Homologs in group_3648

Help

3 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS08430 F4V73_RS08430 37.9 Morganella psychrotolerans - molecular chaperone
F4V73_RS10275 F4V73_RS10275 35.0 Morganella psychrotolerans - molecular chaperone
PMI_RS12550 PMI_RS12550 33.9 Proteus mirabilis HI4320 - molecular chaperone

Distribution of the homologs in the orthogroup group_3648

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3648

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31697 1.88e-32 121 34 7 232 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
Q8X5K6 2.76e-32 121 34 7 238 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P59590 6.25e-32 120 34 7 232 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42914 8.58e-32 119 32 8 237 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P43661 1.45e-30 116 32 5 239 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33409 1.78e-30 116 34 7 239 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P37923 1.06e-29 114 34 8 236 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45991 6.18e-29 112 30 7 239 3 hifB Chaperone protein HifB Haemophilus influenzae
P62609 3.49e-28 110 33 6 209 1 focC Chaperone protein FocC Escherichia coli
P62610 3.49e-28 110 33 6 209 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P75856 1.66e-27 108 32 7 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P69966 2.52e-27 109 30 8 236 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 2.52e-27 109 30 8 236 3 psaB Chaperone protein PsaB Yersinia pestis
P35757 3.51e-27 108 30 7 239 3 hifB Chaperone protein HifB Haemophilus influenzae
P33128 1.26e-26 106 30 7 242 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
Q8X5E4 1.33e-26 106 32 7 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P77249 4.32e-26 104 31 8 238 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P53516 3.03e-25 103 32 5 194 3 afaB Chaperone protein AfaB Escherichia coli
P46004 7.92e-25 102 30 6 220 3 aggD Chaperone protein AggD Escherichia coli
P21646 2.15e-24 100 30 6 247 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P75749 2.3e-24 100 31 7 227 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P33407 4.27e-24 100 26 10 269 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P53520 1.14e-22 96 32 7 184 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P53519 9.26e-22 93 28 7 227 3 cssC Chaperone protein CssC Escherichia coli
P53518 4.54e-21 91 26 6 226 3 cssC Chaperone protein CssC Escherichia coli
P46738 4.54e-21 92 30 5 194 3 nfaE Chaperone protein NfaE Escherichia coli
P15319 1.39e-20 90 30 9 232 1 papD Chaperone protein PapD Escherichia coli
P40876 3.33e-20 89 29 6 233 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P33342 1.38e-19 87 27 7 229 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P26926 4.44e-18 84 26 7 253 1 caf1M Chaperone protein caf1M Yersinia pestis
P77616 9.12e-18 83 29 9 225 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P15483 1.82e-16 79 30 8 219 3 None Chaperone protein CS3-1 Escherichia coli
P25402 2.29e-16 79 26 7 227 3 fanE Chaperone protein FanE Escherichia coli
P33387 1.88e-15 76 28 6 210 3 sefB Chaperone protein SefB Salmonella enteritidis
P25401 3.23e-15 76 29 6 179 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 6.3e-15 75 28 6 183 3 clpE Chaperone protein ClpE Escherichia coli
P77599 4.35e-13 70 30 7 169 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P28722 4.27e-06 50 24 7 186 3 yhcA Uncharacterized fimbrial chaperone YhcA Escherichia coli (strain K12)
P42183 0.000314 42 29 4 110 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08450
Feature type CDS
Gene -
Product molecular chaperone
Location 1743853 - 1744620 (strand: 1)
Length 768 (nucleotides) / 255 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3648
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MTKIHFFRHFAILTLTLMSLTTAVHAAEGGLRLGQTRVIFSGQNNTAKAVIKNNGQQVYLIKTEVMNTPDGNNPQLITPPFIVTPPMFRLEKESQSTALIVRNGTAQLPADRESVFYLSLLAIPAVSKTGTPGENMTSAQVSVGIRNVIKLFYRPAGLKPGFQEAAEKLTFRQHGGQIQVNNPTPYYLTLAALSVNQQPVNVQDANPMIAPFSANTYAVSGTPSQVQWSVITDFGDAGQTLTAAVTSGEFTHESP

Flanking regions ( +/- flanking 50bp)

TAAAGCAACTGTCACTTTTGCCTTTTTATACGACTGATACCGGGGATGTTATGACAAAAATCCATTTTTTCCGCCACTTCGCAATACTGACATTAACCCTGATGTCGCTGACAACCGCTGTACACGCGGCGGAAGGCGGACTTCGTCTGGGTCAGACACGCGTGATATTTAGCGGACAAAACAACACCGCCAAAGCGGTCATTAAAAATAATGGTCAGCAGGTGTATCTGATTAAAACAGAAGTGATGAACACACCGGATGGCAATAATCCGCAGTTAATAACACCGCCTTTTATTGTTACCCCGCCGATGTTCCGGCTGGAAAAAGAGAGTCAGAGTACCGCACTGATTGTCCGCAACGGCACCGCACAGTTACCGGCAGACCGTGAGTCTGTTTTTTATCTCAGCCTGCTGGCGATCCCCGCAGTCAGTAAAACCGGTACGCCCGGGGAAAATATGACCAGCGCGCAGGTCTCTGTCGGGATCCGCAATGTGATTAAATTATTTTACCGCCCGGCAGGATTAAAACCCGGTTTTCAGGAAGCGGCAGAAAAACTGACTTTCCGTCAACACGGCGGGCAGATTCAGGTAAATAACCCGACGCCGTACTATCTGACCCTGGCGGCACTGTCAGTTAATCAGCAGCCGGTCAATGTACAGGATGCCAATCCGATGATAGCGCCCTTCTCCGCCAATACTTATGCGGTCAGTGGTACGCCATCACAGGTGCAGTGGTCTGTTATCACTGATTTCGGTGATGCCGGTCAGACCTTAACAGCAGCGGTAACTTCGGGAGAATTCACTCATGAGTCCCCGTAATTTTTATCGCGCCATCAGTCTGTTATCTGTTTTGAGTGTCAGTGCGGTAC