Homologs in group_83

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03155 FBDBKF_03155 57.5 Morganella morganii S1 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
FBDBKF_19010 FBDBKF_19010 47.0 Morganella morganii S1 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
EHELCC_07380 EHELCC_07380 57.5 Morganella morganii S2 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
EHELCC_18755 EHELCC_18755 47.0 Morganella morganii S2 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
NLDBIP_07705 NLDBIP_07705 57.5 Morganella morganii S4 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
NLDBIP_18550 NLDBIP_18550 47.0 Morganella morganii S4 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
LHKJJB_07240 LHKJJB_07240 57.5 Morganella morganii S3 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
LHKJJB_18625 LHKJJB_18625 47.0 Morganella morganii S3 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
HKOGLL_03690 HKOGLL_03690 57.5 Morganella morganii S5 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
HKOGLL_18360 HKOGLL_18360 47.0 Morganella morganii S5 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
F4V73_RS11765 F4V73_RS11765 55.1 Morganella psychrotolerans cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit

Distribution of the homologs in the orthogroup group_83

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_83

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L6 0.0 810 63 1 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MJ63 0.0 775 61 1 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Cronobacter sakazakii (strain ATCC BAA-894)
Q1R7T4 0.0 768 61 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA2 0.0 768 61 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEV0 0.0 768 61 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O1:K1 / APEC
Q31XM4 0.0 767 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella boydii serotype 4 (strain Sb227)
Q8FEI7 0.0 767 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YY94 0.0 766 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella sonnei (strain Ss046)
A8G9X6 0.0 766 61 3 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Serratia proteamaculans (strain 568)
Q8X7U1 0.0 765 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O157:H7
P38038 0.0 764 60 2 604 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain K12)
B1IU77 0.0 764 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZQK7 0.0 764 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O139:H28 (strain E24377A / ETEC)
P38039 0.0 763 60 4 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z458 0.0 762 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhi
Q83QD9 0.0 762 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri
Q0T1I8 0.0 762 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri serotype 5b (strain 8401)
Q57KH7 0.0 762 60 4 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella choleraesuis (strain SC-B67)
A8A3P5 0.0 761 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O9:H4 (strain HS)
A9N2E6 0.0 759 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q6D1A1 0.0 759 60 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q32CG3 0.0 758 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella dysenteriae serotype 1 (strain Sd197)
A4WDW1 0.0 758 59 1 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Enterobacter sp. (strain 638)
A6TD49 0.0 757 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q5PEH7 0.0 757 60 2 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1JJS2 0.0 756 62 1 589 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8ANX1 0.0 743 58 1 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MF16 0.0 739 58 3 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q2NVN4 0.0 736 58 2 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Sodalis glossinidius (strain morsitans)
Q8ZBN6 0.0 724 59 3 611 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis
Q1C3Z0 0.0 724 59 3 611 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Antiqua)
A4TPY5 0.0 723 59 3 615 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis (strain Pestoides F)
Q1CLS8 0.0 723 59 3 615 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Nepal516)
A7FLZ0 0.0 722 59 3 615 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66ED4 0.0 719 58 3 621 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5NRM1 0.0 707 55 4 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1LTP1 0.0 650 52 3 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Baumannia cicadellinicola subsp. Homalodisca coagulata
P57503 0.0 612 46 4 616 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9JS45 0.0 610 51 3 580 3 cysJ1 Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUD8 0.0 606 51 3 580 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9KUX4 0.0 605 50 3 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A9LZ73 0.0 604 51 3 580 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C (strain 053442)
A5F3I4 0.0 603 49 3 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1KU06 0.0 603 51 3 580 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q8DCK2 0.0 600 48 6 602 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain CMCP6)
Q7MHA5 0.0 599 48 6 602 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain YJ016)
Q7VQH2 0.0 596 49 5 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Blochmanniella floridana
Q5E841 0.0 595 49 3 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8K9D3 0.0 592 46 5 609 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87L90 0.0 588 47 4 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65T53 0.0 588 49 3 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8EAZ9 0.0 575 48 4 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KTH4 0.0 573 48 5 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain ANA-3)
Q6LM58 0.0 572 47 2 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photobacterium profundum (strain SS9)
Q0HYB4 0.0 568 49 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-7)
Q0HFL6 0.0 568 49 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-4)
O32214 2.89e-164 485 41 6 603 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Bacillus subtilis (strain 168)
Q54B10 2.03e-89 292 33 12 553 2 redA NADPH oxidoreductase A Dictyostelium discoideum
A0A2U1KZS6 6.69e-72 248 29 20 646 3 CPR2 NADPH--cytochrome P450 reductase 2 Artemisia annua
Q55CT1 8.75e-70 241 27 18 601 2 redB NADPH--cytochrome P450 reductase Dictyostelium discoideum
Q9SUM3 1.43e-67 236 28 13 616 1 ATR2 NADPH--cytochrome P450 reductase 2 Arabidopsis thaliana
Q653S9 2.75e-67 235 29 18 614 1 CPR3 NADPH--cytochrome P450 reductase 3 Oryza sativa subsp. japonica
A0A2U1LIM9 1.43e-66 233 29 16 609 1 CPR1 NADPH--cytochrome P450 reductase 1 Artemisia annua
Q0J705 4.93e-66 232 28 18 613 1 CPR2 NADPH--cytochrome P450 reductase 2 Oryza sativa subsp. japonica
C5YJG8 7.35e-63 223 29 14 553 1 CPR NADPH--cytochrome P450 reductase Sorghum bicolor
P37040 2.18e-62 221 29 21 643 1 Por NADPH--cytochrome P450 reductase Mus musculus
Q07994 3.82e-62 221 30 26 602 2 None NADPH--cytochrome P450 reductase Musca domestica
P00388 1.26e-61 219 29 20 642 1 Por NADPH--cytochrome P450 reductase Rattus norvegicus
Q05001 2.2e-61 219 29 17 568 2 CPR NADPH--cytochrome P450 reductase Catharanthus roseus
P00389 2.88e-61 218 29 17 620 1 POR NADPH--cytochrome P450 reductase Oryctolagus cuniculus
P16435 3.52e-61 218 29 17 602 1 POR NADPH--cytochrome P450 reductase Homo sapiens
P37116 4.22e-61 218 28 16 615 1 None NADPH--cytochrome P450 reductase Vigna radiata var. radiata
Q6NRG5 1.12e-60 215 27 21 605 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Xenopus laevis
Q9UHB4 1.23e-60 215 28 18 603 1 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Homo sapiens
A0A7T9QPQ1 1.69e-60 217 28 12 566 2 CPR NADPH--cytochrome P450 reductase Piper nigrum
P37039 2.15e-60 216 29 20 621 2 Por NADPH--cytochrome P450 reductase Cavia porcellus
Q7X7K8 2.78e-60 216 28 16 615 1 CPR1 NADPH--cytochrome P450 reductase 1 Oryza sativa subsp. japonica
Q27597 4.13e-60 215 30 25 603 1 Cpr NADPH--cytochrome P450 reductase Drosophila melanogaster
A2AI05 4.74e-60 213 28 17 604 2 Ndor1 NADPH-dependent diflavin oxidoreductase 1 Mus musculus
P04175 1.05e-59 214 29 18 620 1 POR NADPH--cytochrome P450 reductase Sus scrofa
O08394 2.11e-59 218 30 21 575 1 cypD Bifunctional cytochrome P450/NADPH--P450 reductase 1 Bacillus subtilis (strain 168)
P52674 5.12e-59 209 33 3 339 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
P52674 1.69e-44 169 51 1 144 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
Q0CMM0 1.9e-58 211 26 20 637 3 cprA NADPH--cytochrome P450 reductase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q1JPJ0 2.4e-58 209 27 18 604 2 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Bos taurus
Q3SYT8 4.22e-58 209 29 23 623 2 POR NADPH--cytochrome P450 reductase Bos taurus
Q6PFP6 8.88e-58 207 27 17 599 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Danio rerio
Q9SB48 2.04e-57 208 27 17 614 1 ATR1 NADPH--cytochrome P450 reductase 1 Arabidopsis thaliana
Q06518 9.01e-57 210 30 21 593 1 Nos2 Nitric oxide synthase, inducible Rattus norvegicus
Q54JL0 2.27e-56 204 27 20 581 2 redC NADPH-dependent diflavin oxidoreductase 1 Dictyostelium discoideum
P19618 3.31e-56 203 27 18 619 1 por NADPH--cytochrome P450 reductase (Fragments) Salmo trutta
Q26240 3.42e-56 208 27 22 647 2 None Nitric oxide synthase, salivary gland Rhodnius prolixus
Q81BF4 4.76e-56 208 28 18 595 1 CYP102A5 Bifunctional cytochrome P450/NADPH--P450 reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A2QS05 1.23e-55 203 27 21 637 2 cprA NADPH--cytochrome P450 reductase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P16603 1.6e-55 202 28 23 636 1 NCP1 NADPH--cytochrome P450 reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2UHA7 2.33e-55 202 27 21 637 3 cprA NADPH--cytochrome P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P79290 1.32e-54 204 30 20 593 2 NOS2 Nitric oxide synthase, inducible Sus scrofa
P14779 1.41e-54 203 30 20 574 1 cyp102A1 Bifunctional cytochrome P450/NADPH--P450 reductase Priestia megaterium (strain ATCC 14581 / DSM 32 / CCUG 1817 / JCM 2506 / NBRC 15308 / NCIMB 9376 / NCTC 10342 / NRRL B-14308 / VKM B-512 / Ford 19)
P29477 2.21e-54 203 30 23 601 1 Nos2 Nitric oxide synthase, inducible Mus musculus
Q5BFT5 3.83e-54 199 25 19 637 3 cprA NADPH--cytochrome P450 reductase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q00141 3.85e-54 199 27 21 636 1 cprA NADPH--cytochrome P450 reductase Aspergillus niger
Q4WM67 9.94e-54 197 26 20 637 1 cprA NADPH--cytochrome P450 reductase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q90703 1.08e-53 201 28 21 612 2 NOS2 Nitric oxide synthase, inducible Gallus gallus
O62699 2.56e-53 200 29 21 596 2 NOS2 Nitric oxide synthase, inducible Canis lupus familiaris
P35228 2.41e-52 197 29 22 595 1 NOS2 Nitric oxide synthase, inducible Homo sapiens
Q27995 2.49e-52 197 29 21 600 2 NOS2 Nitric oxide synthase, inducible Bos taurus
Q28314 9.52e-52 195 29 21 608 2 NOS2 Nitric oxide synthase, inducible Capra hircus
O54705 5.67e-51 193 29 21 601 2 NOS2 Nitric oxide synthase, inducible Cavia porcellus
Q6BR77 7.4e-51 188 27 18 610 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O08336 3.93e-50 190 27 17 595 1 cypB Bifunctional cytochrome P450/NADPH--P450 reductase 2 Bacillus subtilis (strain 168)
Q6NPS8 6.37e-50 186 27 21 622 1 ATR3 NADPH-dependent diflavin oxidoreductase 1 Arabidopsis thaliana
Q9HDG2 6.67e-50 187 26 27 685 2 CPR NADPH--cytochrome P450 reductase Phanerodontia chrysosporium
O19132 1.32e-48 186 26 19 645 2 NOS1 Nitric oxide synthase 1 Oryctolagus cuniculus
B1B557 2.8e-48 185 31 20 523 2 NSL Nitric oxide synthase-like protein Bombyx mori
B1B557 4.88e-05 50 30 1 71 2 NSL Nitric oxide synthase-like protein Bombyx mori
P37201 3.08e-48 182 26 24 654 3 NCP1 NADPH--cytochrome P450 reductase Candida tropicalis
P29475 5.6e-48 184 26 20 643 1 NOS1 Nitric oxide synthase 1 Homo sapiens
P50126 9.59e-48 181 26 22 634 2 NCP1 NADPH--cytochrome P450 reductase Candida maltosa
Q9Z0J4 8.24e-47 181 26 20 643 1 Nos1 Nitric oxide synthase 1 Mus musculus
P29476 6.77e-46 178 25 20 643 1 Nos1 Nitric oxide synthase 1 Rattus norvegicus
P29473 5.23e-45 175 27 20 644 1 NOS3 Nitric oxide synthase 3 Bos taurus
Q8C1A3 5.44e-45 173 29 11 427 1 Mtrr Methionine synthase reductase Mus musculus
Q8C1A3 4.38e-14 79 29 4 183 1 Mtrr Methionine synthase reductase Mus musculus
O61608 4.25e-44 172 28 20 526 2 None Nitric oxide synthase Anopheles stephensi
O61608 1.02e-05 52 30 5 125 2 None Nitric oxide synthase Anopheles stephensi
Q28969 1.31e-43 171 26 22 654 1 NOS3 Nitric oxide synthase 3 Sus scrofa
Q5AD27 4.32e-43 166 27 22 599 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P70313 5.01e-43 169 25 21 644 1 Nos3 Nitric oxide synthase 3 Mus musculus
P29474 5.15e-43 169 26 21 644 1 NOS3 Nitric oxide synthase 3 Homo sapiens
O94613 8.02e-43 165 25 21 592 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q62600 2.16e-42 167 25 21 644 1 Nos3 Nitric oxide synthase 3 Rattus norvegicus
Q29498 2.4e-42 167 27 16 526 2 NOS1 Nitric oxide synthase 1 Ovis aries
Q27571 4.33e-42 166 27 16 529 1 Nos Nitric oxide synthase Drosophila melanogaster
Q27571 3.72e-06 53 31 1 92 1 Nos Nitric oxide synthase Drosophila melanogaster
Q4HZQ1 1.53e-40 159 25 20 602 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q94IN5 2.06e-40 162 25 21 582 1 PNO Pyruvate dehydrogenase [NADP(+)], mitochondrial Euglena gracilis
Q8T8C0 2.91e-40 161 27 19 525 2 NOS Nitric oxide synthase Bombyx mori
Q8T8C0 5.24e-05 50 32 1 71 2 NOS Nitric oxide synthase Bombyx mori
Q498R1 3.12e-40 159 29 11 404 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q498R1 3.66e-13 76 31 3 141 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q4JIJ2 4.61e-40 159 28 13 450 2 MTRR Methionine synthase reductase Bos taurus
Q4JIJ2 8.67e-15 81 30 4 179 2 MTRR Methionine synthase reductase Bos taurus
O19114 5.98e-40 155 31 14 397 2 NOS2 Nitric oxide synthase, inducible (Fragment) Oryctolagus cuniculus
Q9UBK8 6.32e-39 155 27 10 454 1 MTRR Methionine synthase reductase Homo sapiens
Q9UBK8 3.01e-12 73 31 4 147 1 MTRR Methionine synthase reductase Homo sapiens
Q968X7 3.56e-38 155 23 28 728 2 PFOR Pyruvate dehydrogenase [NADP(+)] Cryptosporidium parvum
Q9TUX8 3.23e-37 152 25 21 644 2 NOS3 Nitric oxide synthase 3 Canis lupus familiaris
Q6CVG8 4.2e-37 149 26 23 638 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6FRH1 6.76e-37 149 24 24 625 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q12181 8.24e-36 145 24 24 625 1 TAH18 NADPH-dependent diflavin oxidoreductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39692 3.01e-35 145 31 17 392 1 MET10 Sulfite reductase [NADPH] flavoprotein component Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q75B78 3.59e-35 144 25 27 629 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P36587 6.8e-35 143 25 28 655 2 ccr1 NADPH--cytochrome P450 reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WU59 9.79e-35 142 25 23 663 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6CCH0 4.83e-34 141 24 24 633 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q5BB41 4.98e-34 140 24 23 639 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P79209 5.02e-34 142 25 20 645 2 NOS3 Nitric oxide synthase 3 Ovis aries
Q4P3D8 3.74e-33 138 24 27 652 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Ustilago maydis (strain 521 / FGSC 9021)
R0IGL9 5.99e-33 139 25 22 594 1 CYP505U2 Self-sufficient cytochrome P450 monooxygenase CYP505U2 Exserohilum turcicum (strain 28A)
I7ZK32 1.06e-31 135 26 25 570 1 CYP505C3 Self-sufficient cytochrome P450 monooxygenase CYP505C3 Aspergillus oryzae (strain 3.042)
A0A0C3HJL3 1.92e-31 134 25 21 592 1 CYP505AG1 Self-sufficient cytochrome P450 monooxygenase CYP505AG1 Oidiodendron maius (strain Zn)
P97270 2.11e-31 134 25 15 562 2 NOS3 Nitric oxide synthase 3 Cavia porcellus
P0CP12 3.18e-31 132 25 13 398 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP12 6.11e-13 75 34 2 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP13 3.18e-31 132 25 13 398 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP13 6.11e-13 75 34 2 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q09878 3.49e-30 130 28 13 390 3 SPCC584.01c Probable sulfite reductase [NADPH] flavoprotein component Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Y8G7 1.56e-28 125 24 24 583 1 CYP505 Bifunctional cytochrome P450/NADPH--P450 reductase Fusarium oxysporum
O61309 4.07e-27 120 26 16 519 2 NOS Nitric oxide synthase Lymnaea stagnalis
A0A455R5H4 5.66e-27 120 25 26 578 1 ascE Bifunctional cytochrome P450/NADPH--P450 reductase ascE Acremonium egyptiacum
G5EJN7 2.14e-24 112 24 23 579 1 CYP505D6 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Phanerodontia chrysosporium
Q0D1W9 3.68e-24 111 25 22 561 1 CYP505E3 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G9MLG2 5.61e-24 110 25 19 577 1 CYP505P1 Self-sufficient cytochrome P450 monooxygenase CYP505P1 Hypocrea virens (strain Gv29-8 / FGSC 10586)
Q9HGE0 1.27e-23 109 24 21 602 2 FUM6 Bifunctional cytochrome P450/NADPH--P450 reductase Gibberella moniliformis (strain M3125 / FGSC 7600)
A2QLV1 3.18e-23 108 25 21 544 1 CYP505E1 Self-sufficient cytochrome P450 monooxygenase CYP505E1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G7XMT1 3.42e-23 108 24 20 544 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus kawachii (strain NBRC 4308)
Q2UNA2 4.88e-23 108 23 25 609 2 CYP505A3 Bifunctional cytochrome P450/NADPH--P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A100IM63 6.06e-23 107 24 20 544 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus niger
A0A3G9HRC2 3.22e-22 105 24 20 590 3 ALT2 Bifunctional cytochrome P450/NADPH--P450 reductase ALT2 Alternaria alternata
A0A0A2J1Z6 1.23e-20 100 23 21 551 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium expansum
Q17574 2.07e-19 95 24 14 408 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q17574 1.38e-09 64 29 4 147 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
A2Y8E0 2.74e-19 93 31 10 234 3 OsI_21320 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. indica
A0A101MN42 2.9e-19 95 25 25 563 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium freii
P41344 3.64e-19 93 31 10 234 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. japonica
Q6ZFJ3 3.65e-19 93 31 11 234 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. japonica
Q9US28 4.5e-19 94 29 8 235 3 SPAC1783.01 Uncharacterized FAD-binding protein C1783.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q00598 7.3e-19 92 29 10 234 1 PETH Ferredoxin--NADP reductase, cyanelle Cyanophora paradoxa
Q8W493 8.19e-19 92 31 10 234 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Arabidopsis thaliana
Q9S9P8 1.02e-18 92 32 10 237 1 RFNR2 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic Arabidopsis thaliana
A2WZT1 1.4e-18 91 30 11 234 3 OsI_05475 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. indica
A0A0G4P2K0 1.68e-18 93 24 26 565 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium camemberti (strain FM 013)
Q41014 7.32e-18 89 30 10 241 2 None Ferredoxin--NADP reductase, root isozyme, chloroplastic Pisum sativum
P41345 1.65e-17 88 32 9 237 1 Os03g0784700 Ferredoxin--NADP reductase, root isozyme, chloroplastic Oryza sativa subsp. japonica
Q9FKW6 1.77e-17 87 29 7 233 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Arabidopsis thaliana
P10933 2.11e-17 87 30 8 233 1 PETH Ferredoxin--NADP reductase, leaf isozyme, chloroplastic Pisum sativum
P41346 2.28e-17 87 30 8 233 2 PETH Ferredoxin--NADP reductase, chloroplastic Vicia faba
O04397 3.83e-17 87 31 11 239 2 None Ferredoxin--NADP reductase, root-type isozyme, chloroplastic Nicotiana tabacum
O04977 4.03e-17 87 30 8 233 2 PETH Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic Nicotiana tabacum
P00454 5.72e-17 85 30 8 234 1 petH Ferredoxin--NADP reductase Spirulina sp.
Q09744 7.12e-17 87 24 13 407 3 SPBC12C2.03c Uncharacterized FAD-binding protein C12C2.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O23877 7.97e-17 86 31 9 254 1 Os07g0147900 Ferredoxin--NADP reductase, embryo isozyme, chloroplastic Oryza sativa subsp. japonica
P00455 8.61e-17 85 29 8 233 1 PETH Ferredoxin--NADP reductase, chloroplastic Spinacia oleracea
P53991 2.79e-16 84 32 9 235 1 PETH Ferredoxin--NADP reductase, chloroplastic Chlamydomonas reinhardtii
Q9M0V6 1.1e-15 82 31 10 237 2 RFNR1 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic Arabidopsis thaliana
P41343 3.51e-15 80 28 7 233 2 PETH Ferredoxin--NADP reductase, chloroplastic Mesembryanthemum crystallinum
Q93RE3 1.01e-14 79 33 8 189 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P31973 2.1e-14 79 30 7 189 1 petH Ferredoxin--NADP reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q55318 6.32e-14 77 27 9 237 1 petH Ferredoxin--NADP reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P21890 3.55e-13 75 28 12 242 1 petH Ferredoxin--NADP reductase Nostoc sp. (strain ATCC 29151 / PCC 7119)
Q44549 1e-12 73 28 12 242 3 petH Ferredoxin--NADP reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P58558 1e-12 73 28 12 242 3 petH Ferredoxin--NADP reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q47418 5.98e-12 67 30 1 124 3 None Flavodoxin YqcA Pectobacterium carotovorum subsp. carotovorum
Q9KVY6 1.48e-10 63 33 3 127 3 mioC Protein MioC homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44813 6.43e-09 58 27 3 147 3 mioC Protein MioC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9L6A2 8.94e-09 58 28 4 144 3 mioC Protein MioC homolog Pasteurella multocida (strain Pm70)
Q92037 9.43e-09 58 29 2 109 2 nos2 Nitric oxide synthase, inducible (Fragment) Carassius auratus
Q92091 1.81e-08 60 28 5 146 2 nos2 Nitric oxide synthase, inducible (Fragment) Oncorhynchus mykiss
Q9AIX6 2.43e-08 60 32 10 193 1 boxA Benzoyl-CoA oxygenase component A Aromatoleum evansii
Q5REF9 3.35e-08 60 25 5 197 2 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Pongo abelii
Q9NV66 3.62e-08 60 25 5 197 1 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Homo sapiens
Q2KHP8 5.25e-08 59 26 5 178 2 tyw1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Xenopus laevis
P65369 6.51e-08 55 23 2 147 3 yqcA Uncharacterized protein YqcA Shigella flexneri
P65367 6.51e-08 55 23 2 147 1 yqcA Flavodoxin YqcA Escherichia coli (strain K12)
P65368 6.51e-08 55 23 2 147 3 yqcA Uncharacterized protein YqcA Escherichia coli O157:H7
P58208 7.74e-07 52 26 4 147 3 mioC Protein MioC Escherichia coli O157:H7
P03817 9.29e-07 52 26 4 147 1 mioC Protein MioC Escherichia coli (strain K12)
A9FRJ0 7.49e-06 51 24 8 212 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
P47169 1.76e-05 52 26 3 154 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18086 2.64e-05 47 26 2 129 3 Desal_0805 Flavodoxin Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q01096 4.64e-05 47 31 5 141 3 None Flavodoxin Megalodesulfovibrio gigas
O34737 4.65e-05 47 25 1 130 3 ykuN Probable flavodoxin 1 Bacillus subtilis (strain 168)
P26492 0.000172 45 22 0 143 1 None Flavodoxin Desulfovibrio desulfuricans
P80312 0.000216 45 23 0 143 1 Ddes_1951 Flavodoxin Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q6NUM6 0.000692 46 26 2 106 1 TYW1B S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1B Homo sapiens

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11085
Feature type CDS
Gene cysJ
Product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
Location 2439718 - 2441532 (strand: -1)
Length 1815 (nucleotides) / 604 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_83
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00175 Oxidoreductase NAD-binding domain
PF00258 Flavodoxin
PF00667 FAD binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0369 Nucleotide transport and metabolism (F)
Inorganic ion transport and metabolism (P)		 FP Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00380 sulfite reductase (NADPH) flavoprotein alpha-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MSNQPPLLSMLPLTQEQLNKLQDVTKDLTPAQFAWLSGYFWGQFNQHSSTKDELVSVQSQVPQQETITVISASQTGNARRLAEQLRDKLVGNQLNVELYSASEYKFKQIHKTTTLIIITSTQGEGEPPEEAITFYKYLHSKKAAPMKQTAYAVLSLGDSSYEHFCQAGKDFDHQLAQLGATSLLERLDADVDYQADADKWITQLTDILKIRIPEQNTQVLQQTQSGTTDSVDTARYHRDAPFSATLLTNQKITGRHSDKDIRHIEISLAGSELQYLPGDALGVWFKNSEEKVDELITLLWLTGDEQVNVKSQTLTLKEALLHHVELTQNSAPIIKAYAQLSRHEELLSLVADKSKLQQYAQTYPINEMVRQYSAQPNAQEFIDILRPLTPRLYSIASSQQEVDDEVHLTLGVVRYNVDQRAYTGGASGFLADQLQEGDTVNVFIERNDHFRLPEDNQVPVIMIGPGTGIAPFRGFMQQRESEGATGKNWLFFGNPHFVEDFLYQVEWQRYVKSGLLTRIDLAWSRDQADKIYVQDKLREQGQEIWQWLQQGAYLYVCGDASRMAKDVEQTLLEIVMTHGNKNIEQADDYLSELRLARRYQRDVY

Flanking regions ( +/- flanking 50bp)

ACCACAATAACAGCACCGATGCAGTGCAATGTTTTTTTAAGGCAGGATCGATGAGCAATCAACCCCCATTATTATCAATGCTTCCATTAACACAGGAGCAATTGAATAAATTACAGGATGTGACGAAAGACTTAACTCCAGCCCAATTTGCTTGGCTTTCTGGCTATTTTTGGGGGCAATTCAATCAGCATTCATCCACTAAAGATGAACTGGTAAGTGTACAAAGTCAGGTTCCCCAACAAGAAACCATCACCGTGATATCAGCATCACAAACTGGCAATGCACGTCGTTTAGCTGAACAATTACGCGATAAATTGGTTGGTAATCAACTTAATGTTGAGCTCTATAGTGCGAGTGAATATAAATTTAAGCAGATCCACAAAACGACAACCTTAATTATTATTACCTCAACACAGGGGGAAGGTGAACCTCCTGAAGAAGCCATCACATTTTATAAATATTTGCACTCTAAAAAAGCCGCGCCAATGAAGCAAACGGCTTATGCTGTACTGAGTCTCGGCGATAGTAGCTATGAACATTTTTGCCAAGCAGGTAAAGATTTTGATCATCAATTGGCGCAACTTGGCGCGACCAGTCTATTAGAAAGATTAGATGCAGATGTTGATTATCAAGCTGACGCTGATAAATGGATAACTCAGCTGACTGATATTTTAAAAATACGTATACCTGAGCAAAACACTCAAGTATTACAACAAACACAATCAGGAACAACCGACAGTGTCGATACCGCACGCTACCATCGTGATGCACCTTTTAGTGCCACTTTATTAACTAATCAGAAGATCACCGGTCGACATTCAGATAAAGATATCCGTCATATTGAAATCAGTCTAGCAGGCTCTGAATTGCAATATCTTCCCGGAGATGCACTAGGAGTATGGTTTAAGAATTCGGAAGAAAAAGTGGATGAGCTTATTACCCTATTATGGTTAACGGGGGATGAGCAGGTAAATGTTAAATCACAAACATTAACGTTAAAAGAAGCATTATTGCATCATGTTGAATTAACTCAAAATAGTGCACCAATTATTAAAGCGTATGCCCAATTATCCCGCCACGAAGAGTTATTATCGCTGGTGGCTGATAAAAGCAAACTTCAGCAATATGCGCAAACCTACCCAATTAATGAAATGGTACGTCAATATAGTGCGCAACCTAATGCTCAAGAGTTTATTGATATATTGCGCCCATTAACTCCACGTCTTTACTCCATCGCTTCATCACAACAAGAAGTTGATGATGAAGTTCATCTTACCTTAGGTGTTGTTCGTTATAACGTCGATCAGCGTGCTTATACAGGAGGTGCCTCAGGGTTCTTAGCTGATCAACTTCAAGAAGGCGATACAGTAAACGTTTTTATTGAACGTAATGATCATTTTCGTTTACCTGAAGATAATCAAGTCCCTGTGATTATGATTGGCCCGGGGACGGGGATTGCGCCTTTTAGAGGGTTTATGCAACAACGTGAAAGTGAAGGTGCGACGGGGAAAAACTGGCTCTTTTTTGGCAATCCTCATTTTGTAGAAGATTTCCTTTATCAAGTGGAATGGCAACGTTATGTCAAAAGCGGGTTGTTAACACGTATTGATTTAGCATGGTCGCGTGATCAAGCCGATAAAATTTATGTGCAAGATAAATTACGGGAGCAAGGTCAGGAAATTTGGCAATGGTTACAGCAAGGTGCTTATCTCTACGTTTGTGGTGATGCATCAAGAATGGCTAAAGATGTTGAACAAACATTGTTAGAAATAGTAATGACCCATGGCAATAAAAATATTGAACAAGCAGATGATTATTTAAGTGAGCTACGTTTAGCACGTCGTTATCAGAGGGATGTTTATTAAAATGAAATCACAAACTCAAGCGCCCTTAGTGGTTGAAGGAAAACTATCTG