Homologs in group_307

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11800 FBDBKF_11800 90.7 Morganella morganii S1 uup ABC transporter ATP-binding protein
EHELCC_14505 EHELCC_14505 90.7 Morganella morganii S2 uup ABC transporter ATP-binding protein
NLDBIP_15600 NLDBIP_15600 90.7 Morganella morganii S4 uup ABC transporter ATP-binding protein
LHKJJB_15010 LHKJJB_15010 90.7 Morganella morganii S3 uup ABC transporter ATP-binding protein
HKOGLL_19275 HKOGLL_19275 90.7 Morganella morganii S5 uup ABC transporter ATP-binding protein
PMI_RS13865 PMI_RS13865 75.6 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein
PMI_RS17345 PMI_RS17345 30.5 Proteus mirabilis HI4320 - 50S ribosome-binding GTPase

Distribution of the homologs in the orthogroup group_307

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_307

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P63389 0.0 1038 78 1 636 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
A0A0H2VBH0 0.0 1038 78 1 636 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63390 0.0 1038 78 1 636 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P44808 0.0 844 65 2 643 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8H0V6 4.42e-121 379 36 6 545 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 4.43e-12 72 33 0 120 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q66H39 1.58e-118 372 38 7 532 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q8K268 5.2e-118 370 37 6 530 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 1.02e-117 370 37 6 530 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q5R9Z5 1.04e-117 370 37 6 530 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
P43535 8.01e-110 350 35 8 542 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O05519 4.36e-104 332 33 11 639 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 6.95e-30 128 29 7 317 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
Q9FJH6 1.89e-102 327 35 5 525 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 2.22e-18 92 26 7 304 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
O59672 2.37e-102 330 35 6 540 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 6.35e-102 326 34 9 533 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8SRV5 1.37e-96 310 36 8 504 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 1.66e-15 83 29 6 211 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
P40024 1.38e-96 311 34 9 542 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 1.59e-10 67 25 4 217 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UG63 2.15e-96 311 35 7 514 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 2.03e-09 64 24 4 261 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9M1H3 2.91e-96 314 34 11 555 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 5.04e-19 95 28 3 255 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q99LE6 1.2e-95 310 35 7 514 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 1.78e-09 64 24 4 261 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q8T6B4 4.73e-95 320 34 8 535 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 6.64e-16 85 25 7 312 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B7 1.29e-92 301 33 7 525 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 5.48e-15 82 25 2 232 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q2KJA2 1.65e-92 301 35 7 514 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 7.67e-10 65 25 4 261 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
P0A9U3 3.86e-92 298 32 8 528 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 3.86e-92 298 32 8 528 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 3.86e-92 298 32 8 528 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q8NE71 8.46e-84 284 35 8 525 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.54e-13 77 26 5 244 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 3.14e-07 57 26 2 117 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q767L0 3.22e-83 281 35 8 525 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 2.79e-13 77 25 8 304 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 3.28e-07 57 26 2 117 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q7YR37 4.53e-83 281 35 8 525 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 8.73e-13 75 27 6 244 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 3.31e-07 57 26 2 117 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q6MG08 4.68e-81 276 35 9 524 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 7.56e-14 79 27 6 244 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 3.79e-07 57 26 2 117 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
O31716 9.03e-80 265 32 9 507 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.51e-26 117 28 3 248 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.83e-18 92 25 5 227 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q9LV93 2.52e-79 268 33 10 527 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 6.42e-11 69 26 4 247 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q6P542 1.03e-78 270 34 8 525 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 8.23e-14 78 27 5 244 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 8.32e-07 56 26 2 117 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
O34512 2.15e-77 258 32 5 486 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 7.16e-24 109 26 4 270 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 4.49e-17 88 31 2 182 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q9FIB4 2.41e-75 257 32 10 524 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 6.18e-13 75 26 4 247 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
O06476 3.44e-71 245 31 13 523 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 1.06e-21 103 29 5 255 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
A0A0H2VFI8 3.76e-68 235 31 14 538 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 1.54e-22 105 31 3 232 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 1.12e-67 234 31 14 538 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.3e-22 105 31 3 232 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 1.12e-67 234 31 14 538 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.3e-22 105 31 3 232 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 1.12e-67 234 31 14 538 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.3e-22 105 31 3 232 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
Q9USH9 1.18e-67 239 29 9 521 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1.62e-10 68 25 4 216 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P45127 1.65e-66 231 31 14 542 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 4.35e-22 103 31 5 258 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 2.08e-65 230 28 16 643 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 6.33e-17 88 32 5 243 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 1.68e-15 84 30 7 239 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQK3 5.35e-64 224 30 12 545 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 5.35e-64 224 30 12 545 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P43672 1.15e-62 222 27 16 642 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
Q8K9I3 3.44e-61 217 28 12 520 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 1.89e-17 89 25 6 283 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57445 7.07e-61 216 28 11 547 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 8.73e-12 72 23 3 226 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P39115 2.32e-59 211 28 13 539 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 8.36e-22 103 30 3 207 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P0DX93 5.99e-53 192 28 14 533 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.24e-19 94 30 7 246 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P25256 3.14e-50 186 30 14 527 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 8.07e-20 97 32 5 247 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
D0MYB4 3.42e-41 164 31 11 391 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.73e-15 84 29 6 214 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 2.97e-11 70 29 1 152 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 4.83e-06 53 32 0 74 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
Q08972 2.65e-40 162 30 10 397 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.18e-17 89 31 5 197 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.6e-10 68 26 1 142 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 5.48e-06 53 31 0 82 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O14134 5.96e-40 160 29 11 408 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.21e-14 81 32 7 218 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.32e-10 68 33 2 104 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 2.6e-07 57 34 0 76 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23212 2.6e-39 154 27 14 500 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 9.28e-16 84 26 6 267 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 1.24e-15 83 28 3 214 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P12622 3e-38 146 34 2 239 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 2.18e-06 53 42 0 59 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 5.82e-06 52 33 1 103 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
O94489 7.81e-35 145 29 14 394 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 8.04e-14 79 26 5 201 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.97e-13 77 33 3 137 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 5.71e-09 63 32 2 124 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93796 1.4e-34 144 28 13 391 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.53e-17 90 31 6 210 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 6.27e-16 85 35 2 117 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 4.98e-08 60 32 2 124 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P53978 1.47e-34 144 28 12 392 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.36e-16 87 31 12 270 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 8.41e-16 85 38 1 101 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.1e-08 62 33 2 115 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29551 2.02e-34 144 29 12 384 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 8.4e-15 82 31 4 161 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.53e-13 77 27 5 211 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.01e-06 55 31 0 85 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q45978 3.18e-33 138 25 14 643 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 2.67e-21 102 32 3 220 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P25997 4.05e-33 139 29 15 394 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 9.51e-16 85 39 1 101 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 2.27e-15 84 29 7 209 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 2.27e-07 58 38 0 70 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q75EV6 5.09e-33 139 28 14 395 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.6e-16 87 31 2 155 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 9.01e-16 85 31 7 202 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.44e-08 60 35 0 87 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P16521 2.33e-32 137 28 14 397 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.06e-16 85 35 2 117 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.54e-14 81 28 4 200 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.77e-08 59 33 2 124 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45167 1.03e-31 132 25 12 469 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 9.43e-18 90 32 5 243 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87RE5 2.48e-24 106 34 4 196 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LTB1 1.89e-22 100 32 4 197 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 4.91e-08 58 24 8 260 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
A1JRI2 2.32e-21 97 31 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 1.36e-11 68 25 7 258 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7MMN0 2.42e-21 97 32 5 196 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 2.42e-21 97 32 5 196 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q832R5 2.87e-21 101 27 24 519 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8TQW9 3.46e-21 101 24 22 558 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9KQB8 4.41e-21 96 33 4 192 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1CJG3 1.27e-20 95 32 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.25e-12 71 26 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 1.27e-20 95 32 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.25e-12 71 26 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 1.27e-20 95 32 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.25e-12 71 26 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 1.56e-20 95 32 4 192 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 1.83e-12 71 26 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8Z5W6 1.59e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 3.79e-09 61 23 7 268 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q32HA3 1.98e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 2.43e-09 62 24 7 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q5PIA5 1.98e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 1.05e-08 60 23 7 268 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.98e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 1.05e-08 60 23 7 268 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q72D73 2.04e-20 95 32 5 221 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 2.09e-07 56 32 5 200 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8ZNV7 2.39e-20 94 32 3 190 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 5.39e-09 60 23 7 268 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3Z2L6 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.44e-20 94 32 3 190 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 4e-09 61 24 8 268 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.44e-20 94 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 4e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q0VTB6 3.95e-20 94 32 7 207 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 3.62e-06 52 25 7 227 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q88RL1 4.63e-20 93 31 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4KKK4 6.06e-20 93 32 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 3.07e-07 55 25 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6LQ00 8.83e-20 97 25 22 528 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 6.31e-08 59 25 5 201 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q8XK20 1.06e-19 96 24 18 528 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q5E6M2 1.1e-19 92 33 7 195 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 2.93e-08 58 25 5 212 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3KKA1 1.59e-19 92 32 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 9.22e-08 57 25 7 228 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q6YRJ4 1.84e-19 96 25 19 526 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 3.62e-07 57 25 8 218 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q83KR7 2.62e-19 91 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 2.62e-19 91 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q7N545 3.7e-19 90 32 3 192 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 4.99e-09 61 25 8 257 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q87UN0 4.34e-19 90 31 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q73P93 4.62e-19 94 24 20 538 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q1IGY7 6.79e-19 90 30 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q31I51 1.27e-18 89 31 7 209 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 5.25e-08 58 24 6 229 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4ZZS2 1.41e-18 89 30 6 216 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q0I4A9 1.47e-18 89 30 4 203 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q8LPJ4 1.55e-18 93 24 21 523 2 ABCE2 ABC transporter E family member 2 Arabidopsis thaliana
Q48PV0 2.9e-18 88 31 6 197 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6D4A8 3.03e-18 88 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 1.86e-09 62 24 6 268 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q58129 3.81e-18 92 24 22 498 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q160Y9 8.04e-18 87 27 4 197 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 2.8e-09 62 28 6 232 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q81V82 8.12e-18 87 29 4 216 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q81V82 1.08e-05 51 25 7 230 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
A1U776 1.12e-17 86 30 4 194 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4QND5 2.26e-17 85 27 3 197 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q6GDC0 2.49e-17 89 24 24 542 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
P44692 3.8e-17 85 27 3 195 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0A9E2 5.77e-17 84 28 6 222 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WXT0 5.99e-17 84 28 5 214 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 3.67e-08 58 24 5 251 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
P96605 7.16e-17 85 30 8 224 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
P96605 2.73e-08 59 27 6 181 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q2YXZ0 7.23e-17 83 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YXZ0 5.49e-07 54 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q21PQ7 1e-16 84 29 7 206 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9HT73 1.12e-16 84 29 6 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.12e-16 84 29 6 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HZL7 1.19e-16 82 31 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.71e-12 70 30 7 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88ZZ2 1.33e-16 87 26 19 513 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 4.36e-08 60 28 6 210 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q926D8 1.35e-16 83 27 5 233 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 1.26e-11 68 26 7 226 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0KPH6 2.14e-16 82 29 6 197 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7A5Q9 2.35e-16 82 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 2.35e-16 82 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q97SA3 2.55e-16 86 24 17 517 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 7.75e-06 52 24 5 207 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 0.000897 46 25 8 220 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9XDA6 2.82e-16 82 26 5 231 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 9.34e-12 69 25 7 226 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5HG41 2.84e-16 82 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q5HG41 4.27e-07 55 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 2.84e-16 82 28 7 228 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FYQ8 4.27e-07 55 25 4 208 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 2.84e-16 82 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q2FH58 4.27e-07 55 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q6GH28 2.95e-16 82 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q6GH28 3.72e-07 55 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q65UG3 3.63e-16 82 27 3 195 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87G35 3.81e-16 85 24 19 525 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6FFL0 3.84e-16 82 35 5 180 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 8.65e-11 66 26 4 209 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q74I62 3.85e-16 85 23 20 518 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q93D97 3.93e-16 85 25 24 524 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 9.47e-07 55 25 5 209 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O86751 3.96e-16 84 30 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8NWT6 7.4e-16 80 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q8NWT6 3.39e-07 55 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 7.4e-16 80 28 7 228 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q6G9I1 3.39e-07 55 25 4 208 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q7VLS9 7.64e-16 81 30 3 194 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1Q889 7.96e-16 80 31 5 185 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 6.16e-09 60 26 4 209 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FQ27 9.89e-16 80 31 5 185 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 1.62e-08 59 25 4 209 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P0A9U2 9.96e-16 84 25 18 523 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 9.96e-16 84 25 18 523 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q4ZLS1 1.75e-15 80 28 5 223 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZLS1 8.88e-11 66 32 6 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q83CV2 2.64e-15 79 29 8 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83CV2 8.49e-10 63 27 7 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5HQ70 3.01e-15 81 26 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34946 3.1e-15 79 28 6 213 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 2.27e-11 67 23 4 216 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34362 3.14e-15 82 24 20 523 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q8U4L3 4.39e-15 79 32 9 211 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 1.2e-06 53 26 7 224 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q1CDR0 4.81e-15 79 32 10 260 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDR0 2.12e-13 74 29 5 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 4.81e-15 79 32 10 260 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q74PI5 2.12e-13 74 29 5 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 4.81e-15 79 32 10 260 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1S0 2.12e-13 74 29 5 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q2W4W1 4.94e-15 79 31 6 196 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9CP24 4.97e-15 79 28 3 194 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q8PUE7 5.19e-15 81 25 8 237 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8XZQ4 5.84e-15 79 30 6 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZQ4 1.16e-11 69 31 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8DQY5 6.72e-15 81 24 17 517 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 2.16e-05 51 24 5 207 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 0.000446 47 25 8 220 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q1BWL4 6.82e-15 79 30 5 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
Q1BWL4 4.81e-12 71 32 8 224 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 6.82e-15 79 30 5 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
A0K739 4.81e-12 71 32 8 224 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q1QCN2 6.95e-15 77 29 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 8.74e-10 62 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6G4Q8 7.22e-15 77 28 6 206 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6G4Q8 0.000752 45 26 7 217 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q665B6 7.39e-15 78 32 10 260 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q665B6 2.14e-13 74 29 5 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q97WT4 7.65e-15 81 22 17 522 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O26236 8e-15 79 34 8 191 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P10640 8.23e-15 77 28 6 221 3 bexA ATP-binding protein BexA Haemophilus influenzae
Q48CA0 9.2e-15 78 27 5 223 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 8.25e-11 66 32 6 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4K441 1.06e-14 78 30 6 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 3.38e-10 64 31 6 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5LUR8 1.19e-14 77 30 5 203 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O29527 1.25e-14 78 30 5 206 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q82JY6 1.28e-14 79 30 8 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 6.81e-05 49 27 7 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9V2E4 1.32e-14 77 29 8 212 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q4FTM3 1.32e-14 77 29 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 6.47e-11 66 30 7 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q897I2 1.35e-14 80 23 16 417 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q6CYU2 1.4e-14 77 27 5 231 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 3.83e-10 64 29 10 251 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8CPN0 1.54e-14 79 26 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O57872 1.55e-14 77 29 8 218 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 3.88e-08 58 28 8 208 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q7N0N3 1.92e-14 76 30 6 209 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N0N3 2.4e-08 58 27 5 188 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8FJ95 2.1e-14 77 29 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJ95 1.32e-10 65 29 11 259 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q28VN1 2.17e-14 76 27 4 198 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 3.07e-09 61 27 6 225 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q9VSS1 2.21e-14 80 24 23 498 1 pix Protein Pixie Drosophila melanogaster
Q97X60 2.21e-14 79 23 19 525 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q1RDS4 2.28e-14 77 30 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
Q1RDS4 1.09e-09 63 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 2.28e-14 77 30 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
A1A9L0 1.09e-09 63 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q8XXY9 2.44e-14 78 30 9 230 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 6.2e-10 64 26 6 216 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q4UJW5 2.46e-14 76 23 4 198 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0BFQ0 2.48e-14 77 30 4 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFQ0 3.01e-12 71 32 8 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q39GW5 2.48e-14 77 30 4 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GW5 3.15e-11 68 29 6 226 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8NSN2 2.75e-14 78 28 5 207 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 1.53e-13 76 27 5 228 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2K0S7 3.02e-14 79 22 17 529 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 5.6e-05 50 27 8 218 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q81PZ8 3.13e-14 79 21 15 528 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q49WM4 3.39e-14 78 25 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q92P76 3.48e-14 77 28 5 210 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q87UI3 3.57e-14 76 27 5 222 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 3.18e-10 64 31 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q02R79 3.58e-14 78 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 8.35e-10 64 30 6 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3KCC5 3.86e-14 77 28 6 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 4.15e-05 50 28 7 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q9HY19 3.92e-14 77 28 5 221 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 8.27e-10 64 30 6 202 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88KY4 4.09e-14 75 30 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 8.98e-08 57 27 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3K506 4.18e-14 76 30 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 4.66e-11 67 31 9 258 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q8YQ88 4.2e-14 76 28 5 225 3 alr3946 Putative ABC transporter ATP-binding protein alr3946 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YQ88 7.68e-09 60 30 8 203 3 alr3946 Putative ABC transporter ATP-binding protein alr3946 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NN36 4.55e-14 76 29 7 224 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NN36 3.47e-07 55 31 6 193 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0A8P9 4.76e-14 75 30 7 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A8P9 9.86e-08 57 27 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9ZCC4 5.01e-14 75 24 5 195 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q58488 5.86e-14 76 28 5 201 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q659V4 6.32e-14 75 30 7 229 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q659V4 0.000151 47 42 0 54 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q3YSK9 6.37e-14 75 28 6 196 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q5L222 6.54e-14 77 25 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q6HG98 6.75e-14 78 26 19 530 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 0.000187 48 28 5 225 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5WCL2 6.77e-14 77 27 4 213 3 tagH Teichoic acids export ATP-binding protein TagH Shouchella clausii (strain KSM-K16)
Q21XJ9 7.57e-14 75 30 6 226 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 3.86e-13 73 28 4 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q92G36 7.66e-14 75 24 6 199 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8GNH6 7.72e-14 76 30 3 183 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 6.59e-08 58 27 7 227 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
P57403 1.01e-13 74 28 3 195 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8R9L8 1.09e-13 77 25 24 540 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q65S66 1.24e-13 76 23 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P0AAI1 1.3e-13 74 28 6 216 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI1 2.89e-07 55 29 10 248 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 1.3e-13 74 28 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
P0AAI2 2.89e-07 55 29 10 248 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q81N53 1.38e-13 77 25 18 518 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 0.00047 47 28 5 225 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q5E284 1.46e-13 74 32 6 201 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4KFA2 1.5e-13 73 29 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 7.98e-12 68 30 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2GJA5 1.53e-13 74 23 5 207 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q88R93 1.59e-13 74 29 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 3.59e-10 64 30 8 250 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1RGL1 1.68e-13 73 25 6 194 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
P0C0E2 1.75e-13 73 28 7 232 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 3.06e-12 70 27 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 1.75e-13 73 28 7 232 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 3.06e-12 70 27 5 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q8KZQ6 1.85e-13 74 29 6 222 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8KZQ6 2.9e-10 65 30 8 257 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q64SQ6 1.87e-13 76 25 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 1.96e-13 76 25 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q0TJC1 1.98e-13 74 28 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJC1 2.55e-09 62 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2SPI3 2.25e-13 73 30 6 199 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q668Q3 2.49e-13 75 28 7 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJS9 2.52e-13 75 28 7 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.52e-13 75 28 7 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.52e-13 75 28 7 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8ES39 2.74e-13 76 24 21 517 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 1.33e-08 61 25 6 252 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4L5B3 2.78e-13 75 26 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q4L5B3 5.48e-06 52 26 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q3SQ65 2.96e-13 73 30 8 225 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3SQ65 0.000183 47 26 7 231 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q98DT6 3.1e-13 73 28 4 197 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98DT6 1.04e-08 60 27 5 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7N3S7 3.2e-13 73 30 7 221 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3S7 1.13e-06 53 24 7 230 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 3.33e-13 75 25 5 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 4.38e-08 59 26 6 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q13ZK7 3.53e-13 74 31 4 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q13ZK7 9.8e-09 61 30 7 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q2GFZ6 3.57e-13 73 25 6 200 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q6LKD4 3.72e-13 74 24 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 3.05e-06 53 25 5 186 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q46ZU5 3.79e-13 73 30 5 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 8.97e-09 60 28 10 264 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LNM0 3.84e-13 73 30 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 6.31e-11 67 33 6 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q02QT1 3.98e-13 73 30 6 213 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02QT1 1.04e-09 63 29 10 252 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7AH43 4.11e-13 74 23 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q734T1 4.18e-13 75 27 15 424 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q734T1 0.000191 48 28 5 225 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q70GD4 4.38e-13 73 30 7 229 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q70GD4 0.000187 47 42 0 54 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
P57013 4.53e-13 72 27 6 210 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P57013 1.35e-06 53 24 8 223 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q66A01 4.63e-13 73 33 8 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 4.63e-13 73 33 8 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
Q8FRX8 4.64e-13 74 26 4 230 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 5.21e-13 74 27 5 209 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9HYG4 4.84e-13 73 30 6 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HYG4 2.03e-09 62 29 10 252 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1RK34 4.96e-13 72 29 11 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q1RK34 1.91e-05 49 27 8 179 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q8UCM5 5e-13 73 29 7 227 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UCM5 2.29e-09 62 29 9 233 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3Z3I7 5.1e-13 72 28 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q3Z3I7 2.36e-08 58 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q68Y13 5.16e-13 72 24 5 194 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5E5I1 5.31e-13 72 30 7 225 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0RT43 5.38e-13 73 31 4 174 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
O28437 5.77e-13 72 29 4 187 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28437 3.94e-07 55 25 3 224 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6G1D9 6.01e-13 72 26 6 206 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q8KLG1 6.51e-13 73 30 5 208 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 1.06e-09 63 27 6 223 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q92LX3 7.3e-13 73 28 4 201 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 7.71e-09 61 25 7 232 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q8TIW9 7.55e-13 72 27 8 244 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIW9 9.18e-12 69 27 7 225 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5HBR8 8.41e-13 72 24 4 191 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 8.41e-13 72 24 4 191 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
P36638 8.62e-13 72 26 5 220 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3ICT8 8.65e-13 72 31 10 229 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
Q3ICT8 4.95e-05 48 24 9 239 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
Q4KC87 8.94e-13 73 28 5 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6NJ07 9.52e-13 73 27 5 234 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 8.78e-11 67 28 8 223 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
O52618 1.05e-12 73 26 7 279 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 8.23e-07 55 26 7 227 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
P77622 1.1e-12 72 26 6 201 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P77622 4.23e-10 65 29 5 198 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q49VI3 1.12e-12 72 25 6 240 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8TIX0 1.14e-12 73 30 5 200 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P0AAI0 1.35e-12 72 26 5 220 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 1.35e-12 72 26 5 220 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 1.35e-12 72 26 5 220 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5FQN4 1.36e-12 70 32 7 188 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q5FQN4 7.96e-05 47 26 7 204 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
P32016 1.37e-12 70 27 6 210 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P32016 2.23e-07 55 24 8 223 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4ZV73 1.39e-12 71 27 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 4.11e-11 66 29 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q21JQ9 1.43e-12 71 27 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q73GK9 1.43e-12 71 27 5 206 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q884I3 1.47e-12 70 29 6 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 5.05e-11 66 29 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q83LN2 1.5e-12 71 28 6 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q83LN2 5.52e-08 57 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q0T6A8 1.52e-12 71 28 6 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q0T6A8 5.78e-08 57 28 9 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q0K9I2 1.67e-12 72 30 4 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 3.55e-12 71 30 6 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3K9F9 1.71e-12 70 29 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 8.48e-11 65 29 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q9X1Z1 1.77e-12 71 29 8 236 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X1Z1 3.55e-05 49 25 9 217 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8K9M6 1.89e-12 70 30 3 188 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5WUF8 2.19e-12 70 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q5WUF8 1.22e-07 56 25 10 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q48KI4 2.34e-12 70 28 7 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 5.1e-11 66 29 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q93SH7 2.38e-12 71 31 7 212 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 1.31e-07 57 30 9 231 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1B9K8 2.56e-12 70 28 4 191 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q0BWF7 2.6e-12 69 31 6 181 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hyphomonas neptunium (strain ATCC 15444)
Q0BWF7 3.61e-08 57 28 6 215 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hyphomonas neptunium (strain ATCC 15444)
Q1M5X4 2.86e-12 73 21 17 528 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 4.44e-06 53 27 6 216 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5GRS1 2.87e-12 70 25 4 198 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
A0LCH8 2.92e-12 70 32 5 189 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A1B9H9 3.31e-12 70 26 3 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
A1B9H9 2.16e-07 55 27 8 237 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q0SK28 3.34e-12 70 30 4 172 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 1.6e-08 59 29 6 220 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q88DY1 3.64e-12 70 30 8 222 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88DY1 6.25e-12 69 28 7 244 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8YDJ8 3.9e-12 70 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8CTM4 4.09e-12 70 26 6 217 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CTM4 9.2e-06 51 24 8 206 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR97 4.09e-12 70 26 6 217 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HR97 9.2e-06 51 24 8 206 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7NIW1 4.25e-12 71 28 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
O27739 4.28e-12 71 28 6 200 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q1QE80 4.46e-12 72 28 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P54592 4.57e-12 70 27 5 209 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
Q8Y8T6 4.59e-12 71 23 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q0VQQ0 5.16e-12 69 31 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VQQ0 1.95e-08 58 25 8 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8EB59 5.27e-12 69 30 9 219 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2K6Q4 5.29e-12 70 29 5 201 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q47MA5 5.5e-12 70 28 7 249 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q47MA5 4.31e-05 49 28 3 172 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
P75370 5.67e-12 69 26 9 235 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 1.52e-11 68 26 5 208 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q88ZJ6 5.81e-12 71 24 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 3.54e-06 53 25 5 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8PP41 5.82e-12 69 29 7 186 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q8PP41 1.34e-09 62 29 6 223 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
O32188 5.92e-12 70 27 7 222 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q8RD07 6.22e-12 69 28 10 217 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 5e-08 57 27 6 211 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O83590 6.32e-12 69 29 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
O83590 6.68e-07 54 24 9 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema pallidum (strain Nichols)
Q2RQQ0 6.48e-12 69 34 6 189 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RQQ0 9.35e-07 53 29 7 177 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8TI15 6.78e-12 70 28 7 208 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q21TG3 6.8e-12 68 26 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q63TW1 6.88e-12 70 30 8 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q63TW1 5.6e-08 58 30 7 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
A0AGP9 6.95e-12 71 23 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q62K56 6.99e-12 70 28 9 241 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q62K56 6.59e-08 58 30 7 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q2RU16 7.21e-12 68 27 9 225 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RU16 7.45e-05 48 30 3 179 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q215F6 8.11e-12 68 31 11 213 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain BisB18)
Q215F6 0.000683 45 26 3 173 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain BisB18)
P94440 8.2e-12 70 25 4 217 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 1.23e-10 66 27 4 196 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q1R155 8.53e-12 68 30 3 190 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 5.26e-05 48 24 4 232 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P9WQM1 8.7e-12 70 29 7 214 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 4.92e-08 58 29 8 231 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 8.7e-12 70 29 7 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 4.92e-08 58 29 8 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 8.7e-12 70 29 7 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 4.92e-08 58 29 8 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1M7W6 8.82e-12 70 31 5 185 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.12e-08 60 26 6 217 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P31134 8.93e-12 70 27 6 225 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 3.17e-10 65 32 7 199 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q576K0 9.17e-12 70 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 9.17e-12 70 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q8PYH5 9.46e-12 70 29 5 200 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q3IWB5 9.81e-12 68 30 6 190 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 2.69e-10 64 29 5 237 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q132E8 9.86e-12 69 28 8 236 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q132E8 9.26e-08 57 26 8 238 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q3JSR6 9.87e-12 70 30 8 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q3JSR6 7.46e-08 58 30 7 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
P70970 9.98e-12 69 27 6 209 3 ecfAB Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus subtilis (strain 168)
Q5PB72 1.02e-11 68 24 6 226 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q722B1 1.02e-11 70 22 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8FV85 1.02e-11 70 25 5 227 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 1.88e-08 60 26 7 224 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.02e-11 70 25 5 227 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 1.88e-08 60 26 7 224 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.02e-11 70 25 5 227 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 1.88e-08 60 26 7 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.02e-11 70 25 5 227 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 1.88e-08 60 26 7 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q81LM1 1.04e-11 69 28 9 228 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q81LM1 3.15e-06 52 28 6 197 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q5X2Z8 1.11e-11 68 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q5X2Z8 8.68e-07 53 25 9 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
P57032 1.12e-11 68 27 5 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
P57032 3.59e-08 58 30 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
Q8FVN0 1.15e-11 69 25 7 227 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q8FVN0 6.92e-06 51 25 4 223 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
A0LUE6 1.15e-11 70 27 9 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
P08720 1.17e-11 69 31 5 185 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 2.5e-08 59 26 6 217 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q0SML1 1.19e-11 70 28 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0SML1 3.93e-08 59 25 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q5KVK2 1.2e-11 70 26 7 220 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5KVK2 1.04e-07 58 27 6 240 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q03AH0 1.21e-11 70 24 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8Z0H0 1.25e-11 70 29 7 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 5.07e-07 55 27 6 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2SI12 1.25e-11 68 32 4 191 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q1MEG2 1.25e-11 69 28 5 201 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6FFZ1 1.26e-11 68 30 8 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFZ1 2e-06 53 27 8 245 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9Z8Q8 1.28e-11 70 23 6 231 3 metN Methionine import ATP-binding protein MetN Chlamydia pneumoniae
Q97EK9 1.28e-11 69 26 7 230 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97EK9 1.68e-09 62 24 9 267 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P54537 1.31e-11 68 24 8 240 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 1.43e-11 68 27 8 248 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8ELR4 1.33e-11 70 21 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q50801 1.34e-11 69 31 8 201 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q4L4R9 1.35e-11 70 25 6 221 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q4L4R9 1.51e-05 51 23 7 232 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q57S53 1.35e-11 70 26 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q57S53 1.39e-09 63 29 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P55476 1.36e-11 70 31 6 214 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 1.09e-09 63 28 6 216 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q58429 1.37e-11 68 27 9 222 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5PCG9 1.39e-11 69 26 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 1.92e-10 66 29 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P74548 1.46e-11 70 26 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9CJB8 1.47e-11 71 29 4 186 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9CJB8 1.12e-07 58 27 7 221 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q2SVN0 1.51e-11 69 28 7 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVN0 2.13e-06 53 29 7 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8PHQ3 1.52e-11 69 25 4 205 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 2.79e-08 59 30 7 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q55740 1.55e-11 68 24 6 216 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 6.25e-09 61 28 5 212 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P10091 1.59e-11 70 28 6 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
P10091 4.41e-07 56 25 5 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q8YCG3 1.63e-11 69 26 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3M5J9 1.64e-11 68 28 6 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 5.32e-08 58 28 7 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DG84 1.65e-11 68 30 8 239 3 tll2439 Putative ABC transporter ATP-binding protein tll2439 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2RKA7 1.78e-11 70 21 16 542 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 1.04e-07 58 24 5 219 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
Q7AKE5 1.84e-11 70 31 6 221 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7AKE5 9.61e-06 52 29 6 207 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6D2F6 1.86e-11 69 27 6 215 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8YCN7 1.88e-11 68 25 7 227 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YCN7 4.6e-06 52 25 4 223 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 1.88e-11 68 25 7 227 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q578S7 4.6e-06 52 25 4 223 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 1.88e-11 68 25 7 227 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q2YL69 4.6e-06 52 25 4 223 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q5WKG4 1.93e-11 68 24 4 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 1.32e-10 65 28 8 248 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q9EYM2 1.97e-11 67 27 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 2.73e-07 55 25 7 241 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8Z8R5 2e-11 69 26 9 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 2.54e-09 62 29 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q92DL6 2.01e-11 69 22 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8ZR89 2.02e-11 69 26 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 1.04e-09 64 29 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04FM1 2.02e-11 68 26 3 202 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04FM1 9.03e-07 54 26 4 199 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q97JB8 2.17e-11 68 28 6 210 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 5.45e-08 58 27 6 205 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q47087 2.18e-11 68 30 5 213 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q47087 6.19e-07 55 27 8 227 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
P76027 2.19e-11 69 28 7 213 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P76027 4.78e-09 62 26 8 227 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
Q00564 2.21e-11 70 28 4 186 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q00564 4.95e-08 60 29 5 193 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q13ZJ1 2.23e-11 68 30 3 184 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 1.34e-09 63 28 6 207 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q4L884 2.25e-11 68 24 4 205 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q4L884 9.54e-07 54 26 4 196 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q578K3 2.28e-11 69 26 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 2.28e-11 69 26 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q5HQQ9 2.28e-11 69 26 7 221 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q928L8 2.39e-11 69 25 10 323 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q82VL9 2.4e-11 67 29 7 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82VL9 1.08e-07 56 28 6 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5ZT78 2.43e-11 67 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZT78 3.34e-08 58 25 10 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8CTB2 2.59e-11 68 26 7 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1LKJ2 2.6e-11 68 30 6 198 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 1.22e-10 66 27 4 195 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P04285 2.63e-11 68 27 6 214 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P04285 7.46e-09 61 26 8 227 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45052 2.67e-11 68 24 5 238 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45052 4.24e-09 62 26 9 235 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92CK1 2.69e-11 68 29 10 268 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92CK1 4.33e-08 58 28 9 218 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9RRL9 2.7e-11 67 31 8 196 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9RRL9 0.000126 47 26 4 189 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2SXD1 2.81e-11 67 28 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SXD1 7.91e-09 60 26 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9K876 2.86e-11 68 27 5 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 0.000797 45 24 6 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P46903 2.98e-11 67 25 5 228 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
P46903 2.46e-09 62 25 6 199 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
O31339 3.04e-11 68 27 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 2.78e-06 53 25 6 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5MZ53 3.08e-11 68 27 7 214 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 3.08e-11 68 27 7 214 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q87EF4 3.48e-11 67 26 5 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87EF4 7.34e-09 60 30 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P45769 3.53e-11 67 25 6 219 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q2NHA1 3.57e-11 67 29 6 201 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q88HL0 3.62e-11 67 29 5 204 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88HL0 2.22e-08 59 26 3 221 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q39EV3 3.63e-11 67 31 8 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39EV3 3.63e-09 61 27 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0SFW6 3.76e-11 68 24 6 233 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q0SFW6 4e-10 65 25 7 271 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q8FUU5 3.91e-11 68 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q8Y4L8 4e-11 68 25 10 323 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P97027 4.52e-11 67 29 4 171 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q9TKX3 4.73e-11 68 27 6 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 7.72e-08 58 29 6 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8UH62 4.79e-11 68 29 7 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 1.04e-06 55 25 5 209 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P42246 4.96e-11 67 29 6 207 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 4.71e-09 62 25 4 205 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q63SP4 5.06e-11 67 29 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q63SP4 6.69e-09 60 26 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 5.06e-11 67 29 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q62J04 6.69e-09 60 26 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q8FVV5 5.08e-11 68 25 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q03JH1 5.1e-11 68 25 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9HPH7 5.12e-11 66 28 10 215 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9HPH7 1.49e-07 56 28 8 240 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q2SVP3 5.13e-11 67 30 3 175 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 5.13e-10 64 28 5 207 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P57383 5.14e-11 66 23 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5LYN4 5.38e-11 68 25 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q6D201 5.51e-11 67 24 8 268 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 3.01e-08 59 28 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q82MV1 5.61e-11 67 28 6 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82MV1 3.67e-08 58 26 8 248 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q720M2 5.61e-11 67 29 10 268 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q720M2 2.28e-09 62 28 9 226 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
G0SEV9 5.71e-11 69 29 7 194 3 RLI1 Translation initiation factor RLI1 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q5M397 5.77e-11 68 25 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8T9W4 6e-11 69 28 9 242 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q07LU3 6.13e-11 67 31 8 218 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q07LU3 4.95e-05 49 24 11 273 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q5FUV5 6.26e-11 66 29 11 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Gluconobacter oxydans (strain 621H)
Q9HT70 6.27e-11 67 27 5 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT70 9.95e-09 61 28 8 212 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 6.27e-11 67 27 5 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK6 9.95e-09 61 28 8 212 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8Y7R4 6.32e-11 67 29 9 237 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y7R4 7.09e-09 60 28 9 226 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O66646 6.76e-11 66 29 7 212 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q9KLQ5 6.93e-11 67 23 5 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q49W48 6.93e-11 67 24 6 221 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49W48 1.18e-05 51 24 6 241 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q830W6 7.02e-11 67 22 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q15TB1 7.03e-11 66 27 5 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q15TB1 1.11e-08 59 26 8 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q20Y31 7.2e-11 67 26 6 230 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q20Y31 3.74e-09 61 25 8 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q13RB6 7.3e-11 68 30 7 208 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q13RB6 2.36e-08 60 25 5 221 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
P37494 7.69e-11 65 28 8 222 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
P37494 2.88e-10 63 25 5 195 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q8UF79 7.72e-11 67 27 4 183 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5E882 7.76e-11 66 33 7 172 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
P94374 7.76e-11 67 27 6 210 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
P94374 1.42e-07 57 27 3 165 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q6F9P2 7.94e-11 67 29 8 203 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9P2 2.15e-07 57 25 6 231 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q13LD8 8.12e-11 67 25 7 239 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q13LD8 1.16e-08 61 27 6 214 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q3ATY5 8.18e-11 66 25 7 228 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q3ATY5 4.38e-07 55 27 6 210 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
P14788 8.34e-11 67 25 5 225 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 2.34e-06 53 27 5 204 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q71X09 8.71e-11 67 25 10 323 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q2Y624 8.78e-11 65 29 7 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A0R6H7 8.99e-11 68 27 9 248 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8DIA0 9e-11 67 26 5 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 1.74e-06 54 27 5 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2K8C8 9.12e-11 67 26 6 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1QLB0 9.16e-11 65 31 10 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1QLB0 5.41e-05 48 26 8 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A3DJK5 9.47e-11 66 27 4 203 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3YW48 9.78e-11 66 26 6 215 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 8.13e-10 63 28 7 229 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q9LSJ6 9.83e-11 68 28 8 207 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 0.000184 48 29 6 179 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q7VMV4 9.89e-11 65 27 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KXJ6 1.02e-10 68 30 6 195 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KXJ6 2.52e-07 57 32 5 203 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4K5Z7 1.04e-10 66 30 9 218 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K5Z7 7.55e-08 57 29 9 233 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P55339 1.06e-10 65 27 8 237 1 ecsA ABC-type transporter ATP-binding protein EcsA Bacillus subtilis (strain 168)
Q2RS22 1.06e-10 66 28 7 252 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RS22 1.08e-09 63 24 6 253 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q6LX68 1.09e-10 66 27 6 202 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q31VE6 1.11e-10 66 29 6 218 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 1.19e-10 66 26 5 207 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q3J7S3 1.12e-10 65 27 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3J7S3 0.00067 45 30 8 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5QU46 1.13e-10 65 27 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 1.45e-05 50 26 8 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q63TX3 1.16e-10 66 30 3 175 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 3.37e-10 65 28 5 207 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q3JSQ0 1.19e-10 66 30 3 175 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 3.56e-10 65 28 5 207 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 1.19e-10 66 30 3 175 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 3.56e-10 65 28 5 207 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q1GL85 1.22e-10 65 27 6 205 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 4.16e-05 49 25 8 214 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q5PFQ7 1.23e-10 67 25 6 219 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P33594 1.23e-10 66 26 5 207 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 7.34e-10 63 29 6 218 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q81GU1 1.25e-10 67 27 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GU1 3.96e-06 53 25 6 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8R7Y5 1.36e-10 66 25 5 221 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2J3T0 1.42e-10 65 29 9 220 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q8P8V9 1.44e-10 65 28 7 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8P8V9 5.68e-10 63 26 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV71 1.44e-10 65 28 7 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q4UV71 5.68e-10 63 26 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q8Z8W8 1.44e-10 67 25 6 219 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q4JTG9 1.47e-10 67 28 6 204 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q4JTG9 8.56e-07 55 23 4 239 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q55463 1.55e-10 65 27 6 195 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55463 1.01e-08 60 28 8 204 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1BHS6 1.55e-10 65 30 8 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q1BHS6 4.3e-09 61 27 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q65P76 1.55e-10 66 28 6 194 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14855
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 205854 - 207785 (strand: -1)
Length 1932 (nucleotides) / 643 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000004
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_307
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06158 ATP-binding cassette, subfamily F, member 3 - -

Protein Sequence

MIVFSSLQVRRGVRVLLDNATATINPGHKVGLVGKNGCGKSTLLALLKGELQAEAGSVTFPGNWSLAWVNQETPALDVPAIDYVIDGDREFRALEAKLHQANEQNDGHEIALIHGQLDTLDAWTVRARAATLLSGLGFSQEQLETPVRAFSGGWRMRLNLAQALICRSDLLLLDEPTNHLDLDAVIWLEKWLKSYPGTLILISHDRDFLDPIIDKVLHIEQDTMFEYTGNYSSFELQRAEKMSQQQAQYESQQLRRAHLQHYVDRFRAQATKAKQAQSRIKMLERMEKIAPALVDNPFHFSFRPPETLPNPLLKMEKVTAGYGEKIILDAIKLNLVPGSRIGLLGRNGAGKSTLIKMLAGELKPLHGEIGLAKGIKLGYFAQHQLEFLRADESPLQHMVRLAPEKTEQQLRDYLGGFGYKGDQVTDVTARFSGGEKARLVLAMIVWQRPNLLLLDEPTNHLDLDMRQALTEALIEFEGAIVVVSHDRHLLRSTTDDLYLVHDGQVEQFDGDLDDYQRWLSGSQKQQRQATETAIGDNDEEKTTVTAQDRKEQKRREAEFRQQTQPLRKQSEKLEKTMSRLSDAIAAVEEKLSDSGLYEQARKAELTTCLQEQAQLKAELEETEMAWMEIQENLEAMTQALENP

Flanking regions ( +/- flanking 50bp)

CGCACGAATTACATTAATTTTACTCTCAATTGCGTACCCTATCGATATTTATGATTGTTTTCTCTTCACTTCAAGTCCGCCGCGGAGTCCGGGTTTTACTCGATAACGCAACGGCTACCATCAATCCCGGACACAAAGTCGGATTAGTGGGAAAAAATGGTTGCGGTAAATCCACCCTGCTGGCACTGCTGAAAGGCGAATTGCAGGCAGAAGCCGGCAGTGTAACCTTCCCCGGCAACTGGTCACTGGCCTGGGTTAACCAGGAAACACCGGCTCTGGATGTCCCGGCGATTGATTATGTGATTGACGGGGATCGTGAATTCCGCGCACTGGAAGCAAAACTGCATCAGGCAAATGAACAAAATGATGGTCATGAGATTGCCCTGATCCACGGTCAGCTCGATACGCTGGACGCCTGGACTGTCCGCGCACGCGCAGCCACGCTGCTCAGCGGACTGGGTTTTTCACAGGAACAGCTCGAAACCCCTGTCCGCGCATTCTCGGGCGGCTGGCGGATGCGTCTGAACCTGGCACAGGCACTTATCTGCCGCTCTGATCTGCTGCTGCTGGATGAACCCACCAACCACCTGGATCTCGATGCTGTGATCTGGCTGGAAAAATGGCTGAAGAGTTATCCCGGCACCTTGATTCTTATCTCTCATGACCGTGATTTCCTTGACCCGATTATCGATAAAGTCCTGCATATTGAGCAGGATACAATGTTCGAATATACCGGAAACTACTCCTCATTTGAATTGCAGCGCGCTGAAAAAATGTCCCAGCAGCAGGCTCAATATGAGAGCCAGCAACTGCGCCGCGCACATCTGCAACACTATGTGGATCGTTTCCGCGCACAGGCAACAAAAGCCAAGCAGGCACAAAGCCGGATAAAAATGCTGGAGCGGATGGAAAAAATCGCGCCCGCGCTGGTGGATAACCCATTTCATTTCAGCTTCCGCCCGCCGGAAACTCTGCCAAATCCATTGCTGAAGATGGAAAAAGTCACCGCCGGGTATGGTGAAAAAATTATTCTCGATGCCATTAAGCTCAACCTGGTGCCCGGCTCACGCATTGGTCTGCTGGGGCGCAACGGCGCAGGTAAATCCACGCTGATAAAAATGCTGGCAGGGGAATTAAAACCACTGCACGGTGAAATCGGGCTGGCGAAAGGCATTAAGCTCGGCTACTTCGCACAACATCAGCTGGAATTCTTACGTGCAGATGAATCCCCGCTGCAACACATGGTGCGCCTCGCACCGGAAAAAACAGAACAGCAATTGCGGGATTACCTCGGCGGCTTCGGATACAAAGGCGACCAGGTGACTGATGTTACCGCCCGTTTCTCCGGCGGTGAAAAAGCGCGCCTGGTACTGGCAATGATTGTCTGGCAGCGCCCGAACCTGTTGCTGCTCGATGAACCGACCAACCACCTGGACCTGGATATGCGCCAGGCTCTGACAGAAGCGCTGATCGAATTTGAAGGTGCGATCGTGGTGGTTTCCCATGATCGTCATTTACTGCGCTCAACAACAGATGATCTCTATCTGGTCCATGATGGTCAGGTCGAACAGTTTGACGGCGATCTGGATGATTACCAACGCTGGCTGTCCGGCAGCCAAAAGCAACAGCGCCAGGCAACAGAAACTGCAATCGGTGATAATGACGAAGAGAAAACCACGGTCACCGCGCAAGATCGTAAAGAACAAAAACGCCGCGAAGCGGAGTTTCGTCAGCAGACTCAGCCACTGCGCAAACAATCAGAGAAACTGGAAAAAACAATGAGCCGGTTATCTGATGCCATTGCAGCGGTTGAAGAAAAACTCAGCGACAGCGGGTTGTATGAACAGGCGCGCAAAGCTGAACTGACAACCTGTCTTCAGGAACAGGCGCAGCTCAAAGCTGAACTCGAAGAAACAGAAATGGCGTGGATGGAGATACAGGAAAACCTCGAGGCCATGACGCAGGCATTAGAAAACCCGTAAATTATCTCAGGCGGTACAATCATGTACCGCCTCTTTTATCAACCATCCAG