Homologs in group_1518

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09405 FBDBKF_09405 88.0 Morganella morganii S1 potC spermidine/putrescine ABC transporter permease PotC
EHELCC_10005 EHELCC_10005 88.0 Morganella morganii S2 potC spermidine/putrescine ABC transporter permease PotC
NLDBIP_10350 NLDBIP_10350 88.0 Morganella morganii S4 potC spermidine/putrescine ABC transporter permease PotC
LHKJJB_11005 LHKJJB_11005 88.0 Morganella morganii S3 potC spermidine/putrescine ABC transporter permease PotC
HKOGLL_14065 HKOGLL_14065 88.0 Morganella morganii S5 potC spermidine/putrescine ABC transporter permease PotC
F4V73_RS10560 F4V73_RS10560 87.3 Morganella psychrotolerans potC spermidine/putrescine ABC transporter permease PotC

Distribution of the homologs in the orthogroup group_1518

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1518

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFK6 6.81e-156 437 89 0 256 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 6.81e-156 437 89 0 256 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 6.81e-156 437 89 0 256 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
Q83RR7 1.53e-155 436 89 0 256 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P45169 5.33e-124 356 70 0 251 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AFL1 4.11e-52 174 43 2 232 1 potI Putrescine transport system permease protein PotI Escherichia coli (strain K12)
P0AFL2 4.11e-52 174 43 2 232 3 potI Putrescine transport system permease protein PotI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFS0 7.88e-21 91 31 2 202 3 ydcV Inner membrane ABC transporter permease protein YdcV Shigella flexneri
P0AFR9 7.88e-21 91 31 2 202 1 ydcV Inner membrane ABC transporter permease protein YdcV Escherichia coli (strain K12)
P75057 1.12e-20 91 28 5 262 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47290 1.67e-20 91 27 8 271 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5PFQ5 4.42e-14 73 26 5 262 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z8X0 1.18e-13 72 26 4 250 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhi
P96065 2.81e-13 71 26 5 262 2 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57SD8 5.77e-13 70 26 4 257 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella choleraesuis (strain SC-B67)
P45322 1.22e-11 65 28 5 186 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WG01 1.47e-10 63 27 0 157 1 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG00 1.47e-10 63 27 0 157 3 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P41032 4.08e-10 62 26 2 206 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9TJR4 4.56e-10 62 28 2 153 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
P56343 1.23e-09 60 26 3 172 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
O58760 1.33e-09 60 27 1 154 3 PH1036 Probable ABC transporter permease protein PH1036 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O06991 2.21e-09 60 24 2 210 3 mdxG Maltodextrin transport system permease protein MdxG Bacillus subtilis (strain 168)
Q2EEX6 3.91e-09 59 26 3 171 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
O07011 4.2e-09 59 25 5 249 1 ganQ Galactooligosaccharides transport system permease protein GanQ Bacillus subtilis (strain 168)
P16701 9.03e-09 58 26 3 207 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
Q55473 1.29e-08 58 25 0 172 1 ggtD Osmoprotective compounds uptake permease protein GgtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O57893 2.15e-08 57 28 1 150 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P77156 3.9e-08 56 35 0 74 1 ydcU Inner membrane ABC transporter permease protein YdcU Escherichia coli (strain K12)
P45170 9.66e-08 55 32 0 79 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0CL49 2.74e-07 53 40 0 69 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 2.74e-07 53 40 0 69 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 2.74e-07 53 40 0 69 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P0AFK5 2.88e-07 53 40 0 69 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 2.88e-07 53 40 0 69 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
P0AF01 3.57e-07 53 29 4 125 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 3.57e-07 53 29 4 125 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
Q9V2C1 4.57e-07 53 26 1 150 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
D4GQ17 7.89e-07 52 24 1 157 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
O31520 1.68e-06 51 25 3 177 3 yesQ Probable ABC transporter permease protein YesQ Bacillus subtilis (strain 168)
A2CI71 2.23e-06 51 30 3 146 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
P77716 2.74e-06 50 28 1 142 1 ycjP Inner membrane ABC transporter permease protein YcjP Escherichia coli (strain K12)
O32154 4.67e-06 50 21 6 178 3 yurM Probable ABC transporter permease protein YurM Bacillus subtilis (strain 168)
Q5JEB3 5.84e-06 49 26 1 150 3 wtpB Molybdate/tungstate transport system permease protein WtpB Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9Z3R7 1.19e-05 49 29 1 167 3 aglG Alpha-glucoside transport system permease protein AglG Rhizobium meliloti (strain 1021)
P55452 1.59e-05 49 25 4 167 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O50501 1.66e-05 48 27 3 137 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0A4N4 1.76e-05 48 25 5 228 3 malD Maltodextrin transport system permease protein MalD Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4N3 1.76e-05 48 25 5 228 3 malD Maltodextrin transport system permease protein MalD Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q32RF7 1.77e-05 48 25 3 169 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
P94530 2.89e-05 47 27 8 192 1 araQ Arabinooligosaccharides transport system permease protein AraQ Bacillus subtilis (strain 168)
Q58763 3.32e-05 47 21 3 201 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q53683 4.72e-05 47 23 1 165 3 None Putative ABC transporter permease protein ORF1 (Fragment) Streptomyces antibioticus
Q9MUL9 5.05e-05 47 26 2 156 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
P26246 7.71e-05 46 27 2 155 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
Q9TKU8 9.22e-05 46 26 3 156 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
O34742 0.000111 45 23 2 155 1 opuCD Glycine betaine/carnitine/choline transport system permease protein OpuCD Bacillus subtilis (strain 168)
P96064 0.000122 46 29 0 89 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57SD7 0.000124 46 29 0 89 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
Q5PFQ6 0.000137 45 29 0 89 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9KTJ6 0.00028 44 24 3 149 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q01895 0.000402 44 27 3 167 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8U4K4 0.000427 44 26 2 143 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q7CS31 0.000518 44 23 1 158 1 smoH Sulfoquinovosyl glycerol transport system permease protein SmoH Agrobacterium fabrum (strain C58 / ATCC 33970)
P27370 0.000529 44 26 7 261 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q87GB8 0.000535 44 25 2 149 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6QJE2 0.000638 44 24 1 139 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
Q7LYX6 0.000778 43 29 0 123 1 malG Trehalose/maltose transport system permease protein MalG Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q74RF8 0.000792 43 26 3 149 3 malG Maltose/maltodextrin transport system permease protein MalG Yersinia pestis
O30143 0.000817 43 28 6 169 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9K489 0.001 43 23 2 159 1 dasC Diacetylchitobiose uptake system permease protein DasC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13480
Feature type CDS
Gene potC
Product spermidine/putrescine ABC transporter permease PotC
Location 2986226 - 2987005 (strand: -1)
Length 780 (nucleotides) / 259 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1518
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1177 Amino acid transport and metabolism (E) E ABC-type spermidine/putrescine transport system, permease component II

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11070 spermidine/putrescine transport system permease protein ABC transporters -

Protein Sequence

MIGRLLRGGFMSIIYAYLYIPIIILIVNSFNSSRFGINWKGFTTDWYTILLNNDSLLQAAGHSLTMAVTSATFATLIGSLAAVALYRYRFRGKKFVGGMLFVVMMSPDIVMAISLLVLFMLLGISLGFWSLLVSHITFCLPFVVVTVYSRLSGFDVKMLEAAKDLGAGEFTILRKIIMPLAMPAVASGWLLSFTLSMDDVVVSSFVTGPSYEILPLKIYSMVKVGVSPEVNALATILLGLSLVLVLISQLILRDRTGKA

Flanking regions ( +/- flanking 50bp)

TTTGTGTATTACCGAGCCGTAAAACTACTGCATAAGAAGGTAGAAATAGAATGATAGGACGGTTATTGCGGGGTGGATTTATGTCCATCATTTACGCGTATCTTTATATCCCGATTATCATTCTGATAGTTAACTCTTTTAACTCATCACGTTTCGGGATCAACTGGAAAGGCTTTACCACTGACTGGTATACCATTTTATTAAATAATGACAGCCTGCTACAAGCTGCAGGGCATTCATTAACGATGGCAGTCACCTCAGCAACCTTTGCGACGTTGATTGGTTCATTGGCTGCGGTGGCGCTTTATCGCTATCGTTTTCGTGGTAAAAAGTTTGTTGGTGGTATGCTGTTTGTGGTGATGATGTCGCCAGATATTGTGATGGCGATTTCATTATTGGTTTTATTTATGCTATTAGGCATTTCCTTAGGGTTTTGGTCATTACTGGTGTCGCATATTACCTTTTGTCTGCCTTTTGTGGTGGTCACGGTCTATTCGCGACTCAGTGGTTTTGATGTCAAAATGCTTGAAGCCGCTAAGGATCTAGGGGCGGGTGAATTTACTATTTTACGTAAAATCATTATGCCATTAGCGATGCCAGCAGTAGCCTCGGGGTGGTTATTAAGCTTTACGTTATCGATGGATGACGTGGTTGTCTCCTCTTTTGTGACTGGACCAAGCTATGAAATTTTACCATTAAAAATTTACTCAATGGTAAAAGTAGGTGTTTCACCGGAAGTGAATGCACTGGCAACCATCCTTTTAGGGCTATCATTAGTATTAGTATTAATTAGTCAGTTGATCTTACGAGATAGAACTGGCAAAGCGTAATTTAAAAGTATTAGTGCGAGTTTCTCGCACTTTTTACGGTCTTGATGACC