Homologs in group_1693

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11800 FBDBKF_11800 76.5 Morganella morganii S1 uup ABC transporter ATP-binding protein
EHELCC_14505 EHELCC_14505 76.5 Morganella morganii S2 uup ABC transporter ATP-binding protein
NLDBIP_15600 NLDBIP_15600 76.5 Morganella morganii S4 uup ABC transporter ATP-binding protein
LHKJJB_15010 LHKJJB_15010 76.5 Morganella morganii S3 uup ABC transporter ATP-binding protein
HKOGLL_19275 HKOGLL_19275 76.5 Morganella morganii S5 uup ABC transporter ATP-binding protein
F4V73_RS14855 F4V73_RS14855 75.6 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1693

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1693

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A0H2VBH0 0.0 1022 75 2 636 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63389 0.0 1021 75 2 636 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 0.0 1021 75 2 636 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P44808 0.0 866 67 3 643 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8H0V6 8.62e-123 383 37 7 542 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 4.01e-10 66 28 0 138 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8K268 7.55e-119 373 37 5 525 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 6.38e-20 97 28 4 249 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 2.41e-117 369 37 4 525 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 4.61e-20 98 28 4 249 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q66H39 2.8e-117 369 38 5 525 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 1.9e-20 99 30 5 249 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q5R9Z5 3.85e-117 368 37 4 525 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 1.64e-19 96 28 4 249 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
O59672 8.69e-106 339 35 7 549 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FJH6 6.93e-105 333 35 5 511 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 2.3e-16 86 26 6 263 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.44e-15 84 27 4 224 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
P43535 9.22e-105 337 34 8 543 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 3.46e-13 76 26 7 298 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O05519 1.51e-102 328 32 8 607 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 3.56e-32 135 31 9 315 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O42943 7.77e-102 326 33 8 530 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40024 4.68e-100 321 34 6 529 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 7.56e-12 72 25 6 236 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0A9U3 3.22e-99 316 34 10 527 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 3.22e-99 316 34 10 527 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 3.22e-99 316 34 10 527 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q8T6B4 2.02e-98 328 34 7 531 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 8.34e-18 91 25 8 295 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B7 3.76e-98 315 34 8 525 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 1.66e-14 80 23 3 277 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q9UG63 3.85e-96 311 35 8 528 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q99LE6 6.27e-96 310 35 8 528 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9M1H3 8.5e-96 313 33 10 557 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q8SRV5 5.38e-95 306 35 9 506 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 3.38e-14 79 26 7 250 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q2KJA2 7.5e-95 308 35 8 537 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
O31716 7.34e-83 273 32 8 507 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 1.49e-27 120 28 2 261 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 1.62e-19 95 28 6 227 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q9LV93 1.32e-78 266 30 10 580 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 3.96e-11 69 24 4 259 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q767L0 2.02e-78 268 34 7 528 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 1.15e-12 75 26 5 288 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q8NE71 1e-77 267 33 7 528 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 6.08e-13 75 26 5 288 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 3.59e-77 265 33 7 528 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 3.38e-12 73 25 5 288 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
O34512 5.03e-77 258 31 5 486 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 4.41e-29 125 25 5 331 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 3.52e-16 85 32 4 182 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q6MG08 2.8e-76 263 33 7 528 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 2.19e-12 73 29 5 217 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6P542 1.26e-73 256 33 7 529 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 2.02e-12 74 28 3 217 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q9FIB4 4.19e-73 251 29 11 581 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 7.54e-13 75 26 6 254 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9USH9 1.36e-72 253 30 8 523 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1.79e-14 80 24 4 232 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P43672 9.91e-70 241 27 15 641 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 5.07e-16 85 26 4 242 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O06476 5.31e-69 239 31 14 528 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 5.9e-22 103 27 4 259 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q57242 3.34e-68 237 28 17 643 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 2.91e-17 89 32 5 245 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 4.7e-17 88 27 4 242 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 5.52e-68 234 31 12 525 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 7.16e-23 106 29 7 279 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 1.63e-22 105 34 6 237 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2VFI8 1.5e-66 231 31 11 525 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 1.23e-22 105 30 2 240 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 1.52e-66 231 31 11 525 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.02e-22 106 30 2 240 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 1.52e-66 231 31 11 525 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.02e-22 106 30 2 240 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 1.52e-66 231 31 11 525 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.02e-22 106 30 2 240 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P9WQK3 3.39e-65 227 30 8 535 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 3.39e-65 227 30 8 535 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P39115 7.65e-59 209 29 13 528 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 6.2e-25 112 33 4 208 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 3.78e-23 107 32 4 207 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q8K9I3 2.64e-56 204 29 17 537 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 4.09e-19 95 28 4 229 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0DX93 2.09e-53 193 28 14 532 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 2.03e-18 92 29 6 246 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P25256 2.41e-52 192 30 14 532 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 4.41e-21 100 29 6 287 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P57445 1.04e-48 183 29 8 388 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 1.94e-11 70 22 3 226 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
D0MYB4 1.7e-42 168 29 12 403 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 8.8e-19 94 30 5 212 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 9.91e-10 65 32 4 135 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.4e-06 55 32 0 74 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O14134 2.83e-41 164 30 12 426 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.27e-13 76 30 4 187 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.83e-09 64 32 2 100 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 2.33e-08 61 35 0 79 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23212 1.09e-40 158 27 16 504 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 9.95e-15 80 28 5 214 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 1.03e-13 77 28 9 238 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P12622 1.84e-40 152 32 3 272 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.99e-08 59 30 0 135 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 2.49e-06 53 38 0 59 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
Q08972 7.74e-40 160 29 11 401 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.08e-18 94 31 5 201 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 3.61e-09 63 33 0 77 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 3.79e-06 53 28 2 123 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29551 3.19e-37 152 30 13 386 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.84e-14 80 35 1 101 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 7.84e-13 75 28 5 203 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 9.77e-07 55 30 0 85 3 TEF3 Elongation factor 3 Pneumocystis carinii
O93796 8.84e-36 148 27 10 381 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 3.82e-17 89 32 6 199 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.13e-15 84 34 1 103 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 4.27e-08 60 29 2 124 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q45978 5.72e-35 143 24 11 643 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 2.57e-21 102 33 4 209 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O94489 2.34e-34 143 27 10 385 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.03e-14 80 28 3 200 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 4.05e-13 76 40 0 77 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.1e-08 62 32 0 87 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q75EV6 4.14e-34 142 28 10 382 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.45e-16 86 31 7 202 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.81e-15 84 29 2 155 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.31e-07 58 30 3 121 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P45167 4.34e-34 139 26 13 472 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 9.55e-19 93 33 5 241 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P53978 6.25e-34 142 28 11 384 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.14e-16 88 31 9 229 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.74e-16 86 44 0 77 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 6e-09 63 31 2 122 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25997 1.08e-32 138 27 11 382 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 6.85e-16 85 36 1 103 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.91e-15 84 30 6 203 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 2.37e-07 58 30 2 107 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P16521 2.73e-32 137 26 10 384 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 4.93e-15 82 42 0 77 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.89e-15 82 28 4 200 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.38e-07 57 32 0 87 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q87RE5 4.89e-23 102 33 4 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6YRJ4 6.82e-23 106 25 21 526 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
A1JRI2 1.56e-22 100 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 3.1e-10 64 23 6 263 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6LTB1 5.21e-21 96 31 4 197 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 8.84e-09 60 24 7 260 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q7N545 5.31e-21 96 32 4 196 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 2.68e-08 58 22 7 257 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1CJG3 7.88e-21 95 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 5.69e-12 69 23 8 261 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 7.88e-21 95 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 5.69e-12 69 23 8 261 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 7.88e-21 95 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 5.69e-12 69 23 8 261 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 8.5e-21 95 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 7.67e-12 69 23 8 261 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8TQW9 1.12e-20 99 22 18 536 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 2.04e-10 67 27 9 236 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q81N53 1.4e-20 99 25 17 514 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q8Z5W6 2.22e-20 94 34 6 192 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 1.33e-07 56 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q5PIA5 2.89e-20 94 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 1.51e-07 56 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 2.89e-20 94 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 1.51e-07 56 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8ZNV7 3.4e-20 94 33 4 191 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 8.08e-08 57 22 8 271 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0VTB6 3.52e-20 94 33 6 200 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 3.46e-06 52 25 7 234 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q6HG98 3.68e-20 98 26 18 516 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q0I4A9 3.99e-20 94 32 4 205 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q7MMN0 4.26e-20 94 31 5 201 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 4.26e-20 94 31 5 201 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q32HA3 8.47e-20 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 8.95e-08 57 23 7 271 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q832R5 9.04e-20 97 25 21 524 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 5.52e-09 62 25 7 207 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q3Z2L6 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.23e-19 92 31 3 190 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 6.19e-08 57 22 8 271 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.23e-19 92 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 6.19e-08 57 22 8 271 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q5E6M2 3.88e-19 90 31 4 203 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 8.97e-10 63 24 5 242 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KQB8 3.95e-19 90 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5HCL3 4.47e-19 94 23 23 542 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q6D4A8 5.05e-19 90 32 4 196 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 5.15e-08 58 22 6 271 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q99QV7 5.06e-19 94 23 23 542 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 5.06e-19 94 23 23 542 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q31I51 1.28e-18 89 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 6.83e-10 63 26 7 219 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q6GDC0 1.49e-18 93 23 22 545 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
Q83KR7 1.5e-18 89 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.5e-18 89 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q87UN0 2.55e-18 88 31 5 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88ZZ2 3e-18 92 24 17 514 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8NUH8 3.06e-18 92 22 21 541 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 3.06e-18 92 22 21 541 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q48PV0 3.78e-18 88 33 6 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8XK20 5.39e-18 91 21 15 530 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q2K0S7 5.72e-18 90 23 19 539 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 6.54e-05 49 25 5 216 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q4KKK4 7.78e-18 87 30 6 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 1.3e-09 62 25 6 209 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q73P93 1.54e-17 89 23 19 516 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 1.29e-10 67 26 3 214 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 6.12e-05 49 23 9 231 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q160Y9 1.62e-17 86 29 4 191 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 1.47e-10 65 26 6 230 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3KKA1 1.86e-17 86 30 6 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.84e-09 62 24 6 229 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q88RL1 2.38e-17 85 30 5 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93D97 2.49e-17 89 23 22 531 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q72D73 3.09e-17 85 31 6 217 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 1.28e-07 57 30 5 197 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q5HQ70 3.74e-17 87 26 10 316 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q65UG3 4.53e-17 85 28 3 201 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q734T1 4.57e-17 88 26 13 406 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4QND5 4.9e-17 85 28 4 203 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q58129 8.35e-17 87 22 20 503 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58129 1.16e-07 58 29 11 216 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4ZZS2 8.39e-17 84 32 6 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q9LID6 1.24e-16 87 22 18 511 2 ABCE1 ABC transporter E family member 1 Arabidopsis thaliana
A1WXT0 1.44e-16 83 26 4 201 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 2.26e-08 59 24 5 246 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q1IGY7 1.49e-16 83 31 4 191 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1Q889 2.13e-16 82 31 3 185 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q89AJ0 2.26e-16 82 27 3 195 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 3.06e-09 61 25 6 208 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0A9U2 2.31e-16 86 25 22 577 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 2.09e-05 51 28 6 204 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 2.31e-16 86 25 22 577 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 2.09e-05 51 28 6 204 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q8CPN0 2.63e-16 84 26 10 316 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7VLS9 2.74e-16 82 30 3 194 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P96605 2.76e-16 83 28 8 224 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
P96605 3.79e-09 62 26 7 225 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q8LPJ4 2.78e-16 86 23 19 508 2 ABCE2 ABC transporter E family member 2 Arabidopsis thaliana
Q1M5X4 2.83e-16 85 24 17 529 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 1.19e-05 52 25 5 216 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q81CT8 2.98e-16 85 23 19 544 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P44692 4.82e-16 82 28 4 198 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q97SA3 5.24e-16 85 24 21 546 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 4.25e-07 56 24 5 207 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q58639 5.28e-16 85 22 25 592 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 1.95e-09 64 24 7 247 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q74I62 7.63e-16 84 23 19 514 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2YXZ0 8.14e-16 80 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YXZ0 3.9e-07 55 25 4 210 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8PUE7 9.42e-16 84 21 18 530 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 1.07e-10 68 26 7 253 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9HZL7 1.13e-15 80 29 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 2.52e-11 67 26 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6G4Q8 1.64e-15 79 29 8 207 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6FFL0 1.98e-15 80 32 6 198 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 8.92e-12 69 25 5 213 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9KXJ6 2.41e-15 83 25 15 425 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KXJ6 3.15e-07 57 25 6 230 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8PVG9 2.47e-15 83 22 16 519 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q21PQ7 2.51e-15 79 28 7 203 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7A5Q9 2.66e-15 79 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q7A5Q9 2.64e-07 55 24 5 217 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 2.66e-15 79 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99UA3 2.64e-07 55 24 5 217 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q28VN1 2.67e-15 79 27 3 190 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 1.12e-09 62 26 7 224 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q9CP24 2.88e-15 79 30 4 200 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q9VSS1 2.93e-15 82 24 21 507 1 pix Protein Pixie Drosophila melanogaster
Q8DQY5 3.06e-15 82 25 20 522 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 1.04e-06 55 24 5 207 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5HG41 3.1e-15 79 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q5HG41 1.58e-07 56 25 4 219 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 3.1e-15 79 27 6 229 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FYQ8 1.58e-07 56 25 4 219 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 3.1e-15 79 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q2FH58 1.58e-07 56 25 4 219 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q6GH28 3.13e-15 79 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q6GH28 3.03e-07 55 25 4 219 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q4FQ27 3.64e-15 79 33 5 186 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
O34362 3.81e-15 82 23 20 528 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 1.87e-08 61 26 7 222 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q0A9E2 4.74e-15 79 29 5 191 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1B9H9 4.89e-15 78 30 5 203 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
A1B9H9 2.4e-08 58 28 7 222 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
P0C0E2 5.27e-15 78 28 9 260 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 3.49e-13 72 29 6 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 5.27e-15 78 28 9 260 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 3.49e-13 72 29 6 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q5LUR8 6.04e-15 78 29 3 192 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P10640 6.13e-15 77 31 6 202 3 bexA ATP-binding protein BexA Haemophilus influenzae
Q8FZV2 6.16e-15 78 28 5 225 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8FZV2 1.35e-07 56 23 4 242 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q83CV2 6.36e-15 78 29 10 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83CV2 1.68e-09 62 26 9 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q1QCN2 6.82e-15 77 29 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 1.17e-08 59 27 5 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8NWT6 7.13e-15 77 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q8NWT6 1.03e-07 56 25 4 219 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 7.13e-15 77 27 6 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q6G9I1 1.03e-07 56 25 4 219 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q0BFQ0 7.9e-15 79 28 4 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFQ0 1.53e-13 75 29 6 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q4FTM3 8.4e-15 77 29 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 8.26e-10 62 27 5 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P94374 1.01e-14 78 28 6 210 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
P94374 2.36e-07 56 27 4 165 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q897I2 1.04e-14 80 23 17 417 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
A0KPH6 1.13e-14 77 28 4 192 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P16678 1.18e-14 77 29 6 224 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
P16678 2.05e-07 56 23 5 209 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q4ZLS1 1.28e-14 77 28 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZLS1 1.41e-10 65 30 6 220 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q3K9F9 1.86e-14 76 28 8 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 9.57e-09 59 26 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q6MCV4 1.9e-14 79 29 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8EB59 2.02e-14 77 31 9 216 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q6G1D9 2.13e-14 76 29 8 207 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q8KLG1 2.24e-14 78 27 4 229 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 3.48e-10 65 26 7 223 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O26236 2.62e-14 77 32 8 189 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O26236 1.12e-06 54 23 8 246 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q6CYU2 2.79e-14 77 26 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 2.95e-09 62 26 8 242 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q49WM4 2.83e-14 78 26 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6LKD4 2.93e-14 78 24 5 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6HI76 3.59e-14 79 20 17 544 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
O29527 3.66e-14 77 30 5 206 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q14Q07 4e-14 77 26 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 3.55e-08 59 27 7 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8FRX8 4.07e-14 77 27 5 236 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 1.53e-12 73 27 4 204 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q4UJW5 4.11e-14 75 24 4 190 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q81PZ8 4.8e-14 79 20 17 544 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q4KFA2 5.13e-14 75 28 5 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 5.4e-10 63 25 5 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4L5B3 6.28e-14 77 26 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
P54591 6.41e-14 75 28 7 209 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
Q8XXY9 8.01e-14 76 29 8 231 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 8.43e-10 64 25 3 211 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P45769 8.33e-14 75 26 6 220 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P45769 9.61e-07 54 22 6 233 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P33916 8.37e-14 78 21 18 542 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 8.54e-09 62 23 8 231 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 1.41e-07 58 25 9 240 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q1RGL1 9.34e-14 74 26 4 182 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 9.48e-07 53 23 5 212 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q9V2E4 9.45e-14 75 26 8 212 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2E4 4.59e-07 55 24 6 219 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q92G36 1.08e-13 74 24 4 190 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q92G36 7.73e-07 54 24 7 212 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q98DT6 1.21e-13 75 27 4 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98DT6 2.23e-08 59 26 8 230 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1BWL4 1.25e-13 75 27 3 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
Q1BWL4 2.59e-13 74 29 7 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.25e-13 75 27 3 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
A0K739 2.59e-13 74 29 7 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q1LNM0 1.33e-13 75 28 7 255 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 1.39e-10 66 29 6 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
O34946 1.39e-13 73 25 6 218 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 2.94e-10 64 22 6 220 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q51719 1.44e-13 75 30 7 219 3 None Putative ABC transporter ATP-binding protein in cobA 5'region Propionibacterium freudenreichii subsp. shermanii
Q51719 1.66e-06 53 29 7 198 3 None Putative ABC transporter ATP-binding protein in cobA 5'region Propionibacterium freudenreichii subsp. shermanii
Q48CA0 1.51e-13 74 27 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 1.14e-10 66 30 6 220 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8NSN2 1.66e-13 75 26 6 239 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 4.27e-13 74 27 5 204 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7N0N3 1.68e-13 73 29 8 214 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N0N3 1.93e-07 55 22 5 214 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8GNH6 1.74e-13 75 25 4 218 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 2.25e-08 60 26 7 227 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q1CDR0 1.81e-13 74 30 10 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDR0 8.11e-13 72 29 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.81e-13 74 30 10 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q74PI5 8.11e-13 72 29 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.81e-13 74 30 10 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1S0 8.11e-13 72 29 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q21XJ9 1.85e-13 74 29 6 230 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 6.5e-12 70 26 4 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5WCL2 1.85e-13 75 25 9 259 3 tagH Teichoic acids export ATP-binding protein TagH Shouchella clausii (strain KSM-K16)
Q8TI15 1.95e-13 74 29 7 204 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TI15 3.12e-10 65 25 6 219 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PHQ3 2.2e-13 74 28 6 205 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 5.03e-09 61 28 7 207 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q665B6 2.2e-13 74 29 9 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q665B6 1.01e-12 72 29 6 228 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
O57872 2.22e-13 73 28 9 219 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 7.81e-08 57 25 6 234 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q6F0V4 2.4e-13 75 26 6 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q884I3 2.42e-13 73 28 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 2.23e-10 64 26 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8YQ88 2.43e-13 74 31 8 234 3 alr3946 Putative ABC transporter ATP-binding protein alr3946 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YQ88 8.85e-10 63 29 10 207 3 alr3946 Putative ABC transporter ATP-binding protein alr3946 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9ZCC4 2.72e-13 73 25 3 192 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q1RK34 2.78e-13 73 29 11 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q1RK34 7.09e-07 54 27 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q0A8P9 2.81e-13 73 28 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9HT73 2.99e-13 73 29 5 212 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 2.99e-13 73 29 5 212 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q92LX3 3.32e-13 75 29 6 201 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 1.27e-10 67 24 6 232 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q5E5I1 3.76e-13 73 31 6 222 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8FJ95 3.78e-13 73 27 5 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJ95 1.17e-09 62 31 8 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q39GW5 4.02e-13 74 26 4 219 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GW5 3.55e-12 71 29 7 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q48KI4 4.15e-13 72 27 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 7.71e-10 63 25 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q21TG3 4.4e-13 72 26 5 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5WKG4 4.59e-13 72 26 4 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 6.78e-09 60 27 7 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q8R9L8 4.92e-13 75 23 12 392 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P44656 5.13e-13 72 29 7 187 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87UI3 5.72e-13 73 26 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 2.1e-10 65 30 6 220 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8U4L3 5.75e-13 72 30 9 211 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 1.28e-06 53 23 6 233 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q4KC87 5.84e-13 74 26 5 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6MU19 6.35e-13 73 23 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 4.27e-07 56 25 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2W4W1 7.01e-13 72 31 7 197 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q1M7W6 7.01e-13 73 27 5 209 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 7.51e-09 61 25 6 212 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K6Q4 7.15e-13 73 29 5 200 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SSS4 7.41e-13 73 23 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q73R11 7.7e-13 74 21 16 514 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 1.28e-11 70 26 6 239 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P57383 7.74e-13 72 24 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57383 0.000312 46 37 3 81 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q6D3A9 7.85e-13 75 21 12 394 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 3.55e-06 53 25 7 218 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1RDS4 8.06e-13 72 27 6 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
Q1RDS4 9.31e-09 60 29 6 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 8.06e-13 72 27 6 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
A1A9L0 9.31e-09 60 29 6 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q2SPI3 9.45e-13 72 29 9 204 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 5.67e-06 52 25 6 244 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q3KCC5 9.65e-13 73 26 6 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q5PCG9 1.01e-12 73 27 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 1.43e-11 69 25 9 260 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P54537 1.04e-12 71 26 7 248 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 9.64e-12 68 24 7 218 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q5WUF8 1.12e-12 71 26 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q5WUF8 2.43e-05 49 22 8 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q8DUF7 1.22e-12 73 25 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0I2Z4 1.22e-12 73 21 5 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
P08720 1.25e-12 72 27 5 209 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 1.89e-08 60 25 5 212 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q1MEG2 1.29e-12 72 29 5 201 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3IWB5 1.32e-12 71 30 7 195 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 1.37e-10 65 27 7 235 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1TXH7 1.35e-12 73 25 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q92P76 1.37e-12 72 27 6 211 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q03AH0 1.39e-12 73 24 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q55463 1.41e-12 72 28 6 195 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O86751 1.51e-12 72 29 7 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2GJA5 1.57e-12 71 22 4 207 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q2GJA5 2.09e-10 65 25 5 226 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
P57013 1.74e-12 70 27 7 217 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P57013 6.28e-09 60 25 7 221 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q830W6 1.78e-12 72 24 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q6D2F6 1.79e-12 72 24 4 213 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0AAI1 1.96e-12 71 27 7 216 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI1 3.21e-08 58 29 6 214 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 1.96e-12 71 27 7 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
P0AAI2 3.21e-08 58 29 6 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q4ZV73 1.99e-12 70 27 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 6.76e-10 63 25 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q46ZU5 2.01e-12 72 27 5 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 6.23e-09 61 27 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8E3S6 2.1e-12 73 21 20 532 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q134N9 2.15e-12 72 27 6 231 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q134N9 8.59e-09 61 25 6 206 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q88R93 2.19e-12 71 28 6 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 8.7e-09 60 28 6 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O52618 2.57e-12 72 26 6 217 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 2.03e-07 57 26 7 217 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q8Z8R5 2.66e-12 72 26 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 2.19e-10 66 25 9 260 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q9K876 2.71e-12 72 25 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 1.51e-06 54 25 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P75370 2.78e-12 70 27 8 233 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 2.78e-09 61 25 5 215 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9Z8Q8 2.81e-12 72 23 6 225 3 metN Methionine import ATP-binding protein MetN Chlamydia pneumoniae
Q1GZH6 2.97e-12 70 31 7 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1GZH6 3.84e-06 52 27 5 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1LKJ2 3.18e-12 71 29 6 202 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 1.52e-11 69 27 4 195 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3YSK9 3.19e-12 70 26 6 205 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q9EYM2 3.28e-12 70 27 6 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 3.49e-10 63 25 6 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q65S66 3.37e-12 72 21 5 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q55740 3.43e-12 70 27 8 212 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 6.33e-10 64 26 4 226 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2IN45 3.52e-12 72 30 7 209 3 phnC Phosphonates import ATP-binding protein PhnC Anaeromyxobacter dehalogenans (strain 2CP-C)
P74548 3.54e-12 72 25 4 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 0.000604 46 34 1 79 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37494 3.67e-12 69 28 6 213 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
P37494 7.31e-10 62 26 7 200 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q3YW48 3.76e-12 70 26 4 223 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 1.1e-09 63 27 6 222 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q5LBT4 3.8e-12 72 24 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5LBT4 2.83e-09 63 27 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q31VE6 3.9e-12 70 25 3 213 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 1.82e-10 65 27 6 222 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q8PY26 4.01e-12 70 27 6 206 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PY26 1.01e-08 60 25 5 214 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P33594 4.08e-12 70 26 4 223 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 1.08e-09 63 27 6 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q9RRL9 4.17e-12 69 31 7 196 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q7N3S7 4.21e-12 70 28 7 218 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3S7 1.07e-06 54 25 6 227 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q64SQ6 4.23e-12 72 24 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q64SQ6 2.86e-09 63 27 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q668Q3 4.23e-12 71 26 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJS9 4.23e-12 71 26 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 4.23e-12 71 26 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 4.23e-12 71 26 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8ZR89 4.43e-12 71 26 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 6.84e-11 67 25 9 260 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8TIW9 4.45e-12 70 28 7 214 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIW9 1.51e-11 68 28 9 239 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q88KY4 4.49e-12 69 29 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 6.89e-07 54 24 5 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3Z3I7 4.51e-12 70 27 7 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q3Z3I7 3.09e-08 58 27 7 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
A0LCH8 4.71e-12 70 32 5 189 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 5.66e-09 60 22 6 248 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9CH26 4.82e-12 72 26 7 222 3 tagH Teichoic acids export ATP-binding protein TagH Lactococcus lactis subsp. lactis (strain IL1403)
P32016 5.27e-12 69 27 7 217 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P32016 1.01e-09 62 26 7 221 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8X4L6 5.3e-12 70 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8X4L6 1.94e-10 65 27 6 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q5QU46 5.46e-12 69 27 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q32AQ1 5.6e-12 70 25 3 213 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q32AQ1 1.04e-09 63 27 6 222 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q5L222 5.78e-12 71 22 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 1.26e-09 63 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5X2Z8 5.84e-12 69 26 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q5X2Z8 1.71e-05 50 23 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q0SK28 6.04e-12 69 28 5 183 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 4.53e-07 55 27 6 220 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
O66646 6.17e-12 68 30 7 213 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q5KVK2 6.18e-12 70 28 9 221 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5KVK2 3.68e-07 56 25 6 232 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q6NJ07 6.3e-12 70 26 5 228 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 1.33e-10 67 26 3 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9HYG4 6.41e-12 70 27 6 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HYG4 1.61e-08 59 26 6 219 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q82JY6 6.5e-12 70 28 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5FUV5 6.86e-12 69 30 8 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Gluconobacter oxydans (strain 621H)
Q68Y13 6.95e-12 69 24 3 191 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4K441 7.01e-12 69 28 6 206 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 1.83e-09 62 28 5 227 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O34677 7.16e-12 69 24 7 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
O34677 4.35e-06 52 31 1 80 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
P55476 7.2e-12 70 30 9 224 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 2.7e-11 68 25 4 213 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q02QT1 7.23e-12 69 27 6 213 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02QT1 4.31e-09 61 26 6 219 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8KZQ6 7.47e-12 69 27 5 204 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8KZQ6 1.35e-08 60 28 6 227 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q0K9I2 7.55e-12 70 27 4 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 1.41e-11 69 28 6 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8DY60 7.7e-12 72 22 21 523 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q1R5D8 7.91e-12 69 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q1R5D8 3.36e-09 61 27 6 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 7.91e-12 69 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCM9 3.36e-09 61 27 6 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 7.91e-12 69 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBX8 3.36e-09 61 27 6 222 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0RT43 8.33e-12 69 31 5 170 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P94440 8.35e-12 70 25 5 213 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 5.85e-11 67 28 4 176 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P45052 9.12e-12 70 25 7 233 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45052 1.8e-09 63 26 9 232 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57S53 9.16e-12 70 26 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q57S53 5.51e-11 68 25 9 260 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q2GFZ6 9.39e-12 68 24 6 192 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q7AH43 9.39e-12 70 23 5 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q8DIA0 9.42e-12 70 27 4 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 3.58e-06 53 26 5 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8A883 9.57e-12 71 25 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A883 9.19e-09 62 27 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8XZQ4 9.75e-12 69 29 5 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZQ4 2.37e-09 62 28 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8TQ05 9.86e-12 71 23 14 396 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 2.71e-05 51 26 5 209 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q1BWI2 1.01e-11 69 27 4 209 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.54e-10 66 26 7 228 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
P75444 1.08e-11 70 25 7 215 3 MPN_334 Putative ABC transporter ATP-binding protein MPN_334 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75444 0.000189 47 26 6 171 3 MPN_334 Putative ABC transporter ATP-binding protein MPN_334 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q92L55 1.14e-11 67 31 6 189 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium meliloti (strain 1021)
P57403 1.14e-11 68 28 4 196 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5ZT78 1.21e-11 68 25 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZT78 8.55e-06 50 22 8 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0VQQ0 1.22e-11 68 27 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VQQ0 4.34e-09 60 27 10 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8PP41 1.23e-11 68 31 7 180 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q5NZT6 1.25e-11 68 26 7 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2KBP5 1.31e-11 68 25 7 223 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q57QD7 1.34e-11 68 28 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 3.29e-08 58 28 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q58488 1.37e-11 68 26 6 201 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2J3T0 1.45e-11 68 30 12 224 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q2J3T0 1.77e-05 50 24 6 218 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q0T6A8 1.49e-11 68 27 7 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q0T6A8 7.08e-08 57 27 7 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q39GT7 1.5e-11 69 26 4 214 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 3.28e-11 68 27 7 228 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q88DY1 1.7e-11 68 25 7 247 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88DY1 4.12e-11 67 29 8 226 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0SML1 1.72e-11 69 27 7 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0SML1 9.76e-09 61 26 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q13RB6 1.73e-11 70 29 6 208 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q13RB6 6.58e-08 59 24 4 220 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
P44531 1.76e-11 69 21 5 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q215F6 1.82e-11 67 29 5 187 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain BisB18)
Q49W48 1.9e-11 69 27 6 206 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P46903 1.9e-11 68 25 5 196 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
P46903 2.77e-11 67 26 7 230 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
O31427 1.94e-11 67 28 5 208 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
O31427 2.95e-06 52 23 5 213 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q7N8B9 2.02e-11 69 22 7 280 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2SVP3 2.07e-11 68 29 3 178 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 3.8e-10 65 25 6 231 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3K506 2.12e-11 68 27 6 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 1e-09 63 28 6 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q4K5Z7 2.16e-11 68 31 8 218 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K5Z7 6.2e-07 54 26 8 233 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P61482 2.3e-11 67 28 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 2.21e-08 58 28 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 2.3e-11 67 28 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 2.21e-08 58 28 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 2.3e-11 67 28 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 2.21e-08 58 28 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q13ZK7 2.37e-11 69 27 3 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q13ZK7 1.04e-09 64 28 5 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q1R155 2.39e-11 67 30 3 190 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3SQ65 2.44e-11 68 28 9 225 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3SQ65 9.35e-08 57 27 9 236 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P44513 2.52e-11 69 26 5 219 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44513 1.8e-05 51 27 8 231 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FV85 2.56e-11 69 23 4 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 3.99e-09 62 26 6 232 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.56e-11 69 23 4 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 3.99e-09 62 26 6 232 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.56e-11 69 23 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 3.99e-09 62 26 6 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.56e-11 69 23 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 3.99e-09 62 26 6 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
D4GP39 2.59e-11 69 26 4 215 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8K9M6 2.6e-11 67 28 4 194 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P77622 2.89e-11 68 25 5 204 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P77622 2e-08 60 28 5 208 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q8T9W4 2.95e-11 70 25 9 266 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
O28437 3.02e-11 67 27 5 207 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28437 1.86e-07 56 24 5 235 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1GL85 3.17e-11 67 27 6 205 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q8YDJ8 3.2e-11 68 27 4 174 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q110U3 3.29e-11 68 26 6 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q9WXX8 3.32e-11 67 29 5 168 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 1.3e-10 65 27 7 194 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q97JB8 3.35e-11 67 26 7 218 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 1.13e-10 66 24 5 232 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q15TB1 3.37e-11 67 28 8 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q15TB1 1.56e-09 62 25 5 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q66A01 3.48e-11 67 33 10 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 3.48e-11 67 33 10 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
A1B9K8 3.5e-11 67 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 1.67e-07 56 26 6 196 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
P9WQM1 3.53e-11 68 28 7 221 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 2.57e-08 60 27 5 227 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.53e-11 68 28 7 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 2.57e-08 60 27 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.53e-11 68 28 7 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 2.57e-08 60 27 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5E284 3.64e-11 67 31 5 201 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8KF76 3.87e-11 67 26 6 204 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KF76 1.49e-07 56 28 9 212 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q12ES3 3.95e-11 66 27 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q12ES3 0.000746 45 28 7 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3JSQ0 3.97e-11 68 28 4 190 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 3.25e-10 65 26 7 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 3.97e-11 68 28 4 190 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 3.25e-10 65 26 7 228 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 4.01e-11 68 28 4 190 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 3.66e-10 65 26 7 228 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
P35116 4.04e-11 67 26 10 236 3 nocP Nopaline permease ATP-binding protein P Agrobacterium fabrum (strain C58 / ATCC 33970)
P35116 6.52e-09 60 23 6 228 3 nocP Nopaline permease ATP-binding protein P Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2SXD1 4.12e-11 67 28 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SXD1 2.27e-10 65 26 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7A169 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 4.18e-11 68 27 5 225 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 4.18e-11 68 27 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
P0A2U7 4.33e-11 67 25 6 212 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U7 3.66e-06 52 21 6 218 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 4.33e-11 67 25 6 212 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0A2U6 3.66e-06 52 21 6 218 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A1JJ55 4.44e-11 69 26 6 227 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JJ55 6.27e-05 49 24 4 213 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O34900 4.47e-11 67 23 6 248 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
O34900 3.88e-08 58 22 6 218 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q97KZ3 4.59e-11 67 26 6 200 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KZ3 6.17e-08 57 22 7 222 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q669P3 4.76e-11 66 28 8 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5PB72 4.83e-11 67 24 6 206 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q82B58 5.03e-11 69 27 5 216 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q50801 5.07e-11 67 30 8 199 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q50801 1.06e-06 54 26 6 209 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q0SZJ3 5.3e-11 67 25 3 213 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q0SZJ3 5.14e-09 61 27 6 222 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q93SH7 5.4e-11 67 31 8 212 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 1.05e-09 63 27 7 243 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3ATY5 5.48e-11 66 25 7 228 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q9HT70 5.53e-11 68 25 9 268 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT70 2.16e-07 57 27 8 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 5.53e-11 68 25 9 268 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK6 2.16e-07 57 27 8 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7NX01 5.55e-11 68 25 6 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 5.59e-09 62 26 6 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2NHA1 5.71e-11 67 28 6 199 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q47C66 5.75e-11 66 29 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q47C66 3.32e-07 55 27 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q49VI3 5.9e-11 67 22 8 269 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DZJ0 6.04e-11 68 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 6.04e-11 68 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 6.04e-11 68 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1CI46 6.19e-11 66 28 8 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 6.19e-11 66 28 8 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 6.19e-11 66 28 8 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
P37009 6.32e-11 67 23 5 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q9HPH7 6.65e-11 66 25 6 210 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q4QP85 6.87e-11 67 26 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4QP85 5.62e-05 49 26 8 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q576K0 7.44e-11 67 27 4 174 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 7.44e-11 67 27 4 174 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
P31134 7.46e-11 68 26 5 204 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q8RD07 7.87e-11 66 26 8 215 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 7.48e-10 63 26 5 225 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9X196 7.88e-11 67 26 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q3J7S3 8.01e-11 65 28 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3J7S3 0.000474 45 27 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q4JTG9 8.02e-11 67 26 4 201 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q4JTG9 2.46e-07 57 22 4 239 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q3B276 8.17e-11 66 27 7 206 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3B276 7.69e-08 57 26 6 207 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q21BU8 8.28e-11 67 25 6 229 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q21BU8 8.46e-10 64 27 8 229 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q7NIW1 8.65e-11 67 26 7 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9Z3I3 9.23e-11 67 23 6 296 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q39EV3 9.32e-11 66 26 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q73GK9 9.33e-11 66 24 4 206 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q57293 9.48e-11 67 20 6 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q13LD8 1.05e-10 67 27 5 200 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q13LD8 3.32e-10 65 25 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q6NA00 1.06e-10 66 26 10 279 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NA00 2.6e-10 65 25 7 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q66EN1 1.08e-10 65 28 10 237 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CMQ3 1.09e-10 65 27 9 237 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 1.09e-10 65 27 9 237 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 1.09e-10 65 27 9 237 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q1BHS6 1.1e-10 65 26 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q63SP4 1.12e-10 65 27 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q63SP4 1.7e-10 65 26 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 1.12e-10 65 27 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q62J04 1.7e-10 65 26 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q63TW1 1.12e-10 67 25 4 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q63TW1 8.49e-09 61 26 6 235 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q8TIX0 1.14e-10 67 28 9 223 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q2SJY7 1.16e-10 67 22 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q9CJB8 1.18e-10 68 26 9 280 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9CJB8 3.93e-08 60 27 7 221 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q31J97 1.18e-10 65 27 6 224 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31J97 1.37e-05 50 24 8 236 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5V6B8 1.19e-10 66 28 6 212 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V6B8 1.04e-09 63 29 6 192 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q55BC0 1.23e-10 68 29 5 196 3 abcA8 ABC transporter A family member 8 Dictyostelium discoideum
Q8Z0H0 1.25e-10 67 28 9 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 2.17e-08 60 23 7 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5M397 1.25e-10 67 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q0P9C4 1.26e-10 68 25 9 230 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q03JH1 1.28e-10 67 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LYN4 1.28e-10 67 23 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q88ZJ6 1.28e-10 67 23 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6D5H7 1.33e-10 67 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D5H7 1.53e-08 60 25 6 232 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q00564 1.34e-10 68 26 9 280 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q00564 8.85e-09 62 28 7 220 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q3M5J9 1.36e-10 65 27 6 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 2.24e-09 62 26 6 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O34392 1.39e-10 65 25 6 200 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 1.48e-07 56 24 5 200 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q0SIB7 1.39e-10 66 26 6 228 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q0SIB7 4.18e-06 52 26 8 232 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q8Y8T6 1.41e-10 67 21 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P72335 1.43e-10 66 26 4 213 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 1.3e-09 63 26 7 216 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q9STT5 1.43e-10 68 28 6 204 3 ABCA7 ABC transporter A family member 7 Arabidopsis thaliana
Q9STT5 0.000151 48 22 4 201 3 ABCA7 ABC transporter A family member 7 Arabidopsis thaliana
Q2NTI7 1.45e-10 65 26 4 191 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q83J77 1.46e-10 65 25 4 223 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q83J77 5.38e-09 61 27 6 222 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q8U8D6 1.47e-10 65 27 5 201 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U8D6 6e-06 52 24 5 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P15361 1.54e-10 65 23 6 220 3 None Probable ABC transporter ATP-binding protein p29 Mesomycoplasma hyorhinis
P15361 7.34e-06 51 21 7 236 3 None Probable ABC transporter ATP-binding protein p29 Mesomycoplasma hyorhinis
Q62K56 1.58e-10 66 25 4 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q62K56 7.81e-09 61 26 6 235 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q2Y624 1.59e-10 65 27 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q6G2E2 1.64e-10 66 25 8 233 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6G2E2 6.22e-10 64 26 6 219 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6D201 1.76e-10 66 24 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 3.89e-09 62 26 6 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4L4R9 1.76e-10 66 23 5 205 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q4L4R9 6.36e-07 55 22 9 272 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q1QDA8 1.83e-10 67 26 11 280 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QDA8 0.000466 47 26 6 185 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8XIZ5 1.84e-10 66 23 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.84e-10 66 23 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3JSR6 1.84e-10 66 25 4 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q3JSR6 7.88e-09 61 26 6 235 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q8FVN0 1.84e-10 65 26 6 222 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13865
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 3078650 - 3080581 (strand: 1)
Length 1932 (nucleotides) / 643 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1693
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06158 ATP-binding cassette, subfamily F, member 3 - -

Protein Sequence

MIVFSSLQIRRGVRVLLDNASATINPGQKIGLVGKNGCGKTTLLSLLKGDLQAEAGNVTFPSTWSMAWVNQETPALDVPAIDYVIDGDREYRELERRLQQANDNNDGHAIALIHGQLDAINAWTIQSRAATLLNGLGFSQQQLTEPVKSFSGGWRMRLNLAQALICRSDLLLLDEPTNHLDLDAVIWLEKWLKSYNGTLILISHDRDFLDPIVDKILHIEQEKIFEYSGNYSSFEMQRATKLAQQQALFENQQAKIAHLQSFIDRFKAKATKAKQAQSRVKMLERMERVAPAHSDNPFQFSFRQPESLPNPLLSMEKVSAGYGDKIILNNIKLNLIPGSRIGLLGRNGAGKSTLIKLLAGELAPLQGKVALSKGIKLGYFAQHQLEYLRADESALQHLTRLAPQETEQKLRDYLGGFGFHGDKVTDACGQFSGGEKARLVLSLLVWQRPNLLLMDEPTNHLDLDMRQALTQALISFEGAIVVVSHDRHLLRSTTDDLYLVHDGQVEPFEGDLDDYQQWLVDQNRQETQANKTQPDQETTNVSNLTAQDKKEQKRKEAEFRQQTQPLRKKLTTLESKMDKLSQELTAIETELSDSQIYEAKNKATLTDCLSRQSIAKSALEEVEMAWMELQEKLEEMTNAFESQ

Flanking regions ( +/- flanking 50bp)

GAACAACTTACTCTATATATTAATTTACATACTCTTAATAGACGACATTTATGATTGTTTTTTCTTCTTTGCAAATTCGCCGCGGTGTCAGGGTATTACTTGATAATGCCAGCGCAACGATTAATCCAGGACAAAAGATTGGTCTTGTGGGTAAAAATGGCTGTGGCAAAACCACACTGCTCTCTTTATTAAAAGGGGATCTACAAGCTGAAGCGGGTAATGTGACATTTCCTAGCACTTGGTCAATGGCATGGGTAAATCAAGAGACACCCGCTTTAGACGTTCCTGCCATTGATTATGTTATTGATGGTGATAGAGAATACCGCGAATTGGAGCGTCGTCTACAACAGGCGAACGACAATAACGATGGTCATGCTATTGCCCTGATCCACGGCCAACTCGATGCTATTAATGCGTGGACTATCCAATCACGTGCAGCCACATTACTTAATGGCTTGGGATTCAGCCAACAACAACTCACTGAGCCAGTAAAATCATTTTCTGGTGGTTGGCGAATGCGCTTAAACTTAGCACAGGCACTAATTTGTCGTTCTGATCTATTACTACTTGATGAACCGACTAACCACTTAGATTTAGATGCGGTAATTTGGCTAGAAAAATGGCTAAAAAGTTATAATGGTACGTTGATTTTAATTTCCCACGACCGAGATTTTCTTGATCCGATTGTGGATAAAATCTTACATATTGAACAAGAGAAAATATTTGAATATTCAGGTAACTACTCTTCGTTTGAAATGCAACGTGCAACAAAATTGGCACAACAACAAGCACTCTTTGAAAATCAGCAAGCAAAAATTGCCCATTTACAAAGTTTTATTGACCGCTTTAAGGCGAAAGCAACTAAAGCCAAACAGGCACAAAGCCGTGTCAAAATGCTTGAACGTATGGAGCGAGTGGCGCCTGCGCACTCAGATAACCCGTTCCAGTTTAGTTTTCGCCAACCAGAAAGCTTACCAAATCCGCTTCTGTCTATGGAAAAAGTCAGTGCCGGTTACGGTGATAAGATTATCCTTAATAACATCAAACTTAACTTAATTCCCGGCTCACGAATTGGGCTCTTAGGCCGTAATGGTGCAGGTAAATCTACATTAATTAAGCTGTTAGCTGGAGAATTAGCTCCACTACAAGGAAAGGTTGCCCTTTCCAAAGGGATCAAATTAGGTTATTTCGCCCAGCATCAGCTGGAATATTTACGTGCCGATGAATCTGCATTACAACATTTAACTCGTTTAGCGCCACAAGAGACTGAGCAAAAATTACGTGATTATCTAGGAGGGTTTGGTTTCCATGGTGATAAAGTCACCGATGCATGTGGCCAATTTTCTGGTGGTGAAAAAGCACGTTTAGTTTTATCGCTACTGGTTTGGCAACGCCCAAATTTACTACTAATGGATGAACCAACCAACCACCTTGATTTAGATATGCGACAAGCATTAACACAAGCGCTAATTAGCTTTGAAGGTGCGATTGTTGTGGTATCCCATGACAGGCATTTATTACGCTCAACCACAGACGATTTATATCTCGTCCATGACGGTCAAGTAGAGCCATTTGAAGGCGATCTTGATGATTATCAGCAGTGGTTAGTTGATCAAAATCGCCAAGAGACTCAAGCTAATAAAACGCAACCCGATCAAGAAACAACAAACGTCTCTAACTTAACGGCTCAAGATAAAAAAGAGCAAAAGCGTAAAGAGGCGGAGTTTAGACAACAAACTCAACCTTTGCGCAAAAAGCTAACCACATTAGAAAGTAAAATGGATAAGCTTAGCCAAGAGCTGACCGCCATCGAAACTGAGCTTTCTGATAGTCAAATTTATGAAGCGAAGAACAAGGCGACGCTTACCGATTGCTTAAGCCGTCAAAGTATTGCCAAATCGGCTTTAGAAGAAGTTGAGATGGCGTGGATGGAATTACAAGAAAAACTAGAAGAGATGACCAACGCTTTTGAGTCTCAATAACTATTTTTCATTAATGCCTAAAAAGGAACTATTAAAATAATATAGTTCCT