Homologs in group_3648

Help

3 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS08430 F4V73_RS08430 30.5 Morganella psychrotolerans - molecular chaperone
F4V73_RS08450 F4V73_RS08450 33.9 Morganella psychrotolerans - molecular chaperone
F4V73_RS10275 F4V73_RS10275 32.9 Morganella psychrotolerans - molecular chaperone

Distribution of the homologs in the orthogroup group_3648

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3648

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X5E4 2.82e-33 123 34 5 206 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P75856 2.16e-32 120 33 5 206 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P31697 1.95e-28 110 29 9 232 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P59590 4.59e-28 109 28 9 232 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P15319 1.06e-27 108 30 5 217 1 papD Chaperone protein PapD Escherichia coli
P33409 1.47e-24 100 28 8 238 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P37923 2.99e-24 99 32 8 232 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5K6 5.75e-24 98 30 7 223 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P77249 5.99e-24 98 30 6 229 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P45991 2.52e-23 97 29 7 226 3 hifB Chaperone protein HifB Haemophilus influenzae
P35757 2.77e-23 97 29 7 227 3 hifB Chaperone protein HifB Haemophilus influenzae
P53520 3.67e-23 97 33 8 214 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P62609 2.71e-22 94 30 7 222 1 focC Chaperone protein FocC Escherichia coli
P62610 2.71e-22 94 30 7 222 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42914 5.45e-22 93 30 7 225 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P33342 7.89e-22 93 29 5 225 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P43661 2.3e-21 91 30 7 220 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33128 3.39e-21 91 28 6 239 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P69966 7.85e-21 91 28 6 225 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 7.85e-21 91 28 6 225 3 psaB Chaperone protein PsaB Yersinia pestis
P25402 1.19e-19 87 28 6 228 3 fanE Chaperone protein FanE Escherichia coli
P75749 8.75e-19 85 30 11 222 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P40876 1.87e-18 84 27 6 232 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P25401 6.97e-18 83 28 4 161 1 faeE Chaperone protein FaeE Escherichia coli
P77616 9.58e-18 82 27 7 234 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P33407 1.54e-17 82 26 7 249 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P53516 2.13e-17 81 28 5 191 3 afaB Chaperone protein AfaB Escherichia coli
Q05433 3.81e-17 81 28 4 162 3 clpE Chaperone protein ClpE Escherichia coli
P21646 4.75e-17 80 29 7 202 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P26926 2.13e-16 79 29 9 229 1 caf1M Chaperone protein caf1M Yersinia pestis
P77599 3.05e-15 75 32 6 150 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P46004 6.12e-15 75 26 5 211 3 aggD Chaperone protein AggD Escherichia coli
P33387 1.51e-13 70 28 7 217 3 sefB Chaperone protein SefB Salmonella enteritidis
P46738 5.73e-13 69 26 5 191 3 nfaE Chaperone protein NfaE Escherichia coli
P15483 2.73e-12 67 28 8 215 3 None Chaperone protein CS3-1 Escherichia coli
P53518 9.13e-11 63 26 7 228 3 cssC Chaperone protein CssC Escherichia coli
P53519 1.09e-09 60 26 7 223 3 cssC Chaperone protein CssC Escherichia coli
P42183 1.35e-07 52 30 3 101 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12550
Feature type CDS
Gene -
Product molecular chaperone
Location 2782162 - 2782860 (strand: -1)
Length 699 (nucleotides) / 232 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3648
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MVNKIRFFQYISLCVLGVLFLSFQVQAGVGLSQTRIIINGDTNTASISARNNNAQPYLVSNFITEKLDTSSPPLSGMFVITPNIFRLAPESENTIKIQIIPTNLPKDRESLYYFHSRNIPSTNKNEDGIKIAMENIIKVFYRPINLAINPKEAGDKLVVKATPNGISIENPTPYYINLFKITVKNETIKLNKINNMIEPFSSKNYVVSNKTGAVNIHIINDLGGESVYNKKL

Flanking regions ( +/- flanking 50bp)

TTTGTTTTACTACCAATAGTAAAGTTGCAGTGCAATAAGGTGATAGGCAGATGGTAAACAAAATACGCTTTTTTCAATATATTTCGTTGTGTGTTTTAGGAGTATTATTTTTATCATTTCAGGTTCAAGCCGGTGTCGGTTTAAGCCAGACTCGTATTATTATTAATGGGGATACTAATACAGCCTCTATTAGCGCTAGAAATAATAATGCACAACCTTATTTAGTCTCTAACTTTATAACCGAAAAACTGGATACCTCATCACCACCTTTGAGTGGTATGTTTGTTATTACTCCAAACATTTTCAGGTTAGCTCCGGAAAGTGAAAATACAATAAAAATTCAAATAATACCAACAAATCTTCCTAAAGATAGAGAATCACTTTATTACTTCCACTCGCGAAATATTCCATCAACAAATAAAAATGAAGATGGGATAAAAATAGCGATGGAAAATATTATCAAGGTATTTTATCGCCCTATTAATTTAGCGATAAACCCAAAAGAAGCCGGTGATAAATTAGTTGTAAAAGCAACGCCTAATGGGATCAGTATTGAGAACCCTACGCCTTATTATATTAATCTTTTTAAGATTACCGTTAAAAATGAAACGATAAAATTAAATAAAATTAATAATATGATAGAACCATTTTCTTCTAAAAACTATGTGGTAAGTAATAAAACAGGTGCTGTTAATATTCATATTATCAACGATTTAGGCGGAGAAAGTGTCTACAATAAAAAACTTTAAAAGAACAGTATTGTTAGCGATGATGGTGTATGCAGTAAACTGTCAATCCG