Homologs in group_1693

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11800 FBDBKF_11800 100.0 Morganella morganii S1 uup ABC transporter ATP-binding protein
EHELCC_14505 EHELCC_14505 100.0 Morganella morganii S2 uup ABC transporter ATP-binding protein
NLDBIP_15600 NLDBIP_15600 100.0 Morganella morganii S4 uup ABC transporter ATP-binding protein
LHKJJB_15010 LHKJJB_15010 100.0 Morganella morganii S3 uup ABC transporter ATP-binding protein
F4V73_RS14855 F4V73_RS14855 90.7 Morganella psychrotolerans - ABC transporter ATP-binding protein
PMI_RS13865 PMI_RS13865 76.5 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1693

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1693

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P63389 0.0 1056 79 1 635 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 0.0 1056 79 1 635 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 0.0 1055 79 1 635 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44808 0.0 848 67 5 643 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8H0V6 3.17e-123 384 37 7 545 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 1.71e-11 71 30 0 140 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8K268 9.47e-118 370 37 6 537 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 8.87e-117 367 37 6 537 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q5R9Z5 1.26e-116 367 37 6 537 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q66H39 2.39e-116 366 37 6 537 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
P43535 2.96e-109 349 36 9 546 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9FJH6 1.74e-105 334 36 5 525 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
O59672 3.31e-104 335 34 6 543 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O05519 1.85e-102 328 32 10 638 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 9.36e-31 131 32 5 246 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O42943 4.79e-102 326 34 8 523 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UG63 3.65e-100 322 36 6 512 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 4.9e-09 63 23 2 251 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q99LE6 2.13e-99 320 36 6 512 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 4.33e-09 63 23 2 251 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9M1H3 3.81e-99 322 35 11 555 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 1.79e-21 102 29 2 255 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
P40024 9.36e-99 317 34 8 541 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 3.42e-10 66 24 3 223 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8SRV5 6.96e-97 311 36 8 505 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 4.57e-17 88 29 4 207 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q2KJA2 1.27e-96 312 36 6 512 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 1.71e-09 64 24 3 261 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q8T6B7 7.57e-96 309 34 8 528 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B4 7.34e-95 319 33 7 535 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 2.91e-17 90 25 7 299 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
P0A9U3 8.62e-93 299 33 8 528 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 7.05e-24 109 29 5 264 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 8.62e-93 299 33 8 528 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 7.05e-24 109 29 5 264 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 8.62e-93 299 33 8 528 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 7.05e-24 109 29 5 264 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
O31716 7.36e-86 281 33 12 545 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q767L0 7.57e-84 283 36 7 519 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 8.77e-15 81 26 6 303 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 2.13e-07 58 25 6 237 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q8NE71 7.29e-83 281 36 7 519 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 6.57e-15 82 25 3 293 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.92e-07 58 25 6 238 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 1.64e-82 280 36 7 519 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 3.05e-14 80 25 3 293 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.81e-07 58 25 6 237 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q6MG08 3.09e-81 276 36 7 519 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 7.77e-15 82 26 2 244 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 2.59e-07 57 25 6 237 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q9LV93 6.99e-81 272 33 7 522 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 8.62e-12 72 26 3 247 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
O34512 2.97e-79 263 32 4 486 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 4.97e-26 115 26 4 293 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 5.63e-18 91 32 3 182 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q6P542 4.12e-78 268 35 7 519 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 8.14e-14 78 26 5 254 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 3.47e-08 60 25 6 237 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q9FIB4 1.49e-76 261 31 10 573 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 2.55e-14 80 27 4 248 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
P0A9W5 9.4e-73 247 32 13 537 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 2.79e-22 104 30 2 232 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 9.4e-73 247 32 13 537 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 2.79e-22 104 30 2 232 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 9.4e-73 247 32 13 537 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 2.79e-22 104 30 2 232 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
A0A0H2VFI8 1.09e-72 247 32 13 537 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 3.39e-22 104 30 2 232 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O06476 1.43e-71 246 32 15 525 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 2.7e-22 105 28 3 254 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q9USH9 5.69e-70 246 30 8 520 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 7.26e-17 88 27 5 247 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 9.92e-10 65 24 4 216 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P45127 1.11e-69 239 32 15 540 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 6.83e-22 103 30 4 257 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 6.65e-69 239 28 14 645 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 9.88e-18 90 32 6 256 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 5.53e-17 88 29 4 229 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQK3 7.09e-68 234 31 12 543 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 7.09e-68 234 31 12 543 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P43672 2.52e-63 224 26 13 640 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 2e-13 77 26 4 242 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P39115 4.54e-61 216 28 14 539 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 2.82e-22 104 28 5 281 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q8K9I3 9.14e-58 207 28 12 520 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 4.08e-17 88 27 2 220 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0DX93 3.46e-57 204 29 14 532 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 1.34e-18 92 32 6 246 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P25256 3.27e-55 200 32 13 519 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 7.83e-20 97 32 5 245 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P57445 2.34e-51 190 28 13 516 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 5.83e-13 75 22 4 289 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
D0MYB4 5.75e-42 167 30 9 400 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.04e-18 94 30 4 209 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.05e-10 68 35 1 99 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 5.07e-06 53 32 0 74 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O14134 8e-42 166 30 12 414 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 9.98e-14 78 32 5 187 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.73e-10 68 34 2 100 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 3.36e-07 57 34 0 76 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23212 9.79e-41 158 26 13 502 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 1.75e-16 86 27 8 267 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 1.25e-15 83 27 5 214 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
Q08972 1.74e-40 162 30 11 397 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 2.65e-20 99 32 7 240 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.98e-10 66 36 0 77 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 8.74e-06 52 36 0 65 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12622 2.1e-40 152 35 2 239 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 4.86e-08 58 31 2 134 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.13e-05 51 38 0 59 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
Q45978 3.38e-38 153 25 11 642 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 3.26e-20 98 33 4 209 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P29551 3.05e-35 146 29 13 385 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.63e-14 80 35 1 101 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 3.65e-14 80 29 7 203 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 4e-07 57 34 1 84 3 TEF3 Elongation factor 3 Pneumocystis carinii
O93796 3.14e-35 146 28 12 391 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 5.06e-17 89 30 6 212 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.4e-16 87 37 1 103 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.28e-07 58 34 0 87 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P53978 3.13e-34 143 27 11 402 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 7.27e-17 88 35 3 136 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 7.23e-16 85 30 7 210 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 3.49e-08 60 41 0 70 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O94489 6.98e-34 142 27 11 396 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 9.22e-15 82 26 5 209 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.1e-13 77 42 0 77 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.42e-08 61 34 1 84 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P45167 9.9e-34 137 26 11 469 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 2.98e-18 91 33 6 254 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25997 1.01e-33 141 27 11 397 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.11e-16 88 39 1 103 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 8.92e-16 85 29 8 215 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.91e-07 58 38 0 70 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q75EV6 1.74e-33 140 29 14 392 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.8e-16 86 37 1 103 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.59e-15 84 30 7 204 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 6.99e-08 59 35 1 84 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P16521 4.41e-33 139 27 11 397 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.44e-16 87 38 1 103 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.32e-14 80 27 4 202 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.5e-07 57 34 0 87 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q87RE5 9.39e-27 113 36 4 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KQB8 1.38e-22 101 35 4 192 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1JRI2 2.31e-22 100 32 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 3.67e-14 76 27 7 258 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8TQW9 2.71e-22 104 25 21 532 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q1CJG3 3.8e-22 99 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.64e-15 80 27 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 3.8e-22 99 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.64e-15 80 27 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 3.8e-22 99 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.64e-15 80 27 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 4.51e-22 99 33 4 191 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 2.37e-15 79 27 7 268 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8Z5W6 8.76e-22 98 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 7.17e-12 69 25 8 268 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q5E6M2 9.09e-22 98 34 6 195 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 3.66e-09 61 24 5 244 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q32HA3 9.82e-22 98 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 1.39e-10 65 25 7 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q5PIA5 1.01e-21 98 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 6.06e-12 69 25 8 271 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.01e-21 98 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 6.06e-12 69 25 8 271 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8ZNV7 1.06e-21 98 33 3 190 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 2.86e-12 70 25 8 271 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7MMN0 1.31e-21 98 32 4 194 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 8.49e-09 60 23 4 226 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 1.31e-21 98 32 4 194 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 8.49e-09 60 23 4 226 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q3Z2L6 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.41e-21 97 33 3 190 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 3.08e-10 64 24 8 268 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.41e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 3.08e-10 64 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q926D8 1.47e-21 98 30 7 241 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 4.26e-12 70 26 7 226 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7N545 2.17e-21 97 33 3 190 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 2.13e-10 65 26 8 257 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6LTB1 2.88e-21 97 32 4 197 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 6.88e-09 60 22 6 257 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q9XDA6 3.87e-21 96 29 7 239 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 8.53e-13 72 26 7 226 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q832R5 5.47e-21 100 25 22 536 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 3.69e-09 63 26 8 205 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q83KR7 1.45e-20 95 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 3.41e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.45e-20 95 32 3 190 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 3.41e-09 61 24 8 268 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0VTB6 1.84e-20 94 34 8 208 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 7.44e-07 54 25 7 228 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4KKK4 3.39e-20 94 32 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 1.07e-08 60 25 7 245 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8PUE7 4.51e-20 97 23 14 427 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 6.61e-09 62 25 8 260 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q87UN0 5e-20 93 32 6 197 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 1.15e-07 57 25 7 242 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88RL1 5.54e-20 93 31 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93D97 6.71e-20 97 26 24 524 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q88ZZ2 9.03e-20 97 25 18 521 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 6.82e-09 62 27 7 212 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q48PV0 1.15e-19 92 32 6 197 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 3.15e-08 58 25 7 242 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3KKA1 1.18e-19 92 32 7 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 4.93e-09 61 25 6 245 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q0I4A9 1.21e-19 92 31 4 203 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q72D73 1.51e-19 92 32 6 219 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 1.36e-09 63 32 5 197 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8XK20 2.85e-19 95 23 17 528 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 1.45e-07 58 25 6 214 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q1IGY7 2.97e-19 91 31 6 198 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 5.75e-07 55 24 6 227 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q160Y9 3.17e-19 91 28 4 197 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6D4A8 4.37e-19 90 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 4.89e-11 67 25 7 271 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4ZZS2 7.16e-19 90 31 5 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 7.12e-08 57 24 7 242 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q8G838 9.56e-19 94 23 20 528 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 5.14e-08 60 28 7 222 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q31I51 1.1e-18 89 31 7 209 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.56e-07 56 23 5 227 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q89AJ0 1.19e-18 89 28 4 198 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 1.56e-09 62 24 6 242 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q65UG3 1.2e-18 89 28 3 194 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UG3 1.92e-05 50 24 7 257 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q73P93 1.74e-18 92 23 18 513 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P44692 2.78e-18 88 28 3 195 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VLS9 3.6e-18 88 30 3 194 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1WXT0 3.61e-18 88 28 5 218 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 3.63e-08 58 26 6 231 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q4QND5 4.06e-18 88 27 3 197 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q58129 1.16e-17 90 23 23 500 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6GDC0 1.26e-17 90 23 24 542 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
Q8LPJ4 1.36e-17 90 24 21 506 2 ABCE2 ABC transporter E family member 2 Arabidopsis thaliana
Q21PQ7 1.59e-17 86 30 7 206 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0A9E2 3.4e-17 85 29 7 221 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 4.26e-10 64 28 6 221 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q81CT8 3.52e-17 89 23 17 535 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P96605 4.09e-17 86 29 8 224 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
P96605 1.64e-08 60 27 11 269 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q6FFL0 4.26e-17 85 35 5 180 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 2.18e-11 68 26 6 246 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q83CV2 5.75e-17 84 29 8 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83CV2 2.86e-10 64 27 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O34362 5.98e-17 88 24 16 525 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q9HZL7 6.17e-17 84 31 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.74e-12 70 29 6 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q97SA3 6.34e-17 88 24 16 516 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 7.44e-07 55 25 5 210 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4FQ27 6.52e-17 84 33 6 189 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 3.65e-07 55 25 5 206 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2K0S7 6.89e-17 87 23 15 528 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 8.93e-06 52 28 8 218 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A0KPH6 8.37e-17 84 29 6 197 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1U776 8.5e-17 84 30 3 194 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1U776 5.45e-06 52 25 6 248 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9CP24 1.03e-16 84 29 3 194 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
O26236 1.98e-16 83 35 8 191 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q74I62 2.41e-16 86 24 19 515 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q1Q889 2.86e-16 82 32 5 185 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 1.89e-07 56 26 5 206 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8DQY5 3.06e-16 85 25 19 518 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 2.52e-06 54 25 5 210 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8FZV2 3.18e-16 82 31 4 214 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8FZV2 3.77e-06 52 24 7 240 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q5LUR8 3.96e-16 82 30 5 203 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q97WT4 5.4e-16 85 21 15 522 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q2YQP3 5.71e-16 81 30 5 218 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q2YQP3 4.37e-06 52 24 7 240 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q57CD8 5.71e-16 81 30 5 218 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q57CD8 4.37e-06 52 24 7 240 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q81N53 6.57e-16 84 26 22 529 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 0.00033 47 43 0 57 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q1QCN2 6.71e-16 80 28 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 1.37e-10 65 30 10 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P10640 7.18e-16 80 28 7 224 3 bexA ATP-binding protein BexA Haemophilus influenzae
P10640 0.000536 45 23 7 227 3 bexA ATP-binding protein BexA Haemophilus influenzae
Q6HG98 7.3e-16 84 25 21 529 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 0.000129 48 45 0 57 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9HT73 7.67e-16 81 28 6 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 7.67e-16 81 28 6 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q97X60 8.76e-16 84 22 16 526 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8U4L3 8.85e-16 81 31 9 212 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 1.71e-05 50 25 8 224 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2YXZ0 9.02e-16 80 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q28VN1 9.68e-16 80 27 3 196 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 1.5e-08 59 26 6 234 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q4FTM3 1.09e-15 80 28 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 7.76e-12 68 30 10 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9VSS1 1.19e-15 84 24 22 504 1 pix Protein Pixie Drosophila melanogaster
Q0BFQ0 1.45e-15 81 31 4 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFQ0 1.02e-12 73 30 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BWL4 1.47e-15 81 31 5 207 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
Q1BWL4 2.6e-12 72 29 6 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.47e-15 81 31 5 207 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
A0K739 2.6e-12 72 29 6 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q4ZLS1 1.56e-15 80 30 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZLS1 1.39e-10 65 31 8 224 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
O34946 1.89e-15 79 26 4 222 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 7.82e-11 65 23 5 217 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q2W4W1 1.94e-15 80 32 6 196 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W4W1 5.89e-06 52 23 6 256 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q7A5Q9 2.26e-15 79 27 7 231 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 2.26e-15 79 27 7 231 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HQ70 2.39e-15 81 26 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q39GW5 2.44e-15 80 31 4 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GW5 1.21e-11 69 28 5 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0A8P9 2.53e-15 79 31 7 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A8P9 1.48e-07 56 27 5 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1CDR0 2.78e-15 80 31 8 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDR0 3.27e-15 79 32 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 2.78e-15 80 31 8 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q74PI5 3.27e-15 79 32 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 2.78e-15 80 31 8 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1S0 3.27e-15 79 32 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q5HG41 3.5e-15 79 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 3.5e-15 79 27 7 229 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 3.5e-15 79 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q49WM4 3.61e-15 81 26 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O86751 3.91e-15 80 30 8 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8EB59 4.03e-15 79 33 8 215 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q6GH28 4.03e-15 78 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q8XZQ4 4.2e-15 79 32 9 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZQ4 6.95e-11 67 30 4 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q665B6 4.49e-15 79 31 8 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q665B6 5.84e-15 79 32 7 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
O57872 5.09e-15 79 30 8 205 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 3.64e-07 55 26 9 226 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q897I2 5.88e-15 81 23 15 411 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q9KXJ6 6.99e-15 81 25 17 526 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KXJ6 0.000105 48 49 0 53 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q21XJ9 7.47e-15 79 30 5 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 2.71e-14 77 30 5 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q1M5X4 7.8e-15 81 22 15 528 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 6.31e-07 56 28 8 218 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8NWT6 8.52e-15 77 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 8.52e-15 77 27 7 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q3K9F9 9.21e-15 77 28 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 1.49e-10 65 28 5 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q8NSN2 1.02e-14 79 29 5 204 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 2.59e-13 75 28 8 239 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q4UJW5 1.28e-14 77 24 5 195 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8CPN0 1.31e-14 79 26 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q81V82 1.44e-14 77 25 4 216 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q81V82 3.69e-06 52 25 7 230 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q6G4Q8 1.66e-14 76 27 6 206 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6G4Q8 0.00014 47 24 6 216 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q92LX3 1.98e-14 79 28 5 214 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 9.78e-09 61 26 7 231 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q4KFA2 2.06e-14 76 29 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 1.03e-11 68 28 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q659V4 2.07e-14 77 29 6 225 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q659V4 6.86e-06 51 25 6 231 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q48CA0 2.15e-14 77 29 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 7.86e-11 66 32 8 223 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6G1D9 2.29e-14 76 28 7 209 3 BQ02700 Putative ABC transporter ATP-binding protein BQ02700 Bartonella quintana (strain Toulouse)
Q1RGL1 2.3e-14 76 25 6 195 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 3.15e-06 52 25 7 212 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
P0A9U2 2.34e-14 80 24 17 521 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 2.34e-14 80 24 17 521 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q3YSK9 2.34e-14 76 27 6 202 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q1CJS9 2.37e-14 78 29 6 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.37e-14 78 29 6 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.37e-14 78 29 6 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 2.39e-14 78 29 7 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
P45769 2.74e-14 76 27 6 219 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q7N0N3 2.99e-14 75 29 8 211 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N0N3 2.23e-07 55 26 5 192 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q92G36 3.03e-14 76 24 5 195 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6CYU2 3.39e-14 76 27 5 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 1.09e-10 66 30 8 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q734T1 3.51e-14 79 26 16 413 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q734T1 0.000248 47 43 0 57 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4K441 3.53e-14 76 30 5 211 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 2.1e-10 65 31 7 223 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3SQ65 3.55e-14 76 30 8 225 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3SQ65 3.48e-06 52 26 8 235 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8FJ95 3.57e-14 76 29 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJ95 1.54e-10 65 28 10 259 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q70GD4 3.81e-14 76 29 6 225 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q70GD4 6.73e-06 51 25 5 231 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q8TI15 3.85e-14 76 29 8 222 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q0B5V4 4.17e-14 79 22 15 525 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q14Q07 4.21e-14 77 26 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 7.77e-09 61 28 6 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8GNH6 4.37e-14 77 30 3 183 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 9.13e-07 55 26 7 228 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q88KY4 4.44e-14 75 29 5 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 4.8e-08 57 28 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1RDS4 5.06e-14 75 30 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
Q1RDS4 1.57e-09 62 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 5.06e-14 75 30 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
A1A9L0 1.57e-09 62 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q65S66 5.54e-14 77 23 5 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2SPI3 5.56e-14 75 29 5 197 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q9V2E4 6.01e-14 75 29 8 212 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q2GFZ6 6.18e-14 75 27 6 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
O29527 6.32e-14 76 30 5 206 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58639 6.42e-14 78 27 8 241 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 4.27e-11 69 26 6 247 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 5.51e-10 65 31 9 220 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O68877 6.77e-14 75 31 8 219 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O68877 2.41e-05 50 28 9 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FW7 6.77e-14 75 31 8 219 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02FW7 2.41e-05 50 28 9 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8FRX8 6.94e-14 77 29 5 206 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 2.42e-12 72 26 6 230 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9EYM2 7.69e-14 74 29 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 1.36e-08 59 25 8 246 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q87UI3 8.35e-14 75 28 6 213 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 1.18e-10 66 31 6 223 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1JJ55 8.53e-14 78 26 9 344 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q884I3 8.54e-14 74 30 6 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 6.32e-11 66 28 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2T4S8 8.78e-14 77 23 18 531 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5HBR8 9.36e-14 74 25 4 191 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 9.36e-14 74 25 4 191 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q3KCC5 9.39e-14 76 29 8 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 0.000156 48 27 7 199 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q9X1Z1 9.46e-14 75 29 8 236 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X1Z1 4.53e-07 55 27 9 206 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A1B9K8 1.01e-13 75 29 5 194 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 6.93e-06 51 26 5 217 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q9ZCC4 1.06e-13 74 24 6 198 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q73GK9 1.08e-13 74 26 4 206 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q88R93 1.09e-13 75 31 7 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 8.93e-10 63 30 7 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48KI4 1.4e-13 73 29 7 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 6.56e-11 66 28 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8E3S6 1.46e-13 77 24 22 518 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8E3S6 2.37e-07 57 27 9 216 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q5PCG9 1.48e-13 75 27 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 3.13e-11 68 30 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8R9L8 1.57e-13 77 24 23 539 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1R155 1.59e-13 73 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8KZQ6 1.7e-13 74 31 7 212 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8KZQ6 3.12e-10 65 30 7 229 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q6LKD4 1.71e-13 75 24 5 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q58488 1.94e-13 74 27 5 201 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q92P76 2.01e-13 75 27 5 210 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
P57403 2.22e-13 73 28 3 197 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q4KC87 2.48e-13 75 27 4 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K506 2.78e-13 73 30 7 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 5.82e-10 63 31 8 221 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
A1B9H9 2.79e-13 73 28 3 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q4ZV73 2.87e-13 73 28 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 5.34e-11 66 28 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q31VE6 3.06e-13 73 24 4 241 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 5.19e-11 67 28 4 215 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q46ZU5 3.48e-13 74 29 4 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 1.22e-08 60 26 5 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0TJC1 3.59e-13 73 29 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJC1 2.21e-09 62 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7N3S7 3.61e-13 73 28 6 221 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3S7 1.34e-07 57 25 6 227 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8UCM5 3.77e-13 73 29 8 228 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UCM5 2.78e-08 58 27 8 236 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q93SH7 4e-13 73 30 7 225 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 1.87e-08 59 30 9 230 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q32AQ1 4.2e-13 73 24 4 241 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q32AQ1 2.1e-10 65 28 4 215 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
P94374 4.45e-13 73 27 6 210 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
P94374 4.77e-08 58 27 8 220 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q55740 4.45e-13 73 27 6 211 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 3.44e-09 62 29 3 207 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7AH43 4.53e-13 74 23 5 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q55463 4.54e-13 73 28 7 207 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55463 2.31e-10 65 25 8 263 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DY60 4.59e-13 75 23 22 518 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 7.5e-08 59 27 9 216 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q0K9I2 4.81e-13 73 31 6 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 8.49e-12 70 29 4 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q50801 4.86e-13 73 32 8 201 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q50801 1.31e-07 57 28 7 207 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q8X4L6 5.2e-13 73 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8X4L6 3.82e-12 70 29 4 215 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q5E284 5.28e-13 72 32 6 201 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q57S53 5.3e-13 74 26 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q57S53 2.04e-10 66 30 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q1LNM0 5.49e-13 73 30 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 4.82e-11 67 30 5 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5WKG4 5.68e-13 72 27 6 200 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 2.61e-10 64 28 7 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q0RT43 5.68e-13 73 31 4 174 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q82JY6 5.7e-13 74 28 7 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8YDJ8 5.71e-13 73 28 3 170 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
O28437 5.82e-13 72 29 4 187 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28437 1.03e-07 57 26 3 211 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0A2U7 6.15e-13 72 26 6 210 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U7 2.45e-05 49 20 5 221 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 6.15e-13 72 26 6 210 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0A2U6 2.45e-05 49 20 5 221 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8RD07 6.27e-13 72 29 10 217 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 1.41e-08 59 26 6 221 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q68Y13 6.64e-13 72 24 6 197 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8PHQ3 6.67e-13 73 27 9 270 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 6.24e-08 58 27 5 203 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q3IWB5 6.87e-13 72 29 6 195 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 1.9e-10 65 29 5 237 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9RRL9 7.32e-13 72 32 8 196 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9RRL9 0.000403 45 27 4 192 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2K6Q4 7.34e-13 73 27 4 208 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3ICT8 7.43e-13 72 31 10 232 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
A0LCH8 7.67e-13 72 33 6 189 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 3.03e-10 64 25 6 248 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8ZR89 7.7e-13 73 26 8 229 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 1.55e-10 66 30 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26362 7.85e-13 75 28 6 234 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
Q98DT6 8.33e-13 72 28 4 197 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98DT6 5.39e-09 61 26 5 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1LKJ2 8.36e-13 73 26 6 259 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 5.07e-12 70 31 6 196 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P33594 8.37e-13 72 25 3 210 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 2.55e-10 65 28 4 215 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q2SB47 8.4e-13 72 32 6 217 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q2SB47 1.5e-06 53 26 6 232 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
P0AAI1 8.67e-13 72 28 6 216 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI1 2.15e-07 56 27 9 248 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 8.67e-13 72 28 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
P0AAI2 2.15e-07 56 27 9 248 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q3YW48 9.1e-13 72 25 3 210 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 2.8e-10 65 27 5 226 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q1BJW2 9.28e-13 74 22 17 528 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 0.000197 48 38 1 68 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 9.28e-13 74 22 17 528 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 0.000197 48 38 1 68 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q722B1 9.45e-13 73 24 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q66A01 9.68e-13 72 34 9 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 9.68e-13 72 34 9 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
Q7N8B9 9.79e-13 73 24 5 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1RK34 9.88e-13 71 29 10 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q1RK34 2.86e-05 49 28 7 177 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q8DUF7 1.02e-12 73 26 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q88ZJ6 1.04e-12 73 25 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 6.21e-05 49 23 5 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q0SML1 1.12e-12 73 28 7 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0SML1 1.49e-07 57 25 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q1R5D8 1.2e-12 72 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q1R5D8 7.19e-10 63 27 5 226 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 1.2e-12 72 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCM9 7.19e-10 63 27 5 226 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 1.2e-12 72 25 3 213 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBX8 7.19e-10 63 27 5 226 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P36638 1.21e-12 72 26 5 220 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1M7W6 1.26e-12 72 29 6 219 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 2.49e-08 59 27 7 212 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8TIW9 1.34e-12 72 27 8 241 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIW9 3.18e-12 70 28 7 214 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q4K5Z7 1.44e-12 71 32 9 218 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K5Z7 5.75e-07 54 27 6 232 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q63TW1 1.45e-12 72 31 8 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q63TW1 4.93e-08 58 28 6 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q2L219 1.55e-12 70 31 9 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella avium (strain 197N)
Q2L219 5.39e-07 54 27 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella avium (strain 197N)
Q13ZK7 1.58e-12 72 30 4 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q576K0 1.59e-12 72 28 3 170 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 1.59e-12 72 28 3 170 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
P0AAI0 1.62e-12 71 25 5 220 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 1.62e-12 71 25 5 220 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 1.62e-12 71 25 5 220 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q88DY1 1.64e-12 71 30 8 222 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88DY1 8.26e-11 66 25 9 281 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9Z8Q8 1.71e-12 72 24 5 222 3 metN Methionine import ATP-binding protein MetN Chlamydia pneumoniae
Q92DL6 1.76e-12 72 24 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q62K56 1.95e-12 72 31 8 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q62K56 5.9e-08 58 28 6 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q1GZH6 1.96e-12 70 31 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1GZH6 3.57e-07 55 28 5 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q21TG3 2.05e-12 70 26 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P08720 2.05e-12 72 29 6 219 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 6.04e-08 58 27 7 212 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q3JSR6 2.06e-12 72 31 8 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q3JSR6 5.59e-08 58 28 6 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q8K9M6 2.09e-12 70 29 3 188 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0SZJ3 2.1e-12 71 24 4 241 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q0SZJ3 1.35e-09 63 28 4 215 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q13ZJ1 2.39e-12 71 31 3 184 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 1.33e-09 63 26 6 212 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
P57013 2.66e-12 70 27 6 210 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P57013 5.71e-06 51 23 6 236 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P54537 2.73e-12 70 25 6 220 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 7.19e-12 69 26 7 247 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8TQ05 2.82e-12 73 23 18 539 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5E5I1 2.85e-12 70 29 7 224 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q39EV3 2.85e-12 70 31 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39EV3 1.72e-11 68 28 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P74548 3.05e-12 72 27 4 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 0.000529 46 24 8 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94440 3.07e-12 71 25 5 236 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 2.85e-10 65 24 4 213 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q8KLG1 3.11e-12 71 29 4 208 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 2.26e-08 59 25 6 222 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q4L4R9 3.18e-12 72 25 6 221 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q4L4R9 0.000191 47 22 7 233 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q1GL85 3.23e-12 70 29 6 189 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 1.15e-05 50 25 7 214 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
P70970 3.49e-12 70 26 6 209 3 ecfAB Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus subtilis (strain 168)
Q5WUF8 3.54e-12 69 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q9TKX3 3.57e-12 71 28 6 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 1.36e-08 60 27 5 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8R7Y5 3.61e-12 70 26 5 221 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8R7Y5 2.73e-07 56 25 8 256 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2SXD1 3.72e-12 70 29 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SXD1 8.79e-12 69 28 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P57032 3.87e-12 70 27 5 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
P57032 2.27e-09 62 31 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
Q8Y651 3.9e-12 70 26 6 212 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y651 2.81e-06 52 26 8 204 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P75370 3.93e-12 70 27 5 208 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 1.73e-11 68 25 8 234 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q6D2F6 3.97e-12 71 27 6 214 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6NJ07 4.03e-12 71 29 4 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 6.81e-11 67 27 5 228 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8Y8T6 4.11e-12 71 23 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O32188 4.23e-12 70 26 7 220 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q3Z3I7 4.29e-12 70 27 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q3Z3I7 5.58e-09 60 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
P9WQM1 4.41e-12 71 29 6 213 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 1.25e-08 60 30 9 233 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 4.41e-12 71 29 6 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 1.25e-08 60 30 9 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 4.41e-12 71 29 6 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 1.25e-08 60 30 9 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0SK28 4.46e-12 70 29 5 184 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 5.7e-11 66 28 4 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q1MEG2 4.63e-12 70 27 4 199 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O52618 4.63e-12 71 30 5 184 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 3.23e-06 53 26 7 222 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
P54592 4.64e-12 70 26 5 209 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
P97027 4.71e-12 70 29 4 171 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
P46903 5.02e-12 69 26 7 208 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
P46903 3.06e-11 67 27 8 229 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
A4TQL5 5.04e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
A4TQL5 4.97e-07 56 23 20 530 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 5.04e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CN15 4.97e-07 56 23 20 530 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 5.04e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
A9R074 4.97e-07 56 23 20 530 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 5.04e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q0WJP9 4.97e-07 56 23 20 530 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 5.04e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C138 4.97e-07 56 23 20 530 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q7NIW1 5.09e-12 71 27 6 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q63SP4 5.16e-12 69 29 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q63SP4 7.79e-12 69 28 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 5.16e-12 69 29 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q62J04 7.79e-12 69 28 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q5KVK2 5.28e-12 71 25 7 220 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5KVK2 1.97e-07 57 24 6 241 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
A0AGP9 5.29e-12 71 23 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q2SVN0 5.45e-12 71 30 7 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVN0 1.03e-06 54 27 5 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q83J77 5.59e-12 70 24 4 241 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q83J77 1.4e-09 62 28 4 215 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q5FUV5 5.83e-12 69 29 9 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Gluconobacter oxydans (strain 621H)
Q21JQ9 6.16e-12 69 26 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21JQ9 8.2e-08 57 27 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8ELR4 6.16e-12 71 22 8 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELR4 5.62e-09 62 25 7 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3KJQ7 6.38e-12 69 29 5 212 3 tauB Taurine import ATP-binding protein TauB Pseudomonas fluorescens (strain Pf0-1)
Q5GRS1 6.41e-12 69 26 5 200 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q8FUU5 6.69e-12 70 28 3 170 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q66EY9 6.72e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66EY9 3.45e-07 57 23 22 571 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 6.72e-12 72 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2K3G1 3.45e-07 57 23 22 571 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q555Z5 7.23e-12 72 27 7 218 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q555Z5 9.43e-06 52 25 4 168 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
P32016 7.53e-12 68 27 6 210 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P32016 3e-06 52 23 7 223 3 ctrD Capsule polysaccharide export ATP-binding protein CtrD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A0A509AN56 7.88e-12 70 27 8 244 1 SufC Iron-sulfur cluster assembly protein SufC Plasmodium berghei (strain Anka)
Q97EK9 8.28e-12 69 25 7 230 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97EK9 8.09e-08 57 25 10 264 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0BWF7 8.3e-12 68 31 6 181 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hyphomonas neptunium (strain ATCC 15444)
Q0BWF7 2.12e-08 58 28 6 215 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hyphomonas neptunium (strain ATCC 15444)
Q3J7S3 8.46e-12 68 28 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3J7S3 0.00034 46 27 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
O27739 9.05e-12 70 27 6 200 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q0BUR6 9.32e-12 68 29 5 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q8Z8R5 9.39e-12 70 26 9 230 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 2.25e-10 66 30 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q5QU46 9.41e-12 68 27 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 1.25e-05 50 25 6 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q87EF4 1.01e-11 68 26 5 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87EF4 8.67e-10 63 30 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q1BHS6 1.04e-11 68 30 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q1BHS6 2.14e-11 68 28 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q2J3T0 1.05e-11 69 28 6 219 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q2J3T0 6.42e-05 48 24 7 267 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q92N13 1.13e-11 68 27 10 254 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q92N13 1.6e-06 53 26 10 244 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
B1JLQ0 1.18e-11 71 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FMJ7 1.23e-11 71 26 9 345 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q83LN2 1.27e-11 68 27 6 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q83LN2 1.39e-08 59 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q2RQQ0 1.32e-11 68 33 6 189 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RQQ0 6.15e-08 57 31 7 177 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0T6A8 1.34e-11 68 27 6 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q0T6A8 1.39e-08 59 27 8 256 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q6NA00 1.37e-11 69 28 9 260 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NA00 1.67e-09 62 26 6 226 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7ANN4 1.45e-11 71 24 10 265 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
A2RKA7 1.56e-11 70 22 16 542 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 1.12e-07 58 24 6 217 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
Q492R2 1.59e-11 68 28 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
Q492R2 1.47e-07 56 28 4 157 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
Q3K6R9 1.63e-11 68 31 9 223 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
Q3K6R9 6.47e-07 54 28 6 232 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
Q97JB8 1.64e-11 68 27 6 205 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 2.69e-08 59 24 5 230 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q82VL9 1.64e-11 67 29 7 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82VL9 5.07e-08 57 28 7 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q830W6 1.75e-11 69 24 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q87R20 1.77e-11 68 28 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87R20 5.98e-07 54 24 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q20Y31 1.81e-11 68 24 5 230 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q20Y31 2.7e-10 65 25 10 258 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q9K876 1.82e-11 69 26 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 2.75e-05 50 24 5 173 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5X2Z8 1.88e-11 67 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q5X2Z8 8.77e-06 50 24 9 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q49VI3 1.9e-11 68 25 6 223 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8XIZ5 1.91e-11 69 23 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.91e-11 69 23 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q12ES3 1.93e-11 67 28 6 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q12ES3 0.000498 45 29 6 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q6D3Q6 2.01e-11 69 26 8 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3Q6 1.64e-06 54 27 6 204 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NHA1 2.04e-11 68 29 6 201 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8PP41 2.29e-11 68 30 7 189 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q8PP41 1.08e-08 60 28 4 214 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q97KS6 2.3e-11 69 25 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0VQQ0 2.3e-11 67 29 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VQQ0 3.95e-09 60 25 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2SI12 2.33e-11 67 31 4 191 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q7GB25 2.38e-11 70 28 9 241 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q7GB25 5.01e-05 50 23 7 194 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q81LM1 2.48e-11 68 28 9 228 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q81LM1 2.97e-06 52 23 6 232 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
P31134 2.52e-11 69 28 6 204 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 6.62e-10 65 31 6 199 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q18KE1 2.6e-11 68 32 11 224 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q03AH0 2.62e-11 69 24 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8FV85 2.62e-11 69 24 4 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 3.46e-09 62 27 7 224 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.62e-11 69 24 4 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 3.46e-09 62 27 7 224 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.62e-11 69 24 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 3.46e-09 62 27 7 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.62e-11 69 24 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 3.46e-09 62 27 7 224 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q07DZ6 2.63e-11 70 25 6 234 3 CFTR Cystic fibrosis transmembrane conductance regulator Ornithorhynchus anatinus
Q7VMV4 2.8e-11 67 27 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A3DJK5 2.85e-11 68 26 4 203 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5PB72 2.93e-11 67 22 6 220 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q9KLQ5 2.94e-11 68 23 5 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2NU23 3.02e-11 67 27 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 2.72e-06 52 26 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q8UF79 3.05e-11 68 27 4 179 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q07LY2 3.05e-11 67 26 8 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q07LY2 1.12e-09 63 27 10 240 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q6LQC0 3.06e-11 68 31 9 213 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium profundum (strain SS9)
Q6LQC0 4.47e-07 55 27 8 237 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium profundum (strain SS9)
A0LUE6 3.07e-11 69 28 9 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q5WCL2 3.18e-11 68 25 4 213 3 tagH Teichoic acids export ATP-binding protein TagH Shouchella clausii (strain KSM-K16)
Q86UK0 3.29e-11 70 29 5 196 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q86UK0 1.12e-08 62 25 5 203 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q58429 3.32e-11 67 27 9 222 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 1.25e-05 50 23 6 219 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4L884 3.41e-11 68 24 4 205 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q0BSM2 3.41e-11 67 30 11 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
P44656 3.48e-11 67 28 7 185 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88HL0 3.51e-11 67 31 8 216 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88HL0 8.55e-09 60 26 3 221 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2NTI7 3.57e-11 67 27 3 190 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q2NTI7 2.31e-06 53 22 7 271 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q9G4F5 3.89e-11 68 26 5 216 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q215F6 4e-11 67 30 11 213 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain BisB18)
Q215F6 0.000849 45 28 5 174 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain BisB18)
Q39GT7 4.23e-11 68 27 4 214 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 2.13e-10 65 25 4 227 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O31339 4.24e-11 68 26 5 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 2.35e-07 57 26 10 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5ZT78 4.34e-11 66 26 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZT78 3.55e-07 55 25 10 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2RS22 4.39e-11 67 28 5 229 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RS22 9.48e-09 60 25 8 263 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P37494 4.4e-11 66 27 5 193 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
P37494 1.42e-10 65 29 10 227 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q8T9W4 4.51e-11 70 25 11 331 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8CTM4 4.63e-11 67 26 6 217 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CTM4 1.72e-05 50 24 6 220 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR97 4.63e-11 67 26 6 217 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HR97 1.72e-05 50 24 6 220 3 tagH Teichoic acids export ATP-binding protein TagH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O66646 4.9e-11 66 29 7 213 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q9HPH7 4.92e-11 67 27 7 208 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9HPH7 2.66e-08 58 25 6 244 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q52666 5.06e-11 67 25 7 236 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q2Y624 5.07e-11 66 29 7 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5MZ53 5.1e-11 67 28 8 219 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5MZ53 1.67e-08 59 26 5 201 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 5.1e-11 67 28 8 219 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55108 1.67e-08 59 26 5 201 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8Z0H0 5.49e-11 68 28 7 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 7.37e-08 58 27 6 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P26050 5.52e-11 67 23 4 259 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 4.93e-09 61 26 6 219 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2RU16 5.56e-11 66 27 9 225 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5NZT6 5.68e-11 66 27 7 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5NZT6 2.22e-08 58 26 5 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P77622 5.78e-11 67 25 6 219 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P77622 3.46e-10 65 30 5 198 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q9CJB8 5.84e-11 69 28 5 196 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9CJB8 2.05e-06 54 26 7 226 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q8DIA0 5.92e-11 67 28 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 5.05e-07 55 27 7 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q0P9C4 6.1e-11 68 26 8 219 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5V6B8 6.17e-11 67 30 5 192 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V6B8 1.52e-09 62 26 7 244 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P42246 6.28e-11 67 29 6 207 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 6.08e-10 64 26 4 215 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q82B58 6.29e-11 68 28 5 216 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82B58 1.99e-09 64 29 7 252 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q3ATY5 6.35e-11 66 24 7 228 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q3ATY5 1.38e-07 56 27 6 207 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q07DY5 6.46e-11 69 24 6 234 3 CFTR Cystic fibrosis transmembrane conductance regulator Colobus guereza
Q07DY5 5.22e-06 53 28 8 182 3 CFTR Cystic fibrosis transmembrane conductance regulator Colobus guereza
Q8XHV3 6.47e-11 67 26 8 214 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain 13 / Type A)
Q0TMS8 6.47e-11 67 26 8 214 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
O34677 6.7e-11 66 24 7 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
O34677 0.000108 47 19 4 235 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q9WY65 6.75e-11 67 26 5 212 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WY65 1.98e-10 65 26 7 226 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5HQQ9 7.04e-11 67 25 6 221 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7VZ31 7.05e-11 66 29 10 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZ31 1.2e-07 56 27 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8T0 7.05e-11 66 29 10 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W8T0 1.2e-07 56 27 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK40 7.05e-11 66 29 10 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WK40 1.2e-07 56 27 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5YZY9 7.2e-11 67 27 6 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5YZY9 4.76e-07 55 26 6 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q1BG75 7.3e-11 66 29 6 200 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 7.3e-11 66 29 6 200 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q132E8 7.57e-11 66 26 6 230 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q132E8 7.92e-09 60 28 12 251 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
P45052 7.87e-11 67 23 5 238 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45052 5.75e-09 61 26 10 232 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q134N9 8.07e-11 67 28 7 233 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q134N9 4.81e-09 62 25 7 235 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_19275
Feature type CDS
Gene uup
Product ABC transporter ATP-binding protein
Location 990 - 2918 (strand: -1)
Length 1929 (nucleotides) / 642 (amino acids)

Contig

Accession ZDB_713
Length 13350 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1693
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter
PF16326 ABC transporter C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06158 ATP-binding cassette, subfamily F, member 3 - -

Protein Sequence

MIVFSSLQVRRGVRVLLDNATATINPGQKVGLVGKNGCGKSTLLALLKGELQAEAGSVSFPGNWSMAWVNQETPALDEPAIEYVIDGDREFRELEAKLQQANEQNDGHAIAVIHGQLDTLDAWTIRSRAATLLHGLGFSQEQLDTPVRAFSGGWRMRLNLAQALICRSDLLLLDEPTNHLDLDAVIWLEKWLKSYPGTLILISHDRDFLDPIIDKVLHIEQNGLFEYTGNYSSFEVQRAEKMAQQQAQYESQQLRRAHLQKYVDRFRAQATKAKQAQSRLKMLERMELIAPALADNPFRFSFRPPEALPNPLLKMEKVSAGYGEKVVLDNIKLNLVPGSRIGLLGRNGAGKSTLIKMLAGELEPLQGKIGLAKGIKLGYFAQHQLEFLRADESPLQHMVRLAPDQTEQQLRDYLGGYGFKGDQVTDNTGRFSGGEKARLVLAMIIWQRPNLLLLDEPTNHLDLDMRQALTEALIEFEGAIVVVSHDRHLLRSTTDDLYLVHDGQVEPFDGDLDDYQRWLADSQKQMRQSAEPAAENGEEKNTVTAQDRKEQKRREAEFRQQTQPLRKESEKLEKTMSRLSDAIAVIEEKLGDSGLYDQSRKAELNTCLQEQAQFKAELEEAEMAWMEIQENLEAMTQAFENQ

Flanking regions ( +/- flanking 50bp)

CGCACGAATTACATTAATTTTACTCTCAATTACTTACCCTATCGATATTTATGATTGTTTTCTCTTCACTTCAGGTTCGCCGCGGCGTCCGTGTTCTGCTCGACAACGCAACGGCCACCATCAATCCGGGCCAGAAAGTCGGACTGGTGGGAAAAAACGGCTGCGGTAAATCCACGCTGCTGGCACTGCTTAAGGGCGAATTACAGGCCGAAGCAGGCAGTGTGTCATTTCCGGGAAACTGGTCCATGGCCTGGGTTAACCAGGAAACCCCGGCACTGGATGAACCGGCGATCGAGTATGTCATTGACGGTGACCGCGAATTCCGTGAGCTTGAGGCAAAATTACAGCAGGCGAATGAACAGAATGACGGCCACGCCATTGCCGTGATCCACGGCCAGCTCGACACCCTCGATGCCTGGACCATCCGTTCCCGTGCCGCCACACTGCTGCACGGGCTGGGATTCTCACAGGAACAGCTGGACACCCCGGTACGGGCCTTCTCCGGGGGCTGGCGGATGCGCCTGAACCTGGCACAGGCACTGATTTGCCGCTCTGATCTGCTGCTGCTCGATGAACCGACCAACCACCTGGATCTCGATGCGGTGATCTGGCTGGAAAAATGGCTGAAGAGCTATCCCGGCACTCTGATTCTGATCTCCCATGACCGCGATTTCCTCGATCCGATCATTGATAAAGTCCTGCACATTGAACAAAACGGTCTGTTTGAATACACCGGTAACTACTCCTCCTTTGAGGTGCAGCGTGCCGAGAAAATGGCCCAGCAGCAGGCACAGTATGAAAGTCAGCAGTTACGCCGCGCACATCTGCAGAAATATGTCGATCGTTTCCGCGCTCAGGCGACCAAAGCCAAGCAGGCACAAAGCCGTCTGAAGATGCTGGAACGCATGGAGCTGATTGCCCCGGCACTGGCGGATAACCCGTTCCGTTTCAGTTTCCGCCCGCCTGAAGCACTGCCGAACCCGCTGCTGAAAATGGAAAAAGTCAGCGCCGGGTACGGTGAGAAAGTGGTGCTGGATAATATCAAACTGAACCTGGTGCCCGGTTCACGTATCGGCCTGCTCGGCCGTAACGGCGCGGGTAAATCCACCCTGATTAAAATGCTCGCCGGTGAACTGGAGCCGTTACAGGGCAAAATTGGTCTCGCCAAAGGTATCAAACTGGGTTACTTCGCCCAGCATCAGCTGGAATTTTTACGCGCAGATGAATCCCCGTTACAGCATATGGTGCGCCTGGCGCCGGATCAGACTGAACAGCAACTGCGTGATTACCTCGGCGGTTATGGTTTCAAAGGTGATCAGGTGACCGACAACACCGGTCGTTTCTCCGGCGGGGAAAAAGCGCGTCTGGTACTGGCGATGATTATCTGGCAGCGCCCGAACCTGCTGCTGCTCGATGAACCGACAAACCACCTGGATCTGGATATGCGCCAGGCACTGACCGAAGCCCTGATCGAATTTGAGGGAGCGATCGTCGTGGTTTCCCACGATCGTCACCTGCTGCGATCCACCACCGATGATCTGTACCTGGTGCATGATGGTCAGGTCGAGCCGTTTGACGGCGATCTGGATGATTATCAGCGCTGGCTGGCAGACAGTCAGAAACAGATGCGCCAGAGTGCGGAGCCGGCGGCGGAAAACGGCGAGGAAAAAAATACCGTCACCGCGCAGGATCGCAAAGAGCAGAAACGCCGTGAGGCGGAATTCCGCCAGCAGACTCAGCCGCTGCGCAAAGAATCTGAGAAACTGGAAAAAACCATGAGCCGGTTATCGGACGCCATTGCCGTGATTGAGGAAAAACTCGGTGACAGCGGCCTGTATGATCAGTCCCGCAAAGCCGAGCTGAACACCTGCCTTCAGGAACAGGCGCAGTTCAAAGCTGAGCTGGAAGAGGCGGAAATGGCCTGGATGGAGATTCAGGAAAACCTCGAAGCCATGACACAGGCCTTTGAAAATCAGTAAATGATAAAGAGCGGCCCCTGCCGCTCTCTTTTCTTATCAGCCGTCCAGGC