33 131 32 8 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
P9WQ77 7.06e-33 131 29 12 396 1 lat Probable L-lysine-epsilon aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ76 7.06e-33 131 29 12 396 3 lat Probable L-lysine-epsilon aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63510 7.06e-33 131 29 12 396 3 lat Probable L-lysine-epsilon aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3QBN5 8.11e-33 131 29 11 332 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S3U0 1.1e-32 130 29 12 334 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7W3U1 1.21e-32 130 35 12 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8EHC8 1.25e-32 130 29 13 337 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q07YU5 1.31e-32 130 29 12 332 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella frigidimarina (strain NCIMB 400)
Q8TBG4 1.44e-32 131 28 20 420 1 ETNPPL Ethanolamine-phosphate phospho-lyase Homo sapiens
Q82UQ8 1.44e-32 130 31 8 317 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8BWU8 1.5e-32 131 29 14 359 2 Etnppl Ethanolamine-phosphate phospho-lyase Mus musculus
A1KB59 1.76e-32 130 29 10 348 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Azoarcus sp. (strain BH72)
Q7W050 1.88e-32 130 35 12 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0HG53 2.02e-32 130 29 12 336 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella sp. (strain MR-4)
A4SJ79 2.19e-32 129 31 10 311 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Aeromonas salmonicida (strain A449)
Q976H2 2.32e-32 129 31 9 316 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q2JMP7 2.86e-32 129 32 11 308 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q5E9S4 3.01e-32 130 27 16 432 2 ETNPPL Ethanolamine-phosphate phospho-lyase Bos taurus
Q5KWK9 3.82e-32 129 30 10 342 3 hemL2 Glutamate-1-semialdehyde 2,1-aminomutase 2 Geobacillus kaustophilus (strain HTA426)
A0B885 3.94e-32 129 28 11 359 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q3SFU6 5.12e-32 129 31 10 317 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Thiobacillus denitrificans (strain ATCC 25259)
A8G9U7 5.59e-32 129 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Serratia proteamaculans (strain 568)
Q7M181 6.06e-32 129 27 12 412 1 None 2-aminohexano-6-lactam racemase Achromobacter obae
P36568 6.2e-32 128 34 10 288 3 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase Serratia marcescens
Q3A7W5 6.51e-32 128 28 16 403 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q980U5 6.76e-32 128 30 10 322 1 hemL Glutamate-1-semialdehyde 2,1-aminomutase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q3ALU9 7.75e-32 128 33 9 313 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Synechococcus sp. (strain CC9605)
Q2JS70 7.78e-32 128 32 11 307 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Synechococcus sp. (strain JA-3-3Ab)
B2A1H4 8.38e-32 128 28 8 329 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A1RMG7 9.64e-32 128 29 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella sp. (strain W3-18-1)
A4Y4G4 9.64e-32 128 29 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
O66998 1.06e-31 127 35 10 282 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Aquifex aeolicus (strain VF5)
C3MYE0 1.12e-31 127 30 8 315 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MZR9 1.12e-31 127 30 8 315 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain M.16.27)
C0QQ98 1.2e-31 127 29 9 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Persephonella marina (strain DSM 14350 / EX-H1)
A1V9X6 1.3e-31 127 32 9 313 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Nitratidesulfovibrio vulgaris (strain DP4)
Q0HSE6 1.4e-31 127 28 12 336 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella sp. (strain MR-7)
C3N842 1.41e-31 127 30 9 318 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NF69 1.41e-31 127 30 9 318 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MJ22 1.41e-31 127 30 9 318 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KJ00 1.41e-31 127 30 9 318 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q83AK3 1.72e-31 127 31 8 304 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAX3 1.72e-31 127 31 8 304 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J495 1.74e-31 127 31 8 304 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Coxiella burnetii (strain CbuK_Q154)
B8HYK1 1.79e-31 127 32 8 313 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q725I1 1.81e-31 127 32 9 313 1 hemL Glutamate-1-semialdehyde 2,1-aminomutase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B6J3H2 1.9e-31 127 31 8 304 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Coxiella burnetii (strain CbuG_Q212)
A9KBA0 1.94e-31 127 31 8 304 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Coxiella burnetii (strain Dugway 5J108-111)
O29027 2.04e-31 127 29 8 305 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9I700 2.43e-31 127 27 11 413 1 bauA Beta-alanine--pyruvate aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7SY54 2.52e-31 127 26 15 419 2 etnppl Ethanolamine-phosphate phospho-lyase Danio rerio
A0A098DDI1 3.25e-31 127 28 9 368 3 FGRAMPH1_01T09365 Aminotransferase FGSG_17085 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0KZS6 3.4e-31 126 28 13 337 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella sp. (strain ANA-3)
Q7U598 4.41e-31 126 34 9 294 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Parasynechococcus marenigrum (strain WH8102)
A0KNY9 5.61e-31 125 31 10 311 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7LWB5 6.15e-31 125 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4YD91 6.73e-31 125 29 13 331 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
B4S0D0 6.86e-31 125 28 7 308 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A0L3S9 7.55e-31 125 32 9 310 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q3ACS9 8.15e-31 125 30 8 311 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C1DUY4 8.32e-31 125 29 9 331 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Sulfurihydrogenibium azorense (strain Az-Fu1 / DSM 15241 / OCM 825)
C4LAK4 8.54e-31 125 30 10 313 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A5GMT2 9.5e-31 125 34 9 294 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Synechococcus sp. (strain WH7803)
A4XK09 1.09e-30 125 30 6 278 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q2Y5Q5 1.09e-30 125 30 8 309 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B4EUE1 1.1e-30 125 27 13 377 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Proteus mirabilis (strain HI4320)
Q2KUS4 1.44e-30 124 34 11 297 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Bordetella avium (strain 197N)
A5WC94 1.55e-30 124 30 10 319 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Psychrobacter sp. (strain PRwf-1)
A3D1R5 1.59e-30 124 28 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q3AWP4 1.63e-30 124 32 9 308 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Synechococcus sp. (strain CC9902)
Q3M3B9 1.65e-30 124 31 10 318 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A4IRG2 1.68e-30 124 30 10 342 3 hemL2 Glutamate-1-semialdehyde 2,1-aminomutase 2 Geobacillus thermodenitrificans (strain NG80-2)
Q1RG34 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli (strain UTI89 / UPEC)
Q8FL16 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLH7 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7K0 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O1:K1 / APEC
B7MBD7 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIK1 1.75e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A3N2K3 1.77e-30 124 29 11 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B1XIT5 1.77e-30 124 31 8 313 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B7MP16 1.82e-30 124 30 10 312 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O81 (strain ED1a)
B3GYN8 1.86e-30 124 29 11 321 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B6HZD0 1.93e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli (strain SE11)
B7N823 1.93e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ZWA2 1.93e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O9:H4 (strain HS)
A9L5J5 1.98e-30 124 28 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella baltica (strain OS195)
B0BRF0 2.03e-30 124 29 11 321 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B1IQI6 2.14e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M195 2.14e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O8 (strain IAI1)
B7LGL6 2.14e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli (strain 55989 / EAEC)
A7ZHP6 2.14e-30 124 31 10 302 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Escherichia coli O139:H28 (strain E24377A / ETEC)
B0CC57 2.14e-30 124 31 9 297 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Acaryochloris marina (strain MBIC 11017)
A6WKL6 2.26e-30 124 28 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella baltica (strain OS185)
B8EBU3 2.26e-30 124 28 12 333 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Shewanella baltica (strain OS223)
Q8Y1M4 2.4e-30 124 29 9 321 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6AQ32 2.84e-30 124 28 9 314 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B9KFS8 2.96e-30 124 30 11 331 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q2S8X9 2.97e-30 124 28 7 328 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Hahella chejuensis (strain KCTC 2396)
Q87VY5 3.26e-30 124 29 7 305 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0KDN9 3.53e-30 124 30 11 314 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1GXW0 4.03e-30 123 31 10 308 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B8FBA1 4.27e-30 123 31 11 316 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Desulfatibacillum aliphaticivorans
C3LSN1 4.29e-30 123 28 10 320 3 hemL Glutamate-1-semialdehyde 2,1-aminomutase Vibrio cholerae serotype O1 (strain M66-2)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13935
Feature type CDS
Gene -
Product acetylornithine/succinyldiaminopimelate transaminase
Location 3094525 - 3095742 (strand: -1)
Length 1218 (nucleotides) / 405 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1699
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00202 Aminotransferase class-III

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4992 Amino acid transport and metabolism (E) E Acetylornithine/succinyldiaminopimelate/putrescine aminotransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MINQRINRATYDQVMLPIYSPADFIPVKGQGSRVWDQQGKSYIDFAGGIAVLALGHAHPLLNKALQEQSEKLWHVSNVFTNEPALCLAQKLIQHTFAERVFFANSGAEANEAALKLARHYAITRHNPYKTKIIAFHHAFHGRTFFTVSVGGQPKYADGFGPKPADIIHVPFNSLDAVKAVIDSHTCAVILEPIQGEGGVTPATAEFMHGLRTLCDKHQALLILDEVQTGMGRTGKLFAYMHYDIQPDIITSAKALGSGFPLSAMLTTEDIASVMGVGTHGTTYGGNPLACAVGNAAFDLINTQAVLEGVSERHRWIVDELQAINQTYAVFSQIRGQGLLIGAQLAPLYAGKAKELLALASKHGLMILNAGADVIRFTPSLIITLEELQEGMNALRKALDEFVKAE

Flanking regions ( +/- flanking 50bp)

TTTAGTGATTATATTTTCATTGTATAGCTAAATGTCGGTCAGGTGGGGTAATGATAAATCAACGTATTAATAGGGCAACTTACGATCAGGTAATGTTGCCAATTTATTCACCAGCAGATTTTATTCCTGTTAAAGGGCAAGGTAGCCGTGTTTGGGATCAACAGGGAAAATCCTATATTGATTTTGCTGGTGGTATTGCTGTTCTAGCGCTTGGGCATGCGCATCCACTATTGAATAAAGCACTGCAAGAGCAAAGTGAGAAGCTTTGGCATGTAAGTAATGTGTTTACTAATGAGCCGGCATTATGTTTAGCTCAGAAATTAATCCAACATACTTTTGCTGAACGTGTCTTTTTTGCCAATTCTGGGGCAGAAGCGAATGAAGCCGCACTTAAATTAGCACGACATTACGCTATTACCCGTCATAATCCTTATAAAACGAAGATAATTGCCTTCCACCACGCCTTTCATGGTAGAACATTTTTTACAGTCTCTGTTGGGGGACAACCTAAATATGCGGATGGTTTTGGTCCTAAACCTGCGGATATTATACATGTCCCTTTTAACTCTCTTGATGCTGTAAAAGCCGTGATTGACTCTCATACTTGTGCCGTAATACTGGAGCCTATCCAAGGTGAGGGCGGAGTGACACCGGCGACAGCGGAGTTTATGCATGGCTTACGTACACTATGTGATAAGCATCAAGCGCTATTAATTCTTGATGAAGTACAAACGGGTATGGGGCGAACCGGCAAACTATTTGCTTATATGCACTATGATATACAGCCCGATATTATTACCAGTGCCAAAGCATTAGGTAGTGGTTTTCCTCTCAGTGCGATGTTAACCACCGAGGATATCGCTTCGGTAATGGGGGTAGGAACACATGGTACGACTTATGGGGGGAACCCATTAGCCTGTGCAGTAGGCAATGCTGCTTTTGATTTAATCAACACTCAGGCGGTATTAGAAGGTGTCAGTGAGCGTCATCGTTGGATAGTGGATGAATTGCAGGCGATAAACCAAACTTATGCTGTGTTTTCTCAAATTCGTGGACAAGGCTTATTAATTGGCGCGCAGTTAGCACCACTGTATGCAGGTAAAGCAAAAGAGTTACTTGCACTGGCCTCTAAGCATGGCTTAATGATATTAAATGCCGGGGCTGATGTAATACGCTTTACACCATCGCTGATTATTACCCTCGAAGAGTTACAAGAGGGCATGAATGCGTTACGAAAAGCGCTTGATGAGTTTGTAAAAGCAGAGTGAATTCAAATGTAAAACCCCATCATTGCGATGGGGCTTCATACAAAATAATC