Homologs in group_121

Help

10 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06220 FBDBKF_06220 65.9 Morganella morganii S1 thiQ thiamine ABC transporter ATP-binding protein ThiQ
EHELCC_09265 EHELCC_09265 65.9 Morganella morganii S2 thiQ thiamine ABC transporter ATP-binding protein ThiQ
NLDBIP_09645 NLDBIP_09645 65.9 Morganella morganii S4 thiQ thiamine ABC transporter ATP-binding protein ThiQ
LHKJJB_08110 LHKJJB_08110 65.9 Morganella morganii S3 thiQ thiamine ABC transporter ATP-binding protein ThiQ
HKOGLL_07660 HKOGLL_07660 65.9 Morganella morganii S5 thiQ thiamine ABC transporter ATP-binding protein ThiQ
F4V73_RS15695 F4V73_RS15695 64.7 Morganella psychrotolerans thiQ thiamine ABC transporter ATP-binding protein ThiQ
PMI_RS19510 PMI_RS19510 21.6 Proteus mirabilis HI4320 - AAA family ATPase
PMI_RS04640 PMI_RS04640 21.4 Proteus mirabilis HI4320 - AAA family ATPase
PMI_RS05675 PMI_RS05675 33.0 Proteus mirabilis HI4320 fetA iron ABC transporter ATP-binding protein FetA
PMI_RS06995 PMI_RS06995 25.5 Proteus mirabilis HI4320 - ATP-binding protein

Distribution of the homologs in the orthogroup group_121

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_121

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8V0 5.81e-109 316 66 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D0F3 8.98e-103 300 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NVW9 6.47e-102 298 62 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Sodalis glossinidius (strain morsitans)
Q66EN1 2.1e-101 296 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CMQ3 3.96e-101 296 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 3.96e-101 296 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 3.96e-101 296 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q326G9 1.48e-100 294 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q8Z9I6 1.2e-99 292 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q5PDF8 1.27e-99 292 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q32K28 1.35e-99 292 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z5U5 2.09e-99 291 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q0T8D1 2.93e-99 291 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q8XA06 5.72e-99 290 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q57TF5 5.99e-99 290 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q8ZRV2 7.79e-99 290 60 0 230 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P31548 8.02e-99 290 60 0 230 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q83MG3 8.38e-99 290 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q8FL82 8.71e-98 287 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RGD0 1.79e-97 286 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q0TLS2 2.02e-97 286 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7MPC5 5.81e-83 249 57 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 5.81e-83 249 57 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q65SC9 5.36e-82 246 55 0 213 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QLQ1 4.09e-81 244 57 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
P44986 2.15e-80 243 56 0 208 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6LV32 3.85e-80 243 52 1 241 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q9KP42 1.74e-78 238 55 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87SV4 3.13e-77 235 51 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0I354 1.11e-75 231 57 1 206 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q9CNP9 1.49e-72 223 50 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Pasteurella multocida (strain Pm70)
Q5E882 2.34e-72 223 49 0 221 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q11D92 1.08e-70 219 48 1 222 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
Q98FA5 4.33e-68 213 45 0 219 3 thiQ Thiamine import ATP-binding protein ThiQ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q28VL7 3.81e-65 204 47 1 217 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q1GCR8 4.63e-65 204 47 0 218 3 thiQ Thiamine import ATP-binding protein ThiQ Ruegeria sp. (strain TM1040)
Q7VP69 1.82e-64 202 49 1 211 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8FYU9 2.13e-62 197 46 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 2.13e-62 197 46 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BC2 1.05e-60 193 45 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.05e-60 193 45 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q8UBY6 1.12e-59 191 41 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92L31 7.17e-58 186 42 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
Q3IY12 9.94e-55 178 45 0 218 3 thiQ Thiamine import ATP-binding protein ThiQ Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P14788 2.44e-46 159 43 0 199 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8Z0H0 4.28e-46 159 41 1 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2SJY7 8.11e-46 159 44 2 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q5WBL0 8.42e-46 155 43 4 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q8DIA0 1.1e-44 155 42 2 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P56344 1.48e-44 152 38 0 199 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q8RGC8 1.52e-44 155 39 1 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9X196 1.9e-44 155 40 2 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P31134 3.57e-44 155 40 3 218 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q0I3Y9 4.18e-44 154 39 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q8E8K8 1.57e-43 152 41 1 200 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q89UD2 1.88e-43 152 39 2 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7MLB8 5.63e-43 152 39 4 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q8D954 5.63e-43 152 39 4 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
P74548 6.15e-43 151 43 0 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6MCV4 8.69e-43 151 40 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q14Q07 9.46e-43 150 38 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q65UE1 1.18e-42 150 38 1 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q3MAR5 1.4e-42 150 43 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q82TL6 1.59e-42 150 41 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7NIW1 1.69e-42 150 41 0 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9KRT4 2.94e-42 150 39 4 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7VNG4 3.34e-42 149 38 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LR20 3.38e-42 149 38 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q5E586 3.8e-42 149 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3YUV0 3.84e-42 149 40 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 3.84e-42 149 40 2 211 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 3.84e-42 149 40 2 211 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 3.84e-42 149 40 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q8YM92 3.86e-42 149 42 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9KS33 4.08e-42 149 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7UBD0 4.09e-42 149 40 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q8FB37 4.31e-42 149 40 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P54933 4.33e-42 148 38 2 207 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q8UA73 4.43e-42 149 35 3 224 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5YZY9 5.12e-42 148 41 2 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
A3DDF6 5.84e-42 148 39 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8FVT0 7.21e-42 148 36 1 221 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q1M8R6 7.25e-42 148 43 2 195 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2YKZ7 7.29e-42 148 36 1 221 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 7.29e-42 148 36 1 221 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q1GIE5 7.97e-42 149 39 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q64SQ6 8.04e-42 150 42 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 8.04e-42 150 42 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5FL41 9.76e-42 148 37 1 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q0SXQ1 1.1e-41 148 40 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
O51587 1.17e-41 147 36 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P63354 1.35e-41 147 39 2 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.35e-41 147 39 2 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6D201 1.55e-41 147 39 1 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q660M8 1.79e-41 147 36 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0TA26 2.35e-41 147 39 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8UBB7 2.66e-41 147 40 0 190 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8A883 2.79e-41 149 43 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1QE80 2.92e-41 148 39 3 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0AGF4 3.07e-41 147 41 1 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q664X5 3.51e-41 147 41 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 3.51e-41 147 41 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 3.51e-41 147 41 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 3.51e-41 147 41 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
A1TXH7 4.07e-41 147 38 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q7MKU3 4.1e-41 147 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 4.1e-41 147 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q9K876 4.49e-41 146 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P9WQM1 4.73e-41 146 41 0 190 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 4.73e-41 146 41 0 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 4.73e-41 146 41 0 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q30V33 4.87e-41 147 39 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q92VJ2 6.1e-41 146 38 2 224 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q02R79 6.72e-41 146 42 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q6D4E2 6.77e-41 146 41 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q88ZJ6 6.93e-41 146 40 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9HY19 7.01e-41 146 42 2 194 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
D4GP38 7.06e-41 146 39 1 192 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q0SML1 8.02e-41 145 36 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q7NQN5 8.39e-41 145 41 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7N6Z2 8.94e-41 145 40 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P19566 9.4e-41 145 39 2 211 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z1U0 9.4e-41 145 39 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q57GZ7 9.4e-41 145 39 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q8ELR4 9.7e-41 145 38 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q87PH3 1.03e-40 146 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6NBT1 1.14e-40 145 37 2 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6F0V4 1.16e-40 145 42 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q7N986 1.19e-40 145 38 2 212 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9TKX3 1.29e-40 145 38 3 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q042G7 1.39e-40 145 37 1 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q9I6L0 1.42e-40 144 41 2 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3KCC5 1.74e-40 144 39 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q73XU8 2.11e-40 145 38 1 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q74K65 2.37e-40 144 36 1 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q72FW5 2.74e-40 144 38 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O31339 2.84e-40 144 38 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P45171 3.27e-40 144 39 0 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94360 3.28e-40 144 36 1 210 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q81GU1 3.36e-40 144 38 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5PKZ8 3.42e-40 144 39 2 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9CP06 3.56e-40 144 37 1 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q8X8K4 3.62e-40 144 36 4 214 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q2K6L3 3.9e-40 144 42 2 195 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P77481 4.29e-40 144 36 4 214 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q47T99 4.66e-40 144 38 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q9V2C0 5.19e-40 143 37 3 231 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q9G4F5 6.77e-40 143 37 1 206 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
O85818 7.37e-40 143 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q92XW1 8.83e-40 142 39 2 224 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q6LKD4 8.92e-40 143 39 2 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q8FHR3 1.02e-39 143 35 4 214 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI47 1.04e-39 143 35 4 214 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P9WQI3 1.14e-39 143 40 3 210 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 1.14e-39 143 40 3 210 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8U648 1.33e-39 140 43 3 194 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
A1VZQ5 1.34e-39 139 37 4 218 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0AAF9 1.34e-39 139 37 6 238 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 1.34e-39 139 37 6 238 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 1.34e-39 139 37 6 238 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 1.34e-39 139 37 6 238 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q03PF2 1.53e-39 142 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q18AM3 1.55e-39 142 37 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q1RC47 1.83e-39 142 35 4 214 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q2YAD6 1.96e-39 142 41 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9KUI0 1.98e-39 142 37 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Y8T6 2.16e-39 142 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q160M2 2.28e-39 142 40 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q4QK57 2.28e-39 142 39 0 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q0P9X7 2.7e-39 139 37 4 218 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q722B1 2.75e-39 142 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8F6Z1 2.83e-39 141 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.83e-39 141 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q57SD6 2.83e-39 142 38 3 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q7NX01 3.49e-39 141 38 1 203 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 3.58e-39 141 41 2 205 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q609Q1 3.69e-39 141 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P96063 5.16e-39 141 38 3 207 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ7 5.33e-39 141 38 3 205 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P37009 5.4e-39 140 37 2 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8Z8W8 5.8e-39 141 38 3 205 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
P40860 5.82e-39 141 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8D0W8 5.96e-39 141 40 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q7W9U5 6.59e-39 140 40 3 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A0AGP9 6.67e-39 141 40 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q2K4V4 6.94e-39 141 39 2 191 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8Z4V6 7.12e-39 140 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q65QT6 7.52e-39 141 37 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5JEB0 7.8e-39 140 39 3 217 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q92DL6 8.24e-39 140 37 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8EBC3 8.85e-39 140 37 3 213 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1MQ44 8.85e-39 140 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q63TY1 8.88e-39 140 36 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8UH62 9.08e-39 140 40 1 194 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
A1URR2 9.28e-39 140 41 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q98HF7 9.38e-39 140 40 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q62K82 1.02e-38 140 36 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
P10346 1.03e-38 137 38 5 236 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q7WGW1 1.07e-38 140 40 3 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q01937 1.1e-38 140 39 2 194 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q668K6 1.15e-38 140 40 1 193 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7AH43 1.3e-38 139 36 2 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q1MCN6 1.32e-38 140 39 2 194 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A1B9Q7 1.34e-38 140 38 3 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q8U4K3 1.36e-38 139 37 3 218 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q6FFZ1 1.48e-38 137 39 3 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8ZLF4 1.6e-38 139 39 2 194 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q88AS5 1.62e-38 139 38 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1GB17 1.64e-38 140 35 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P77795 1.66e-38 139 40 2 195 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q8RI39 1.87e-38 140 38 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q57IS3 1.9e-38 139 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q7MFC4 1.95e-38 140 39 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 1.95e-38 140 39 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q164Y5 2.04e-38 139 35 3 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6F9A8 2.07e-38 139 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8Z245 2.15e-38 139 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
Q2K1C8 2.4e-38 139 37 3 215 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q032D0 2.82e-38 136 38 6 244 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q110U3 3.07e-38 139 38 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q7VZE5 3.09e-38 139 39 3 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P55453 3.24e-38 138 38 3 203 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6G194 3.59e-38 138 39 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q8FW07 4.93e-38 138 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 4.93e-38 138 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q0K9I2 5.01e-38 137 38 3 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2YKR8 5.03e-38 138 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q9Z3R9 5.42e-38 138 39 4 198 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q830W6 5.54e-38 138 36 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
P54537 5.94e-38 135 37 5 222 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q03AH0 5.96e-38 138 38 0 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q7N8B9 6.62e-38 138 37 2 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6G5J0 6.63e-38 138 39 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8YCB1 7.84e-38 137 39 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8XZP8 8.31e-38 138 38 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88CL2 8.48e-38 137 38 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5PJL1 8.5e-38 137 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P16676 9.24e-38 138 39 1 194 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8FFB3 9.44e-38 138 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A3PRY1 9.5e-38 137 36 3 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q5L222 9.67e-38 137 35 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q81GC1 1.06e-37 137 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8XBJ8 1.09e-37 137 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q93DX8 1.1e-37 135 35 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q1GID1 1.11e-37 137 36 3 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q04G50 1.15e-37 137 35 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04BG2 1.22e-37 137 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q5HQ70 1.41e-37 137 41 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0TC10 1.47e-37 137 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9A7X1 1.47e-37 137 37 2 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7UC29 1.62e-37 137 39 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q1R5H8 1.76e-37 137 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 1.76e-37 137 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q8FCQ2 1.82e-37 137 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3M5J9 1.95e-37 134 39 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q00752 1.99e-37 137 38 3 200 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q87GB5 2.12e-37 137 38 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5PMK1 2.16e-37 137 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z7H7 2.3e-37 137 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q5DZC6 2.37e-37 137 38 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0I2Z4 2.46e-37 136 35 0 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
P40790 2.56e-37 137 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.56e-37 137 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q1M589 2.79e-37 136 38 2 195 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q98K23 2.8e-37 136 38 2 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0SRL2 2.94e-37 136 37 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q38VW6 3.18e-37 136 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q6D734 3.29e-37 136 37 2 205 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0PY57 3.31e-37 136 37 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q03ZQ0 3.58e-37 136 36 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8RQL7 4.04e-37 133 37 6 223 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8U6M1 4.11e-37 136 37 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81TH8 4.11e-37 135 36 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q9JZW0 4.31e-37 136 36 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q63E84 4.47e-37 135 36 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 4.47e-37 135 36 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 4.47e-37 135 36 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 4.72e-37 135 36 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q92WD6 4.99e-37 135 38 4 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q9JUX4 5.27e-37 135 36 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9MUN1 5.32e-37 135 39 2 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q46ZM0 5.5e-37 136 38 2 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9KL04 5.51e-37 136 38 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CIQ6 6.73e-37 132 38 6 244 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. lactis (strain IL1403)
Q57293 6.78e-37 135 36 0 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q3IX40 6.99e-37 135 35 3 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1TAI4 7.32e-37 135 40 3 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O83658 7.69e-37 135 38 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q8D653 7.72e-37 135 39 1 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q82WT5 8.05e-37 135 38 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
O32151 8.06e-37 135 36 4 212 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q21GS5 8.58e-37 135 39 3 202 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1B8V9 9.06e-37 135 38 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 9.06e-37 135 38 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q98G42 9.07e-37 135 37 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q32EY4 9.71e-37 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1RD28 1.09e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.09e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q52666 1.11e-36 132 35 5 228 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P69877 1.13e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.13e-36 135 39 3 198 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.13e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.13e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.13e-36 135 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
P18813 1.14e-36 133 38 3 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
P27675 1.22e-36 132 38 5 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q8CPN0 1.37e-36 135 40 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8PNN4 1.4e-36 134 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q1WVI7 1.51e-36 134 36 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
O34992 1.6e-36 135 34 5 227 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
O57896 1.62e-36 134 36 4 219 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8PC11 1.62e-36 134 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q31VH5 1.7e-36 134 37 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q2SSS4 1.84e-36 134 37 4 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q28QL7 1.85e-36 134 38 2 191 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
P10907 1.87e-36 134 37 2 194 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q3YW77 1.89e-36 134 37 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q3Z2Z3 1.96e-36 134 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.96e-36 134 39 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q5ZWE4 2e-36 134 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P44531 2.17e-36 133 37 2 197 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5X627 2.25e-36 134 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q63Q62 2.27e-36 134 37 2 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q62GB4 2.52e-36 134 37 2 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q0S0Z3 2.57e-36 134 41 6 209 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q8DUF7 2.73e-36 134 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8XZX8 2.77e-36 134 38 2 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q87DT9 2.82e-36 134 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q5XCA4 2.94e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9PDN2 2.97e-36 133 35 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8UII7 3.04e-36 134 37 0 190 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0T5R2 3.08e-36 134 38 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q65S66 3.09e-36 133 36 0 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6MU19 3.15e-36 133 36 4 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q4K681 3.2e-36 134 37 1 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2L0H5 3.31e-36 134 38 2 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q2SU77 3.35e-36 134 37 2 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q89WG0 3.48e-36 134 37 0 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3JMW7 3.64e-36 134 37 2 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q16BJ3 3.66e-36 131 39 5 188 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P0CZ35 3.7e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 3.7e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 3.7e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8UB29 4.13e-36 133 38 2 196 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DZJ0 4.56e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 4.56e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 4.56e-36 134 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1LNM0 4.67e-36 131 38 5 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q578K3 5e-36 133 38 2 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5e-36 133 38 2 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q0SBZ1 5.04e-36 133 41 6 209 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q49WM4 5.16e-36 133 38 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WXF0 5.68e-36 133 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q38WL5 6.05e-36 132 35 6 251 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q8XIZ5 6.08e-36 132 36 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 6.08e-36 132 36 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0LUE6 6.26e-36 133 35 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q9KLQ5 6.32e-36 132 37 2 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1J6Q6 6.72e-36 133 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 6.72e-36 133 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 6.72e-36 133 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 6.72e-36 133 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q9CM80 8.25e-36 132 36 2 197 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q13TV1 8.86e-36 132 35 3 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q6LK87 9.79e-36 132 37 2 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q6CZ34 9.84e-36 132 36 3 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1BRZ8 1.17e-35 132 37 4 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 1.17e-35 132 37 4 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q5M397 1.18e-35 132 37 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q46ZU5 1.21e-35 130 38 4 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5LYN4 1.25e-35 132 37 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q03JH1 1.26e-35 132 37 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q325N3 1.33e-35 129 40 5 193 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q0K998 1.37e-35 132 37 2 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0BIZ6 1.41e-35 132 36 4 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q92UV5 1.45e-35 132 38 2 206 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q8X6U5 1.57e-35 132 35 3 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q1AS06 1.59e-35 132 36 2 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5LX21 1.65e-35 132 33 4 233 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A1JIE0 1.68e-35 132 39 3 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
D4GP39 1.71e-35 132 37 1 191 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q3Z542 1.8e-35 129 40 5 193 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 1.8e-35 129 40 5 193 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
P45769 1.9e-35 129 36 4 216 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q92WJ0 1.96e-35 131 38 2 196 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q32IZ6 2.11e-35 129 40 5 193 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q66FU4 2.38e-35 131 37 3 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1LLP5 2.45e-35 131 37 2 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q21XJ9 2.69e-35 129 39 5 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q9HYG4 2.76e-35 129 41 3 194 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7CN92 2.76e-35 132 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.76e-35 132 35 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q5MZ54 3.18e-35 135 40 2 191 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 3.18e-35 135 40 2 191 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q65F80 3.24e-35 130 38 4 227 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q1CNC6 3.62e-35 131 37 3 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 3.62e-35 131 37 3 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 3.62e-35 131 37 3 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q02QT1 3.92e-35 129 40 3 194 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7A169 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 4.4e-35 130 40 2 190 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 4.4e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q8FVV5 5.11e-35 130 38 2 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q6CYU2 5.34e-35 128 38 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7VKP7 5.76e-35 130 35 4 232 3 modC Molybdenum import ATP-binding protein ModC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9L0Q1 6.17e-35 130 37 3 191 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8X5I6 6.41e-35 127 40 5 193 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q52815 6.8e-35 127 37 3 205 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A0PXX8 7.13e-35 128 34 9 248 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium novyi (strain NT)
Q39KB9 7.26e-35 130 36 4 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7CS28 7.39e-35 130 34 3 210 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4L5B3 7.44e-35 130 39 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q1RFH8 7.6e-35 127 39 2 188 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 7.6e-35 127 39 2 188 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q85A69 8.62e-35 130 37 3 209 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q45460 9.09e-35 130 32 6 234 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q0RAT5 9.72e-35 132 37 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q24XJ2 9.8e-35 129 35 3 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q9I6T2 9.81e-35 130 37 3 195 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q668Q3 1.03e-34 129 38 4 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJS9 1.03e-34 129 38 4 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 1.03e-34 129 38 4 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 1.03e-34 129 38 4 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q5LT05 1.11e-34 130 40 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q55463 1.13e-34 128 36 2 190 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WQL3 1.14e-34 130 36 4 230 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 1.14e-34 130 36 4 230 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4KC87 1.15e-34 129 41 5 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1M7A6 1.16e-34 127 39 2 193 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P55662 1.16e-34 127 35 5 220 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q97KS6 1.38e-34 129 36 3 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P21410 1.72e-34 129 38 4 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q0S6U9 1.92e-34 126 40 4 194 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhodococcus jostii (strain RHA1)
Q97UY8 2.03e-34 129 37 3 205 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q83MA0 2.23e-34 126 40 5 193 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q2K8C8 2.35e-34 129 36 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q65T42 2.37e-34 129 35 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0RYP7 2.38e-34 128 39 5 209 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q7NRX5 2.39e-34 129 39 2 185 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9KHT9 2.63e-34 129 34 6 219 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 2.63e-34 129 34 6 219 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9RKC6 2.69e-34 126 34 5 227 3 SCO3161 Putative ABC transporter ATP-binding protein SCO3161 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1SWH9 2.92e-34 129 35 1 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q55462 2.98e-34 132 40 4 192 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1WSB8 3.03e-34 127 34 7 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q8YCG3 3.88e-34 128 38 2 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FKF5 4.15e-34 125 39 2 188 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1BWL4 4.48e-34 127 39 3 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 4.48e-34 127 39 3 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q5WKG4 5.63e-34 125 40 5 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q3IM24 5.7e-34 125 34 6 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q6D2F6 5.75e-34 127 35 6 228 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O32169 5.93e-34 127 37 4 236 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q1MFL8 6.31e-34 125 37 2 194 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q13ZK7 6.81e-34 127 41 4 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q881U6 6.82e-34 124 38 3 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8NSN2 7.63e-34 127 39 1 199 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q39GW5 8e-34 126 39 3 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q03PY5 8.11e-34 125 36 4 216 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q0BFQ0 8.26e-34 126 39 3 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1CDR0 8.7e-34 125 36 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 8.7e-34 125 36 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 8.7e-34 125 36 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q665B6 1.08e-33 125 36 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1QTX6 1.16e-33 127 36 0 201 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8RFN2 1.16e-33 126 35 5 242 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8G5P8 1.18e-33 127 39 4 204 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q60AI1 1.45e-33 127 39 0 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P48243 1.63e-33 124 35 5 221 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P10091 1.71e-33 127 37 2 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q98G43 1.74e-33 126 38 4 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0T7M2 1.79e-33 124 39 5 193 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri serotype 5b (strain 8401)
O34900 1.99e-33 124 33 4 229 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q7VYN2 2.32e-33 126 37 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WID6 2.32e-33 126 37 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VV72 2.47e-33 126 37 2 225 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.47e-33 126 37 2 225 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.47e-33 126 37 2 225 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q73YZ5 2.54e-33 123 36 5 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 2.54e-33 123 36 5 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q7W6G5 2.61e-33 126 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
O34677 2.63e-33 123 35 4 224 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
A3CMQ7 2.68e-33 126 32 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q98DT6 2.8e-33 124 40 5 200 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8DPC2 2.92e-33 126 33 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.92e-33 126 33 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.92e-33 126 33 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8PP41 2.92e-33 123 38 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q8FV85 3.14e-33 126 37 4 222 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 3.14e-33 126 37 4 222 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 3.14e-33 126 37 4 222 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 3.14e-33 126 37 4 222 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q92LU2 3.16e-33 125 37 4 198 3 modC Molybdenum import ATP-binding protein ModC Rhizobium meliloti (strain 1021)
Q4K441 3.3e-33 124 38 4 197 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11495
Feature type CDS
Gene thiQ
Product thiamine ABC transporter ATP-binding protein ThiQ
Location 2532905 - 2533606 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_121
Orthogroup size 11
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3840 Coenzyme transport and metabolism (H) H ABC-type thiamine transport system, ATPase component ThiQ

Protein Sequence

MIKLEQLSYTYEHQHLTFNLTVKAGERIAILGPSGAGKSSLLSLIAGFLPSESGSLFLKGKDHTKTAPAQRPISMLFQDNNLFPHLTVRQNIGLGLDPGLKLTVAQKALLESRAKQVSLSDYLERLPSQLSGGQRQRVAIARCLVREQPILLLDEPFSALDPALRIEMLTLLEQICDEKNLTLLMVSHSLEDAHKIAPRALVIDNGTIVYDGNTASLIKGEVDQSLLLGIPFN

Flanking regions ( +/- flanking 50bp)

GTTATGTTTCACGCTTTTTAGCCTTATCGAACGCGTTTCAGGAAAATCCTATGATTAAGTTAGAGCAGCTTTCTTATACCTATGAGCACCAACATCTGACCTTTAATTTAACGGTAAAAGCGGGGGAGCGTATTGCTATTTTAGGTCCCAGTGGTGCAGGTAAAAGCTCATTACTCAGCTTAATAGCGGGTTTTCTGCCCTCAGAGTCAGGCTCGTTATTTTTAAAAGGGAAAGATCATACCAAAACAGCCCCTGCCCAACGCCCTATCTCGATGTTATTTCAAGATAACAATCTTTTTCCTCATCTCACGGTAAGACAAAATATTGGTTTAGGGCTAGATCCAGGGCTAAAGCTCACTGTGGCACAGAAAGCACTATTAGAAAGTCGAGCCAAACAGGTTTCTTTAAGTGATTATCTAGAGCGTTTACCTTCACAGCTATCAGGAGGTCAACGTCAACGAGTGGCAATTGCCCGTTGTCTGGTACGTGAACAGCCTATTTTATTGTTAGACGAACCTTTTTCCGCCCTTGATCCCGCATTACGTATCGAAATGCTGACATTATTAGAACAAATTTGTGATGAAAAAAATCTCACTTTACTCATGGTGTCTCACAGCTTAGAAGATGCTCATAAAATCGCACCAAGAGCGCTTGTTATTGATAATGGCACCATTGTCTATGATGGAAATACAGCGTCATTAATCAAAGGCGAAGTGGATCAATCACTGCTGTTAGGGATACCTTTTAATTAATCTATTGAAATATAGCGATATCGAAAGAAGCTTATTCCCCCCTACAAGCC