Homologs in group_83

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03155 FBDBKF_03155 45.2 Morganella morganii S1 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
FBDBKF_19010 FBDBKF_19010 100.0 Morganella morganii S1 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
EHELCC_07380 EHELCC_07380 45.2 Morganella morganii S2 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
EHELCC_18755 EHELCC_18755 100.0 Morganella morganii S2 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
NLDBIP_07705 NLDBIP_07705 45.2 Morganella morganii S4 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
NLDBIP_18550 NLDBIP_18550 100.0 Morganella morganii S4 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
LHKJJB_07240 LHKJJB_07240 45.2 Morganella morganii S3 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
LHKJJB_18625 LHKJJB_18625 100.0 Morganella morganii S3 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
HKOGLL_03690 HKOGLL_03690 45.2 Morganella morganii S5 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
F4V73_RS11765 F4V73_RS11765 43.9 Morganella psychrotolerans cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
PMI_RS11085 PMI_RS11085 47.0 Proteus mirabilis HI4320 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit

Distribution of the homologs in the orthogroup group_83

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_83

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L6 0.0 565 48 1 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MJ63 0.0 543 48 2 594 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Cronobacter sakazakii (strain ATCC BAA-894)
A6TD49 0.0 541 48 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1R7T4 0.0 539 47 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA2 0.0 539 47 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEV0 0.0 539 47 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O1:K1 / APEC
Q8FEI7 0.0 537 47 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P38039 0.0 536 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X7U1 0.0 535 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O157:H7
A4WDW1 0.0 535 46 1 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Enterobacter sp. (strain 638)
Q31XM4 0.0 535 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella boydii serotype 4 (strain Sb227)
B1IU77 0.0 535 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZQK7 0.0 535 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YY94 0.0 534 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella sonnei (strain Ss046)
A8A3P5 0.0 534 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O9:H4 (strain HS)
Q32CG3 0.0 534 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella dysenteriae serotype 1 (strain Sd197)
A9N2E6 0.0 534 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P38038 0.0 534 46 2 595 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain K12)
Q57KH7 0.0 533 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella choleraesuis (strain SC-B67)
Q6D1A1 0.0 533 46 2 609 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8ANX1 0.0 530 46 1 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83QD9 0.0 529 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri
Q0T1I8 0.0 529 46 2 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri serotype 5b (strain 8401)
Q8Z458 0.0 529 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhi
A9MF16 0.0 527 46 2 590 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8G9X6 0.0 526 45 2 594 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Serratia proteamaculans (strain 568)
Q5PEH7 0.0 526 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5NRM1 3.88e-180 525 43 3 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2NVN4 3.71e-178 520 45 2 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Sodalis glossinidius (strain morsitans)
A1JJS2 1.29e-176 516 47 1 581 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q65T53 2.79e-174 509 43 5 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1LTP1 1.73e-167 492 42 3 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Baumannia cicadellinicola subsp. Homalodisca coagulata
Q8ZBN6 1.5e-165 488 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis
Q1C3Z0 1.5e-165 488 46 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLZ0 3.1e-165 487 44 5 616 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPY5 6.21e-165 486 44 5 616 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis (strain Pestoides F)
Q1CLS8 6.21e-165 486 44 5 616 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Nepal516)
Q66ED4 2.27e-164 485 44 6 619 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9KUX4 4.68e-156 464 41 4 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9JS45 1.87e-155 462 42 5 598 3 cysJ1 Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q87L90 2.11e-155 462 39 2 602 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5F3I4 4.3e-155 461 41 4 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1KU06 4.18e-153 456 43 4 585 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q8DCK2 1.78e-152 454 40 6 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain CMCP6)
A9LZ73 2.17e-152 454 43 5 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C (strain 053442)
Q7MHA5 7.26e-152 453 40 6 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain YJ016)
P57503 7.87e-152 452 37 3 591 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9JUD8 6.13e-151 450 43 5 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6LM58 2.39e-150 449 41 4 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photobacterium profundum (strain SS9)
Q5E841 3.86e-150 448 41 5 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8K9D3 1.26e-147 442 38 3 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8EAZ9 7.75e-145 435 39 4 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HFL6 1.54e-144 434 39 4 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-4)
Q0HYB4 1.97e-144 434 40 6 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-7)
Q7VQH2 3.54e-144 433 38 5 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Blochmanniella floridana
A0KTH4 6.2e-144 432 39 6 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain ANA-3)
O32214 1.48e-138 419 37 5 610 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Bacillus subtilis (strain 168)
Q54B10 1.49e-80 268 30 13 584 2 redA NADPH oxidoreductase A Dictyostelium discoideum
Q0J705 6.04e-74 253 31 17 611 1 CPR2 NADPH--cytochrome P450 reductase 2 Oryza sativa subsp. japonica
A0A2U1LIM9 2.58e-73 251 32 20 609 1 CPR1 NADPH--cytochrome P450 reductase 1 Artemisia annua
A0A2U1KZS6 3.82e-71 245 31 20 612 3 CPR2 NADPH--cytochrome P450 reductase 2 Artemisia annua
C5YJG8 1.03e-70 244 31 13 555 1 CPR NADPH--cytochrome P450 reductase Sorghum bicolor
P16435 1.29e-70 243 31 19 617 1 POR NADPH--cytochrome P450 reductase Homo sapiens
A0A7T9QPQ1 1.53e-69 241 31 16 562 2 CPR NADPH--cytochrome P450 reductase Piper nigrum
P04175 1.21e-68 238 31 17 604 1 POR NADPH--cytochrome P450 reductase Sus scrofa
Q3SYT8 1.35e-68 238 31 18 604 2 POR NADPH--cytochrome P450 reductase Bos taurus
P37039 4.84e-68 236 31 20 605 2 Por NADPH--cytochrome P450 reductase Cavia porcellus
Q653S9 4.79e-67 234 31 18 564 1 CPR3 NADPH--cytochrome P450 reductase 3 Oryza sativa subsp. japonica
Q7X7K8 4.8e-67 234 31 17 564 1 CPR1 NADPH--cytochrome P450 reductase 1 Oryza sativa subsp. japonica
Q05001 5.2e-67 234 32 18 568 2 CPR NADPH--cytochrome P450 reductase Catharanthus roseus
P00389 1.03e-66 233 31 21 606 1 POR NADPH--cytochrome P450 reductase Oryctolagus cuniculus
P37040 2.73e-66 231 30 22 604 1 Por NADPH--cytochrome P450 reductase Mus musculus
Q9SUM3 7.32e-66 231 31 21 615 1 ATR2 NADPH--cytochrome P450 reductase 2 Arabidopsis thaliana
P00388 1.15e-65 230 31 23 605 1 Por NADPH--cytochrome P450 reductase Rattus norvegicus
P37116 1.03e-62 222 30 20 620 1 None NADPH--cytochrome P450 reductase Vigna radiata var. radiata
Q9SB48 1.56e-62 222 29 18 616 1 ATR1 NADPH--cytochrome P450 reductase 1 Arabidopsis thaliana
Q55CT1 1.8e-62 221 30 18 550 2 redB NADPH--cytochrome P450 reductase Dictyostelium discoideum
Q54JL0 3.53e-61 217 27 18 573 2 redC NADPH-dependent diflavin oxidoreductase 1 Dictyostelium discoideum
P79290 7.11e-60 219 30 24 613 2 NOS2 Nitric oxide synthase, inducible Sus scrofa
Q9UHB4 1.25e-59 212 28 16 597 1 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Homo sapiens
Q6PFP6 5.2e-59 210 30 19 595 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Danio rerio
Q6NPS8 1.12e-58 210 29 23 617 1 ATR3 NADPH-dependent diflavin oxidoreductase 1 Arabidopsis thaliana
Q27995 1.38e-58 215 30 23 612 2 NOS2 Nitric oxide synthase, inducible Bos taurus
Q28314 1.74e-58 215 30 22 595 2 NOS2 Nitric oxide synthase, inducible Capra hircus
P35228 3.6e-58 214 29 22 602 1 NOS2 Nitric oxide synthase, inducible Homo sapiens
P29475 3.8e-58 214 29 26 661 1 NOS1 Nitric oxide synthase 1 Homo sapiens
O62699 4.27e-58 214 29 20 598 2 NOS2 Nitric oxide synthase, inducible Canis lupus familiaris
Q07994 6.28e-58 209 28 19 601 2 None NADPH--cytochrome P450 reductase Musca domestica
Q90703 1.94e-57 212 29 21 604 2 NOS2 Nitric oxide synthase, inducible Gallus gallus
Q9Z0J4 2.11e-57 212 29 26 655 1 Nos1 Nitric oxide synthase 1 Mus musculus
Q27597 2.31e-57 207 29 16 599 1 Cpr NADPH--cytochrome P450 reductase Drosophila melanogaster
Q06518 2.95e-57 211 30 22 604 1 Nos2 Nitric oxide synthase, inducible Rattus norvegicus
P19618 1.36e-56 204 27 18 598 1 por NADPH--cytochrome P450 reductase (Fragments) Salmo trutta
P29476 1.77e-56 209 29 26 655 1 Nos1 Nitric oxide synthase 1 Rattus norvegicus
A2AI05 3.31e-56 202 28 18 596 2 Ndor1 NADPH-dependent diflavin oxidoreductase 1 Mus musculus
P29477 1.17e-55 206 29 23 603 1 Nos2 Nitric oxide synthase, inducible Mus musculus
O54705 3.49e-55 205 29 23 604 2 NOS2 Nitric oxide synthase, inducible Cavia porcellus
O19132 4.67e-55 205 28 25 655 2 NOS1 Nitric oxide synthase 1 Oryctolagus cuniculus
Q6NRG5 5.72e-55 199 28 19 600 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Xenopus laevis
O08394 8.93e-55 204 31 23 576 1 cypD Bifunctional cytochrome P450/NADPH--P450 reductase 1 Bacillus subtilis (strain 168)
Q1JPJ0 5.34e-54 196 29 17 598 2 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Bos taurus
Q81BF4 7.86e-54 201 28 21 609 1 CYP102A5 Bifunctional cytochrome P450/NADPH--P450 reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q29498 2.27e-53 200 31 22 528 2 NOS1 Nitric oxide synthase 1 Ovis aries
Q00141 1.04e-52 194 27 16 635 1 cprA NADPH--cytochrome P450 reductase Aspergillus niger
A2QS05 1.8e-52 194 26 17 645 2 cprA NADPH--cytochrome P450 reductase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P14779 5.17e-52 196 29 22 580 1 cyp102A1 Bifunctional cytochrome P450/NADPH--P450 reductase Priestia megaterium (strain ATCC 14581 / DSM 32 / CCUG 1817 / JCM 2506 / NBRC 15308 / NCIMB 9376 / NCTC 10342 / NRRL B-14308 / VKM B-512 / Ford 19)
Q0CMM0 3.75e-51 190 26 17 645 3 cprA NADPH--cytochrome P450 reductase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O08336 3.8e-51 193 28 22 603 1 cypB Bifunctional cytochrome P450/NADPH--P450 reductase 2 Bacillus subtilis (strain 168)
Q4WM67 4.95e-51 190 26 17 645 1 cprA NADPH--cytochrome P450 reductase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P50126 6.11e-51 189 27 19 635 2 NCP1 NADPH--cytochrome P450 reductase Candida maltosa
Q5BFT5 6.15e-51 189 26 16 634 3 cprA NADPH--cytochrome P450 reductase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2UHA7 1.44e-50 189 26 14 638 3 cprA NADPH--cytochrome P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P16603 9.81e-49 183 26 17 638 1 NCP1 NADPH--cytochrome P450 reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q94IN5 4.3e-48 184 29 24 586 1 PNO Pyruvate dehydrogenase [NADP(+)], mitochondrial Euglena gracilis
Q62600 8.87e-47 180 27 21 653 1 Nos3 Nitric oxide synthase 3 Rattus norvegicus
P37201 1.08e-46 177 28 22 638 3 NCP1 NADPH--cytochrome P450 reductase Candida tropicalis
Q26240 1.53e-46 179 27 22 654 2 None Nitric oxide synthase, salivary gland Rhodnius prolixus
P29474 3.56e-46 178 28 23 654 1 NOS3 Nitric oxide synthase 3 Homo sapiens
P29473 4.61e-46 178 29 25 654 1 NOS3 Nitric oxide synthase 3 Bos taurus
Q27571 5.38e-46 178 30 20 526 1 Nos Nitric oxide synthase Drosophila melanogaster
Q28969 1.55e-45 176 28 23 645 1 NOS3 Nitric oxide synthase 3 Sus scrofa
O61608 1.59e-45 176 29 21 527 2 None Nitric oxide synthase Anopheles stephensi
Q5AD27 3.7e-45 172 27 22 595 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8C1A3 3.18e-44 171 32 13 425 1 Mtrr Methionine synthase reductase Mus musculus
Q8C1A3 1.13e-11 71 32 5 147 1 Mtrr Methionine synthase reductase Mus musculus
O19114 2.36e-43 165 32 16 396 2 NOS2 Nitric oxide synthase, inducible (Fragment) Oryctolagus cuniculus
P0CP12 3.92e-43 166 25 18 612 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP13 3.92e-43 166 25 18 612 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9UBK8 2.1e-42 165 31 12 420 1 MTRR Methionine synthase reductase Homo sapiens
Q9UBK8 1.74e-10 67 32 6 153 1 MTRR Methionine synthase reductase Homo sapiens
P52674 2.31e-42 162 32 3 339 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
P52674 9.72e-33 135 42 2 173 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
Q498R1 9.41e-42 164 31 10 422 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q498R1 6.13e-11 68 32 5 151 2 Mtrr Methionine synthase reductase Rattus norvegicus
B1B557 2.52e-41 164 28 16 528 2 NSL Nitric oxide synthase-like protein Bombyx mori
Q6CVG8 7.51e-41 160 25 21 629 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9HDG2 1.04e-40 161 26 22 672 2 CPR NADPH--cytochrome P450 reductase Phanerodontia chrysosporium
Q4JIJ2 1.46e-40 160 33 16 426 2 MTRR Methionine synthase reductase Bos taurus
Q4JIJ2 8.77e-11 68 32 5 146 2 MTRR Methionine synthase reductase Bos taurus
Q6BR77 2.04e-40 159 25 21 612 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O94613 1.88e-39 155 24 18 603 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39692 2.58e-38 155 32 15 383 1 MET10 Sulfite reductase [NADPH] flavoprotein component Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8T8C0 3.32e-38 154 27 19 527 2 NOS Nitric oxide synthase Bombyx mori
P36587 1.52e-37 151 28 25 644 2 ccr1 NADPH--cytochrome P450 reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4HZQ1 5.09e-37 149 26 18 591 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6CCH0 2.92e-35 144 25 25 623 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P70313 4.05e-35 145 40 8 232 1 Nos3 Nitric oxide synthase 3 Mus musculus
P70313 7.16e-10 65 23 7 304 1 Nos3 Nitric oxide synthase 3 Mus musculus
P97270 1.5e-34 143 26 18 571 2 NOS3 Nitric oxide synthase 3 Cavia porcellus
Q12181 3.51e-34 140 24 25 628 1 TAH18 NADPH-dependent diflavin oxidoreductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
I7ZK32 4.55e-34 142 29 22 558 1 CYP505C3 Self-sufficient cytochrome P450 monooxygenase CYP505C3 Aspergillus oryzae (strain 3.042)
Q09878 1.07e-33 140 30 12 368 3 SPCC584.01c Probable sulfite reductase [NADPH] flavoprotein component Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5BB41 1.1e-33 139 26 26 642 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WU59 1.83e-33 139 24 21 650 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
R0IGL9 2.01e-33 140 28 21 534 1 CYP505U2 Self-sufficient cytochrome P450 monooxygenase CYP505U2 Exserohilum turcicum (strain 28A)
Q9HGE0 1.34e-32 137 26 22 603 2 FUM6 Bifunctional cytochrome P450/NADPH--P450 reductase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q6FRH1 1.53e-32 135 24 26 625 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9TUX8 5.22e-32 135 39 9 227 2 NOS3 Nitric oxide synthase 3 Canis lupus familiaris
Q9TUX8 3.02e-07 57 23 8 304 2 NOS3 Nitric oxide synthase 3 Canis lupus familiaris
Q9Y8G7 3.05e-31 133 26 20 546 1 CYP505 Bifunctional cytochrome P450/NADPH--P450 reductase Fusarium oxysporum
Q4P3D8 4.59e-31 132 24 24 648 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Ustilago maydis (strain 521 / FGSC 9021)
A0A455R5H4 1.58e-30 131 26 28 603 1 ascE Bifunctional cytochrome P450/NADPH--P450 reductase ascE Acremonium egyptiacum
O61309 6.94e-30 129 26 17 534 2 NOS Nitric oxide synthase Lymnaea stagnalis
A0A100IM63 1.65e-29 128 27 23 543 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus niger
A0A0C3HJL3 3.41e-29 127 26 20 551 1 CYP505AG1 Self-sufficient cytochrome P450 monooxygenase CYP505AG1 Oidiodendron maius (strain Zn)
G5EJN7 7.48e-29 125 27 28 592 1 CYP505D6 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Phanerodontia chrysosporium
Q968X7 8.06e-29 126 24 25 662 2 PFOR Pyruvate dehydrogenase [NADP(+)] Cryptosporidium parvum
G7XMT1 2.8e-28 124 26 23 543 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus kawachii (strain NBRC 4308)
A0A0A2J1Z6 8.37e-28 122 28 27 558 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium expansum
Q75B78 1.17e-27 121 24 26 628 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
G9MLG2 3.14e-26 117 27 25 572 1 CYP505P1 Self-sufficient cytochrome P450 monooxygenase CYP505P1 Hypocrea virens (strain Gv29-8 / FGSC 10586)
A2QLV1 4.1e-26 117 28 28 551 1 CYP505E1 Self-sufficient cytochrome P450 monooxygenase CYP505E1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0G4P2K0 9.38e-25 113 28 30 560 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium camemberti (strain FM 013)
A0A101MN42 1.13e-24 113 27 28 561 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium freii
Q0D1W9 4.78e-24 110 27 27 566 1 CYP505E3 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P79209 3.35e-23 108 36 10 237 2 NOS3 Nitric oxide synthase 3 Ovis aries
Q2UNA2 8.65e-23 107 23 21 617 2 CYP505A3 Bifunctional cytochrome P450/NADPH--P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A3G9HRC2 2.24e-20 99 22 19 613 3 ALT2 Bifunctional cytochrome P450/NADPH--P450 reductase ALT2 Alternaria alternata
Q17574 5.85e-20 97 31 10 260 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q17574 1.28e-09 64 30 4 149 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q9US28 3.26e-18 92 25 15 397 3 SPAC1783.01 Uncharacterized FAD-binding protein C1783.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93RE3 7.91e-18 89 31 11 241 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P21890 3.88e-17 87 35 10 188 1 petH Ferredoxin--NADP reductase Nostoc sp. (strain ATCC 29151 / PCC 7119)
Q09744 8.11e-17 87 26 17 430 3 SPBC12C2.03c Uncharacterized FAD-binding protein C12C2.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P58558 1.25e-16 86 34 10 192 3 petH Ferredoxin--NADP reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q44549 1.65e-16 85 34 10 192 3 petH Ferredoxin--NADP reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q92091 3.88e-15 81 28 8 256 2 nos2 Nitric oxide synthase, inducible (Fragment) Oncorhynchus mykiss
A2Y8E0 7.35e-15 80 29 9 237 3 OsI_21320 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. indica
Q6ZFJ3 8.81e-15 79 31 10 207 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. japonica
A2WZT1 1.13e-14 79 31 10 207 3 OsI_05475 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. indica
P41344 1.18e-14 79 29 9 237 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. japonica
P41345 1.46e-14 79 28 8 233 1 Os03g0784700 Ferredoxin--NADP reductase, root isozyme, chloroplastic Oryza sativa subsp. japonica
O23877 2.59e-14 78 29 7 195 1 Os07g0147900 Ferredoxin--NADP reductase, embryo isozyme, chloroplastic Oryza sativa subsp. japonica
Q8W493 4.12e-14 77 27 8 233 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Arabidopsis thaliana
P10933 4.3e-14 77 28 7 228 1 PETH Ferredoxin--NADP reductase, leaf isozyme, chloroplastic Pisum sativum
Q00598 4.97e-14 77 29 11 234 1 PETH Ferredoxin--NADP reductase, cyanelle Cyanophora paradoxa
P31973 7.02e-14 77 32 7 188 1 petH Ferredoxin--NADP reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9FKW6 1.35e-13 76 27 5 227 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Arabidopsis thaliana
O04397 3.45e-13 75 28 8 195 2 None Ferredoxin--NADP reductase, root-type isozyme, chloroplastic Nicotiana tabacum
P41346 6.88e-13 73 28 8 228 2 PETH Ferredoxin--NADP reductase, chloroplastic Vicia faba
Q9S9P8 1.8e-12 72 27 7 195 1 RFNR2 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic Arabidopsis thaliana
P00455 1.87e-12 72 28 7 228 1 PETH Ferredoxin--NADP reductase, chloroplastic Spinacia oleracea
Q41014 2.81e-12 72 27 7 195 2 None Ferredoxin--NADP reductase, root isozyme, chloroplastic Pisum sativum
P41343 2.89e-12 72 28 7 228 2 PETH Ferredoxin--NADP reductase, chloroplastic Mesembryanthemum crystallinum
P00454 3.49e-12 70 31 6 187 1 petH Ferredoxin--NADP reductase Spirulina sp.
Q9M0V6 6.01e-12 71 27 7 195 2 RFNR1 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic Arabidopsis thaliana
Q55318 1.17e-11 70 26 9 229 1 petH Ferredoxin--NADP reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9FRJ0 1.18e-11 68 28 9 214 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
O04977 8.43e-11 67 27 8 232 2 PETH Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic Nicotiana tabacum
P65369 1.02e-10 63 28 3 145 3 yqcA Uncharacterized protein YqcA Shigella flexneri
P65367 1.02e-10 63 28 3 145 1 yqcA Flavodoxin YqcA Escherichia coli (strain K12)
P65368 1.02e-10 63 28 3 145 3 yqcA Uncharacterized protein YqcA Escherichia coli O157:H7
P53991 1.49e-10 66 27 9 233 1 PETH Ferredoxin--NADP reductase, chloroplastic Chlamydomonas reinhardtii
Q47418 2.11e-10 62 29 1 127 3 None Flavodoxin YqcA Pectobacterium carotovorum subsp. carotovorum
P03817 7.14e-10 61 33 3 118 1 mioC Protein MioC Escherichia coli (strain K12)
Q9L6A2 1.25e-09 60 30 3 146 3 mioC Protein MioC homolog Pasteurella multocida (strain Pm70)
P71165 1.43e-09 60 30 2 135 1 DvMF_1143 Flavodoxin Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
P44813 4.8e-09 58 27 3 146 3 mioC Protein MioC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P58208 7.86e-09 58 33 3 118 3 mioC Protein MioC Escherichia coli O157:H7
Q9NV66 2.34e-08 60 29 4 164 1 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Homo sapiens
Q5REF9 3.27e-08 60 29 4 164 2 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Pongo abelii
O34737 1.55e-07 54 29 1 116 3 ykuN Probable flavodoxin 1 Bacillus subtilis (strain 168)
Q9KVY6 2.89e-07 53 30 2 115 3 mioC Protein MioC homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2KHP8 5.67e-07 56 27 5 168 2 tyw1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Xenopus laevis
Q01096 8.25e-06 49 30 4 142 3 None Flavodoxin Megalodesulfovibrio gigas
Q01095 8.65e-06 49 28 3 128 1 None Flavodoxin Megalodesulfovibrio gigas (strain ATCC 19364 / DSM 1382 / NCIMB 9332 / VKM B-1759)
Q9KMY3 1.51e-05 51 27 6 135 1 hmp Flavohemoprotein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9AIX6 1.54e-05 51 26 9 203 1 boxA Benzoyl-CoA oxygenase component A Aromatoleum evansii
P00323 3.57e-05 47 29 4 138 1 DVU_2680 Flavodoxin Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P26492 0.000111 46 26 3 131 1 None Flavodoxin Desulfovibrio desulfuricans
Q92037 0.00016 46 25 2 97 2 nos2 Nitric oxide synthase, inducible (Fragment) Carassius auratus
O34589 0.000274 45 28 2 125 3 ykuP Probable flavodoxin 2 Bacillus subtilis (strain 168)
P80312 0.000458 44 24 3 137 1 Ddes_1951 Flavodoxin Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8VQF4 0.000556 44 28 5 149 1 cinC Cindoxin Citrobacter braakii

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18360
Feature type CDS
Gene cysJ
Product Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
Location 18129 - 19907 (strand: -1)
Length 1779 (nucleotides) / 592 (amino acids)

Contig

Accession ZDB_705
Length 25512 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_83
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00175 Oxidoreductase NAD-binding domain
PF00258 Flavodoxin
PF00667 FAD binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0369 Nucleotide transport and metabolism (F)
Inorganic ion transport and metabolism (P)		 FP Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00380 sulfite reductase (NADPH) flavoprotein alpha-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MTSPITTSPLSVPDWQHLQPLLDRLTPQQLNWLSAWCRERAAAAPSAAEREPADILLIAASQTGNARRVAESLRDQLFSAQRAVRLVNAGDLSLTAFPESPLVVLICATTGDGDAPEEALPLFHFLHSVQAPSLTKIRYAVLALGNRAYPQFCQAGKNFDNRLHALGAQRILARVEADSDYQATADKWISQLLPELLTLTPPADEERLSRLTHNTVVQIDSQPHQRDKPQSAVLRRAVRLTAPESEKHVCQIVLDIRGTGLHYQTGDALGVYPENSPELVSELLGLLWFDGTERVTLKGKSYSLREALMTQCELTINSAPVVAAYARLSNAPELLDMIADPQQLISYAQRRPVADMVREFAVQTSAQAWVDCLPPLMPRLYSISSSPLVSPDEVHLTAGVVEFRTDGRTRYGAATRYLTHQLQPGDTVACFVEHNDHFRLPDDPEKPVIMIGPGTGIAPFRAFLQQRAAQQSGGKNWLITGNPHEKSDFLYETELTDFVRQGVLTELTTAWSRDQPQKIYVQDKLSEMRETVWRWLEQGAYVYVCGDAFRMAKDTDAALLDIIRSEGAMSAEEAQVFLNGLRTAKRYQRDVY

Flanking regions ( +/- flanking 50bp)

ATGTTGGAACGTCAGAATAATAACGAATACACTCATTTACCGGGTTTACTATGACATCGCCGATCACAACCTCTCCGCTCTCCGTGCCCGACTGGCAGCACCTGCAACCCTTACTTGACAGACTGACTCCGCAACAGCTGAATTGGTTATCGGCCTGGTGCCGTGAACGGGCAGCGGCAGCGCCGTCTGCGGCGGAACGGGAACCGGCGGATATTCTGCTGATCGCTGCGTCCCAGACCGGTAACGCCCGGCGTGTGGCGGAATCCCTTCGGGATCAGTTGTTCAGTGCGCAGCGGGCGGTACGTCTGGTAAATGCCGGGGATCTCTCACTGACTGCATTTCCGGAATCACCGCTGGTGGTGCTTATCTGTGCCACCACCGGGGATGGTGATGCACCGGAAGAAGCCCTGCCGCTGTTTCATTTCCTTCATTCTGTTCAGGCACCTTCGCTGACAAAAATCCGTTACGCGGTGCTGGCGCTGGGTAACCGGGCGTATCCGCAGTTTTGTCAGGCCGGAAAGAATTTTGATAACCGCCTGCATGCCCTCGGGGCGCAGCGGATCCTGGCGCGTGTGGAAGCAGACAGTGATTATCAGGCCACTGCAGATAAATGGATCTCTCAGTTGCTCCCTGAGTTGCTGACCCTGACACCGCCGGCAGATGAAGAGCGGCTCAGCCGTCTCACTCACAATACGGTGGTGCAGATTGATTCACAGCCGCATCAGCGTGATAAACCACAGTCTGCGGTTCTGCGCCGCGCGGTACGCCTGACCGCACCGGAATCGGAAAAGCATGTCTGTCAGATTGTGCTGGATATCCGCGGCACCGGGTTACATTATCAGACCGGTGATGCGCTGGGTGTGTATCCGGAAAACAGCCCGGAGCTGGTCAGTGAGCTGCTGGGACTGCTTTGGTTTGACGGTACTGAGCGTGTCACGCTGAAAGGAAAATCGTATTCTCTGCGTGAGGCCCTGATGACGCAGTGTGAGCTGACCATCAACAGCGCACCGGTTGTGGCGGCTTACGCCCGCCTCAGTAACGCGCCGGAACTGCTGGATATGATTGCGGATCCGCAGCAGCTGATATCGTACGCACAGCGCAGACCGGTGGCGGATATGGTTCGTGAGTTTGCCGTGCAGACCTCCGCACAGGCCTGGGTGGATTGCCTGCCGCCGCTGATGCCGCGTTTATACTCCATTTCCTCGTCGCCGCTGGTCTCACCGGATGAAGTGCATCTGACCGCCGGGGTGGTGGAGTTCCGGACTGACGGGCGCACCCGCTACGGTGCGGCAACCCGTTACCTGACGCATCAGTTACAGCCCGGGGATACGGTTGCCTGTTTTGTGGAACACAATGATCACTTCCGCCTGCCGGATGACCCGGAAAAACCGGTGATTATGATAGGGCCGGGCACCGGTATTGCGCCGTTCCGTGCGTTTCTTCAGCAGCGGGCGGCTCAGCAATCCGGCGGAAAAAACTGGCTGATTACCGGCAATCCGCATGAAAAAAGTGATTTTCTGTATGAGACAGAGCTGACAGATTTTGTGCGTCAGGGCGTGCTGACAGAGCTGACAACCGCCTGGTCGCGGGATCAGCCGCAGAAGATTTATGTGCAGGATAAGCTGTCTGAAATGCGGGAAACCGTCTGGCGCTGGCTGGAGCAGGGCGCGTATGTATATGTGTGCGGGGATGCTTTCCGGATGGCAAAAGACACGGATGCTGCATTACTGGATATTATCCGCAGTGAAGGGGCGATGTCCGCGGAAGAGGCACAGGTTTTTCTGAACGGATTACGGACAGCCAAACGTTATCAGCGGGATGTTTACTGATCTTCTGTCCGAATAACGGACGGAACAGTAGCATCTGCGCCGATCTTATG