Homologs in group_3743
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| FBDBKF_20470 | FBDBKF_20470 | 76.2 | Morganella morganii S1 | - | HTH tetR-type domain-containing protein |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| P51561 | 1.05e-135 | 381 | 88 | 0 | 205 | 1 | tetR | Tetracycline repressor protein class H | Pasteurella multocida |
| P04483 | 8.53e-91 | 268 | 64 | 2 | 204 | 1 | tetR | Tetracycline repressor protein class B from transposon Tn10 | Escherichia coli |
| P51562 | 3.61e-88 | 261 | 61 | 1 | 204 | 2 | tetR | Tetracycline repressor protein class H | Photobacterium damsela subsp. piscicida |
| P0ACT5 | 3.61e-88 | 261 | 61 | 1 | 204 | 3 | tetR | Tetracycline repressor protein class D | Salmonella ordonez |
| P0ACT4 | 3.61e-88 | 261 | 61 | 1 | 204 | 1 | tetR | Tetracycline repressor protein class D | Escherichia coli |
| P03039 | 1.51e-70 | 216 | 52 | 1 | 204 | 4 | tetR | Tetracycline repressor protein class C | Escherichia coli |
| P03038 | 2.27e-70 | 216 | 54 | 2 | 203 | 1 | tetR | Tetracycline repressor protein class A from transposon 1721 | Escherichia coli |
| P21337 | 6.28e-66 | 204 | 50 | 2 | 209 | 1 | tetR | Tetracycline repressor protein class E | Escherichia coli |
| P51560 | 3.05e-64 | 200 | 50 | 2 | 201 | 2 | tetR | Tetracycline repressor protein class G | Vibrio anguillarum |
| P67435 | 1.1e-07 | 54 | 25 | 2 | 169 | 4 | BQ2027_MB1388C | Uncharacterized HTH-type transcriptional regulator Mb1388c | Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) |
| P9WMD3 | 1.1e-07 | 54 | 25 | 2 | 169 | 1 | Rv1353c | HTH-type transcriptional repressor Rv1353c | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| P9WMD2 | 1.1e-07 | 54 | 25 | 2 | 169 | 3 | MT1396 | HTH-type transcriptional repressor MT1396 | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Q79ZV4 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain MW2) |
| Q6G609 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain MSSA476) |
| Q6GDD9 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain MRSA252) |
| Q7A352 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain N315) |
| Q7A2K5 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain Mu50 / ATCC 700699) |
| A6QKF4 | 0.00015 | 44 | 24 | 0 | 69 | 1 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain Newman) |
| Q5HCN2 | 0.00015 | 44 | 24 | 0 | 69 | 1 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain COL) |
| Q9RQQ0 | 0.00015 | 44 | 24 | 0 | 69 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus aureus (strain NCTC 8325 / PS 47) |
| Q5HKQ1 | 0.000499 | 42 | 32 | 0 | 46 | 1 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A) |
| Q8GLC6 | 0.000518 | 42 | 32 | 0 | 46 | 3 | icaR | Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR | Staphylococcus epidermidis |
| O53789 | 0.000606 | 43 | 41 | 0 | 46 | 1 | Rv0681 | Uncharacterized HTH-type transcriptional regulator Rv0681 | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Source | Proteus mirabilis HI4320 |
|---|---|
| Locus tag | PMI_RS11865 |
| Feature type | CDS |
| Gene | tetR(J) |
| Product | tetracycline resistance transcriptional repressor TetR(J) |
| Location | 2620845 - 2621468 (strand: -1) |
| Length | 624 (nucleotides) / 207 (amino acids) |
| In genomic island | - |
| Accession | NC_010554 |
|---|---|
| Length | 4063606 nucleotides |
| Topology | circular |
| Plasmid | False |
| Orthogroup | group_3743 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG1309 | Transcription (K) | K | DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K18476 | TetR/AcrR family transcriptional regulator, tetracycline repressor protein | - | - |
MAKLDKEQVIDNALILLNEVGMEGLTTRKLAQKLGVEQPTLYWHVKNKRALLDALAETILQKHHHHVLPLANESWQDFLRNNAISFRQALLMYRDGGKIHAGTRPSANQFETSEQQLQFLCDAGFTLTQAVYALSSIAHFTLGSVLETQEHQESQKEREKVPKIEINYPPLLTQAIDIMDSDNGEAAFLFVLDVMISGLETVLNNHH
TATCTCTATCAGTGATAGATTGTCAAGAATATTTTATTATGAGGACGCAAATGGCAAAATTAGATAAAGAACAGGTTATTGATAACGCATTGATTTTATTAAATGAAGTCGGTATGGAAGGGTTAACAACACGTAAGTTGGCGCAAAAATTAGGAGTAGAGCAACCGACACTTTATTGGCATGTAAAGAATAAACGTGCGTTATTAGATGCTTTAGCTGAGACTATTTTACAAAAGCATCATCATCATGTTTTGCCATTAGCGAATGAAAGTTGGCAGGATTTTTTGCGTAATAACGCAATAAGTTTTCGTCAGGCGCTATTAATGTATCGTGATGGTGGAAAGATCCATGCAGGCACACGACCATCAGCCAATCAATTTGAGACATCAGAGCAACAATTGCAATTTTTGTGCGATGCTGGCTTTACGTTAACGCAAGCTGTTTATGCATTAAGTTCCATCGCGCATTTTACACTTGGTTCAGTGCTTGAAACCCAAGAACATCAAGAGAGCCAAAAAGAGCGAGAAAAAGTGCCAAAAATAGAGATAAACTACCCACCATTATTAACGCAAGCTATTGATATTATGGATAGTGATAATGGTGAAGCTGCATTCCTTTTTGTGCTCGATGTGATGATTTCAGGGCTAGAAACAGTGCTAAATAATCATCATTAAATAGGCTGACGCCCCTTAGGGGCGATGAGTTGCCCTTGTCTATCTGCGAT
