Homologs in group_83

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03155 FBDBKF_03155 72.2 Morganella morganii S1 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
FBDBKF_19010 FBDBKF_19010 43.9 Morganella morganii S1 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
EHELCC_07380 EHELCC_07380 72.2 Morganella morganii S2 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
EHELCC_18755 EHELCC_18755 43.9 Morganella morganii S2 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
NLDBIP_07705 NLDBIP_07705 72.2 Morganella morganii S4 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
NLDBIP_18550 NLDBIP_18550 43.9 Morganella morganii S4 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
LHKJJB_07240 LHKJJB_07240 72.2 Morganella morganii S3 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
LHKJJB_18625 LHKJJB_18625 43.9 Morganella morganii S3 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
HKOGLL_03690 HKOGLL_03690 72.2 Morganella morganii S5 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
HKOGLL_18360 HKOGLL_18360 43.9 Morganella morganii S5 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
PMI_RS11085 PMI_RS11085 55.1 Proteus mirabilis HI4320 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit

Distribution of the homologs in the orthogroup group_83

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_83

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L6 0.0 777 62 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8A3P5 0.0 740 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O9:H4 (strain HS)
Q3YY94 0.0 739 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella sonnei (strain Ss046)
Q8X7U1 0.0 738 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O157:H7
B1IU77 0.0 737 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FEI7 0.0 737 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZQK7 0.0 737 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O139:H28 (strain E24377A / ETEC)
P38038 0.0 737 57 1 601 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain K12)
Q1R7T4 0.0 736 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA2 0.0 736 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEV0 0.0 736 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O1:K1 / APEC
Q31XM4 0.0 736 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella boydii serotype 4 (strain Sb227)
Q32CG3 0.0 734 57 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella dysenteriae serotype 1 (strain Sd197)
Q6D1A1 0.0 733 57 1 609 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q83QD9 0.0 729 57 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri
Q0T1I8 0.0 729 57 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri serotype 5b (strain 8401)
A7MJ63 0.0 728 57 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Cronobacter sakazakii (strain ATCC BAA-894)
A4WDW1 0.0 728 56 0 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Enterobacter sp. (strain 638)
Q8Z458 0.0 725 58 3 595 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhi
A6TD49 0.0 724 57 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q5NRM1 0.0 723 57 2 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P38039 0.0 722 57 1 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57KH7 0.0 721 57 1 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella choleraesuis (strain SC-B67)
A9MF16 0.0 719 57 3 603 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ANX1 0.0 719 56 0 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8G9X6 0.0 718 56 3 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Serratia proteamaculans (strain 568)
A1JJS2 0.0 716 59 0 586 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9N2E6 0.0 715 57 1 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEH7 0.0 714 57 1 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZBN6 0.0 708 58 3 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis
Q1C3Z0 0.0 708 58 3 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Antiqua)
Q2NVN4 0.0 707 57 1 603 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Sodalis glossinidius (strain morsitans)
A4TPY5 0.0 706 57 3 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis (strain Pestoides F)
Q1CLS8 0.0 706 57 3 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Nepal516)
A7FLZ0 0.0 705 57 3 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66ED4 0.0 703 56 3 618 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1LTP1 0.0 652 52 3 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Baumannia cicadellinicola subsp. Homalodisca coagulata
P57503 0.0 572 45 4 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9D3 0.0 568 45 5 616 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q65T53 0.0 563 46 4 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7MHA5 0.0 560 46 5 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain YJ016)
Q9KUX4 0.0 558 46 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87L90 0.0 557 45 2 602 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DCK2 0.0 556 46 5 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain CMCP6)
Q9JUD8 0.0 556 48 4 587 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A5F3I4 0.0 556 46 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A9LZ73 0.0 555 48 3 575 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C (strain 053442)
Q7VQH2 0.0 553 45 4 613 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Blochmanniella floridana
A1KU06 0.0 550 47 4 587 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JS45 0.0 548 48 4 579 3 cysJ1 Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5E841 0.0 546 44 4 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LM58 0.0 546 44 3 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photobacterium profundum (strain SS9)
Q0HFL6 2.22e-177 518 43 5 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-4)
A0KTH4 4.96e-176 514 43 5 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain ANA-3)
Q0HYB4 3.46e-175 513 42 5 607 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-7)
Q8EAZ9 3.32e-170 500 41 7 615 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O32214 2.07e-151 452 39 7 602 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Bacillus subtilis (strain 168)
Q54B10 3.18e-90 294 32 10 549 2 redA NADPH oxidoreductase A Dictyostelium discoideum
A0A2U1KZS6 2.25e-64 227 28 17 626 3 CPR2 NADPH--cytochrome P450 reductase 2 Artemisia annua
Q0J705 3.44e-64 227 29 20 613 1 CPR2 NADPH--cytochrome P450 reductase 2 Oryza sativa subsp. japonica
A0A2U1LIM9 1.9e-63 224 27 19 650 1 CPR1 NADPH--cytochrome P450 reductase 1 Artemisia annua
Q9SUM3 4.92e-63 224 28 17 611 1 ATR2 NADPH--cytochrome P450 reductase 2 Arabidopsis thaliana
C5YJG8 5.09e-63 223 29 17 559 1 CPR NADPH--cytochrome P450 reductase Sorghum bicolor
Q653S9 1.7e-62 222 29 18 619 1 CPR3 NADPH--cytochrome P450 reductase 3 Oryza sativa subsp. japonica
Q9SB48 3.03e-62 221 28 22 669 1 ATR1 NADPH--cytochrome P450 reductase 1 Arabidopsis thaliana
Q7X7K8 3.66e-62 221 26 15 618 1 CPR1 NADPH--cytochrome P450 reductase 1 Oryza sativa subsp. japonica
Q55CT1 1.45e-61 219 27 18 610 2 redB NADPH--cytochrome P450 reductase Dictyostelium discoideum
P52674 6.6e-61 214 35 3 334 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
P52674 9.17e-41 158 43 4 189 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
Q05001 2.97e-60 216 29 18 566 2 CPR NADPH--cytochrome P450 reductase Catharanthus roseus
P16435 1.07e-59 214 27 15 602 1 POR NADPH--cytochrome P450 reductase Homo sapiens
P04175 1.87e-58 210 28 18 603 1 POR NADPH--cytochrome P450 reductase Sus scrofa
P37116 5.06e-58 209 27 18 653 1 None NADPH--cytochrome P450 reductase Vigna radiata var. radiata
P37040 6.13e-58 209 27 17 601 1 Por NADPH--cytochrome P450 reductase Mus musculus
Q3SYT8 3.53e-57 207 27 16 602 2 POR NADPH--cytochrome P450 reductase Bos taurus
P00388 1.2e-56 206 27 17 601 1 Por NADPH--cytochrome P450 reductase Rattus norvegicus
P00389 1.26e-56 205 28 18 603 1 POR NADPH--cytochrome P450 reductase Oryctolagus cuniculus
A0A7T9QPQ1 3.68e-56 204 28 14 566 2 CPR NADPH--cytochrome P450 reductase Piper nigrum
P37039 1.63e-55 202 27 19 641 2 Por NADPH--cytochrome P450 reductase Cavia porcellus
Q07994 2.77e-55 201 26 20 609 2 None NADPH--cytochrome P450 reductase Musca domestica
Q27597 3.99e-55 201 27 21 627 1 Cpr NADPH--cytochrome P450 reductase Drosophila melanogaster
Q1JPJ0 7.12e-54 196 26 17 604 2 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Bos taurus
Q6PFP6 1.13e-52 193 26 14 597 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Danio rerio
Q9UHB4 6.45e-52 191 25 14 599 1 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Homo sapiens
A2AI05 9.4e-52 191 26 18 598 2 Ndor1 NADPH-dependent diflavin oxidoreductase 1 Mus musculus
Q6NRG5 1.12e-50 187 24 13 609 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Xenopus laevis
P19618 5.49e-50 186 27 17 603 1 por NADPH--cytochrome P450 reductase (Fragments) Salmo trutta
O08394 2.25e-49 188 28 21 588 1 cypD Bifunctional cytochrome P450/NADPH--P450 reductase 1 Bacillus subtilis (strain 168)
P35228 5.14e-49 187 27 20 604 1 NOS2 Nitric oxide synthase, inducible Homo sapiens
Q26240 1.56e-48 186 27 22 651 2 None Nitric oxide synthase, salivary gland Rhodnius prolixus
P14779 1.23e-47 183 26 18 578 1 cyp102A1 Bifunctional cytochrome P450/NADPH--P450 reductase Priestia megaterium (strain ATCC 14581 / DSM 32 / CCUG 1817 / JCM 2506 / NBRC 15308 / NCIMB 9376 / NCTC 10342 / NRRL B-14308 / VKM B-512 / Ford 19)
Q81BF4 1.45e-47 182 27 19 586 1 CYP102A5 Bifunctional cytochrome P450/NADPH--P450 reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P16603 1.47e-47 180 28 25 653 1 NCP1 NADPH--cytochrome P450 reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q06518 3.17e-46 179 28 22 598 1 Nos2 Nitric oxide synthase, inducible Rattus norvegicus
O54705 5.68e-46 178 29 22 595 2 NOS2 Nitric oxide synthase, inducible Cavia porcellus
O62699 1.8e-44 174 27 20 604 2 NOS2 Nitric oxide synthase, inducible Canis lupus familiaris
A2QS05 4.06e-44 171 26 20 635 2 cprA NADPH--cytochrome P450 reductase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q54JL0 8.14e-44 169 26 19 580 2 redC NADPH-dependent diflavin oxidoreductase 1 Dictyostelium discoideum
Q00141 1.77e-43 169 26 20 634 1 cprA NADPH--cytochrome P450 reductase Aspergillus niger
P29477 2.63e-43 170 27 22 599 1 Nos2 Nitric oxide synthase, inducible Mus musculus
P79290 3.22e-43 170 27 21 598 2 NOS2 Nitric oxide synthase, inducible Sus scrofa
Q0CMM0 2.91e-42 165 25 21 641 3 cprA NADPH--cytochrome P450 reductase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O94613 3.08e-42 164 26 20 593 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2UHA7 3.73e-42 165 26 22 642 3 cprA NADPH--cytochrome P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q27995 3.99e-42 166 27 19 598 2 NOS2 Nitric oxide synthase, inducible Bos taurus
P37201 4.33e-42 164 25 21 652 3 NCP1 NADPH--cytochrome P450 reductase Candida tropicalis
Q28314 9.98e-42 165 27 19 602 2 NOS2 Nitric oxide synthase, inducible Capra hircus
Q6NPS8 2.28e-41 162 25 18 618 1 ATR3 NADPH-dependent diflavin oxidoreductase 1 Arabidopsis thaliana
O08336 4.82e-41 163 27 21 587 1 cypB Bifunctional cytochrome P450/NADPH--P450 reductase 2 Bacillus subtilis (strain 168)
Q9Z0J4 6.67e-41 163 26 25 658 1 Nos1 Nitric oxide synthase 1 Mus musculus
Q4WM67 7.23e-41 161 24 18 633 1 cprA NADPH--cytochrome P450 reductase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6BR77 9e-41 160 25 20 606 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P29475 1.85e-40 162 26 23 647 1 NOS1 Nitric oxide synthase 1 Homo sapiens
O19132 2.08e-40 161 26 24 656 2 NOS1 Nitric oxide synthase 1 Oryctolagus cuniculus
Q5BFT5 2.42e-40 159 25 20 636 3 cprA NADPH--cytochrome P450 reductase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P29476 2.76e-40 161 27 25 658 1 Nos1 Nitric oxide synthase 1 Rattus norvegicus
P29473 3e-40 161 26 22 653 1 NOS3 Nitric oxide synthase 3 Bos taurus
P50126 1.01e-39 157 25 21 651 2 NCP1 NADPH--cytochrome P450 reductase Candida maltosa
Q9HDG2 4.72e-39 156 25 26 672 2 CPR NADPH--cytochrome P450 reductase Phanerodontia chrysosporium
B1B557 8.3e-39 156 27 16 522 2 NSL Nitric oxide synthase-like protein Bombyx mori
B1B557 0.000134 48 30 1 71 2 NSL Nitric oxide synthase-like protein Bombyx mori
P70313 1.2e-38 156 25 18 645 1 Nos3 Nitric oxide synthase 3 Mus musculus
Q62600 2.25e-38 155 26 21 652 1 Nos3 Nitric oxide synthase 3 Rattus norvegicus
P29474 2.65e-38 155 26 22 653 1 NOS3 Nitric oxide synthase 3 Homo sapiens
Q8T8C0 1.97e-37 152 28 21 524 2 NOS Nitric oxide synthase Bombyx mori
Q9TUX8 8.6e-37 150 26 22 653 2 NOS3 Nitric oxide synthase 3 Canis lupus familiaris
Q9UBK8 9.29e-37 149 26 8 415 1 MTRR Methionine synthase reductase Homo sapiens
Q9UBK8 8.15e-11 68 30 5 173 1 MTRR Methionine synthase reductase Homo sapiens
Q28969 2.9e-36 149 26 24 670 1 NOS3 Nitric oxide synthase 3 Sus scrofa
Q94IN5 3.4e-36 149 26 24 578 1 PNO Pyruvate dehydrogenase [NADP(+)], mitochondrial Euglena gracilis
I7ZK32 4.07e-36 148 28 21 538 1 CYP505C3 Self-sufficient cytochrome P450 monooxygenase CYP505C3 Aspergillus oryzae (strain 3.042)
O61608 5.16e-35 145 26 19 524 2 None Nitric oxide synthase Anopheles stephensi
Q8C1A3 1.68e-34 142 26 11 416 1 Mtrr Methionine synthase reductase Mus musculus
Q8C1A3 1.07e-12 74 32 5 158 1 Mtrr Methionine synthase reductase Mus musculus
P36587 1.7e-34 142 26 26 632 2 ccr1 NADPH--cytochrome P450 reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39692 6.35e-34 141 27 12 382 1 MET10 Sulfite reductase [NADPH] flavoprotein component Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5AD27 8.3e-34 139 24 22 612 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q27571 2.49e-33 140 27 21 524 1 Nos Nitric oxide synthase Drosophila melanogaster
Q29498 3.4e-33 139 28 22 537 2 NOS1 Nitric oxide synthase 1 Ovis aries
Q498R1 1.39e-32 136 26 11 416 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q498R1 1.61e-12 74 31 4 157 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q6FRH1 3.62e-32 135 24 24 633 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4P3D8 5.21e-32 134 24 20 660 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Ustilago maydis (strain 521 / FGSC 9021)
Q09878 6.57e-32 135 28 11 391 3 SPCC584.01c Probable sulfite reductase [NADPH] flavoprotein component Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O19114 2.92e-31 130 30 15 371 2 NOS2 Nitric oxide synthase, inducible (Fragment) Oryctolagus cuniculus
A0A0C3HJL3 9.97e-31 132 27 23 599 1 CYP505AG1 Self-sufficient cytochrome P450 monooxygenase CYP505AG1 Oidiodendron maius (strain Zn)
Q4JIJ2 2.47e-30 130 26 11 403 2 MTRR Methionine synthase reductase Bos taurus
Q4JIJ2 3.33e-12 73 31 3 147 2 MTRR Methionine synthase reductase Bos taurus
Q4HZQ1 4.76e-30 128 23 14 583 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q968X7 6.05e-30 129 25 25 616 2 PFOR Pyruvate dehydrogenase [NADP(+)] Cryptosporidium parvum
P97270 4.23e-29 127 25 16 570 2 NOS3 Nitric oxide synthase 3 Cavia porcellus
Q6CVG8 8.33e-29 124 24 26 638 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q5BB41 1.7e-28 124 23 26 641 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q75B78 3.47e-28 123 24 26 627 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A0A0A2J1Z6 9.9e-28 122 26 20 540 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium expansum
Q9Y8G7 1.01e-27 122 25 21 541 1 CYP505 Bifunctional cytochrome P450/NADPH--P450 reductase Fusarium oxysporum
Q90703 1.45e-27 122 35 10 253 2 NOS2 Nitric oxide synthase, inducible Gallus gallus
Q90703 1.1e-07 58 28 3 126 2 NOS2 Nitric oxide synthase, inducible Gallus gallus
Q12181 3.49e-27 120 24 25 637 1 TAH18 NADPH-dependent diflavin oxidoreductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A100IM63 4.23e-27 120 26 26 557 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus niger
P0CP12 8.08e-26 115 27 13 368 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP12 1.22e-11 71 32 1 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP13 8.08e-26 115 27 13 368 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP13 1.22e-11 71 32 1 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q4WU59 1.64e-25 115 23 23 645 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
G7XMT1 4.69e-25 114 27 25 543 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus kawachii (strain NBRC 4308)
R0IGL9 1.1e-24 113 26 23 579 1 CYP505U2 Self-sufficient cytochrome P450 monooxygenase CYP505U2 Exserohilum turcicum (strain 28A)
A0A101MN42 1.88e-24 112 27 26 554 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium freii
A2QLV1 2.51e-24 112 27 20 536 1 CYP505E1 Self-sufficient cytochrome P450 monooxygenase CYP505E1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0G4P2K0 6.45e-24 110 26 23 548 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium camemberti (strain FM 013)
Q9HGE0 2.36e-23 108 25 23 618 2 FUM6 Bifunctional cytochrome P450/NADPH--P450 reductase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q0D1W9 3.6e-23 108 27 25 578 1 CYP505E3 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P79209 4.81e-23 108 34 9 233 2 NOS3 Nitric oxide synthase 3 Ovis aries
P79209 5.58e-06 53 24 3 160 2 NOS3 Nitric oxide synthase 3 Ovis aries
A0A3G9HRC2 1.85e-22 106 24 25 624 3 ALT2 Bifunctional cytochrome P450/NADPH--P450 reductase ALT2 Alternaria alternata
G9MLG2 4.21e-22 105 25 21 587 1 CYP505P1 Self-sufficient cytochrome P450 monooxygenase CYP505P1 Hypocrea virens (strain Gv29-8 / FGSC 10586)
G5EJN7 2.3e-21 102 22 21 595 1 CYP505D6 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Phanerodontia chrysosporium
A0A455R5H4 1.82e-20 99 23 19 559 1 ascE Bifunctional cytochrome P450/NADPH--P450 reductase ascE Acremonium egyptiacum
Q9US28 4.85e-19 94 28 11 257 3 SPAC1783.01 Uncharacterized FAD-binding protein C1783.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09744 5.06e-19 94 25 16 460 3 SPBC12C2.03c Uncharacterized FAD-binding protein C12C2.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9S9P8 8.27e-17 86 31 6 195 1 RFNR2 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic Arabidopsis thaliana
O61309 6.41e-16 85 46 2 92 2 NOS Nitric oxide synthase Lymnaea stagnalis
Q17574 2.45e-15 83 25 17 416 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q17574 1.38e-06 55 27 4 161 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
O04397 2.47e-15 81 29 6 194 2 None Ferredoxin--NADP reductase, root-type isozyme, chloroplastic Nicotiana tabacum
Q6CCH0 6.84e-15 81 26 7 234 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6CCH0 8.15e-11 68 27 7 234 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P10933 1.19e-14 79 28 8 234 1 PETH Ferredoxin--NADP reductase, leaf isozyme, chloroplastic Pisum sativum
P41346 2.15e-14 78 28 8 234 2 PETH Ferredoxin--NADP reductase, chloroplastic Vicia faba
Q2UNA2 2.3e-14 80 21 20 605 2 CYP505A3 Bifunctional cytochrome P450/NADPH--P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9FKW6 2.93e-14 78 27 8 234 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Arabidopsis thaliana
Q8W493 3.13e-14 78 26 9 237 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Arabidopsis thaliana
Q55318 3.86e-14 78 30 7 191 1 petH Ferredoxin--NADP reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6ZFJ3 6.09e-14 77 26 8 234 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. japonica
A2WZT1 8e-14 77 26 8 234 3 OsI_05475 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. indica
P41345 8.77e-14 77 28 9 237 1 Os03g0784700 Ferredoxin--NADP reductase, root isozyme, chloroplastic Oryza sativa subsp. japonica
A2Y8E0 1.16e-13 76 26 9 234 3 OsI_21320 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. indica
P41344 1.45e-13 75 26 9 234 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. japonica
Q41014 2.33e-13 75 31 8 195 2 None Ferredoxin--NADP reductase, root isozyme, chloroplastic Pisum sativum
O23877 2.81e-13 75 29 10 237 1 Os07g0147900 Ferredoxin--NADP reductase, embryo isozyme, chloroplastic Oryza sativa subsp. japonica
Q9M0V6 3e-13 75 29 6 195 2 RFNR1 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic Arabidopsis thaliana
O04977 3.3e-13 75 27 8 234 2 PETH Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic Nicotiana tabacum
P31973 3.62e-13 75 30 7 189 1 petH Ferredoxin--NADP reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P44813 5.47e-13 70 32 3 147 3 mioC Protein MioC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P53991 8.48e-13 73 26 6 234 1 PETH Ferredoxin--NADP reductase, chloroplastic Chlamydomonas reinhardtii
Q93RE3 1.76e-12 72 29 10 192 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P21890 3.38e-12 72 29 8 193 1 petH Ferredoxin--NADP reductase Nostoc sp. (strain ATCC 29151 / PCC 7119)
Q44549 3.48e-12 72 29 8 193 3 petH Ferredoxin--NADP reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P00455 3.48e-12 72 25 8 234 1 PETH Ferredoxin--NADP reductase, chloroplastic Spinacia oleracea
P58558 3.83e-12 72 29 8 193 3 petH Ferredoxin--NADP reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P58208 5.07e-12 67 30 4 148 3 mioC Protein MioC Escherichia coli O157:H7
Q47418 5.72e-12 67 35 1 124 3 None Flavodoxin YqcA Pectobacterium carotovorum subsp. carotovorum
P03817 5.74e-12 67 30 4 148 1 mioC Protein MioC Escherichia coli (strain K12)
Q00598 3.01e-11 68 26 10 234 1 PETH Ferredoxin--NADP reductase, cyanelle Cyanophora paradoxa
P41343 1.57e-10 66 24 8 234 2 PETH Ferredoxin--NADP reductase, chloroplastic Mesembryanthemum crystallinum
P00454 1.64e-10 65 27 7 200 1 petH Ferredoxin--NADP reductase Spirulina sp.
Q9KVY6 3.39e-10 62 32 2 131 3 mioC Protein MioC homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q92037 1.45e-09 60 31 2 98 2 nos2 Nitric oxide synthase, inducible (Fragment) Carassius auratus
Q9AIX6 1.35e-08 60 27 10 228 1 boxA Benzoyl-CoA oxygenase component A Aromatoleum evansii
Q92091 2.66e-08 60 26 3 130 2 nos2 Nitric oxide synthase, inducible (Fragment) Oncorhynchus mykiss
Q9L6A2 3.29e-08 56 28 4 146 3 mioC Protein MioC homolog Pasteurella multocida (strain Pm70)
P65369 7.12e-08 55 26 3 148 3 yqcA Uncharacterized protein YqcA Shigella flexneri
P65367 7.12e-08 55 26 3 148 1 yqcA Flavodoxin YqcA Escherichia coli (strain K12)
P65368 7.12e-08 55 26 3 148 3 yqcA Uncharacterized protein YqcA Escherichia coli O157:H7
P47169 5.84e-07 56 29 3 148 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A9FRJ0 7.55e-07 54 24 7 177 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
Q1K9C2 4.04e-06 53 26 2 126 3 sir1 Sulfite reductase [NADPH] subunit beta Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O34737 0.000206 45 29 1 112 3 ykuN Probable flavodoxin 1 Bacillus subtilis (strain 168)
O34589 0.000261 45 25 3 127 3 ykuP Probable flavodoxin 2 Bacillus subtilis (strain 168)
Q9KMY3 0.000353 47 24 6 173 1 hmp Flavohemoprotein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q01096 0.00071 43 31 5 141 3 None Flavodoxin Megalodesulfovibrio gigas
Q8VQF4 0.001 43 39 2 78 1 cinC Cindoxin Citrobacter braakii

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11765
Feature type CDS
Gene cysJ
Product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
Location 501383 - 503188 (strand: 1)
Length 1806 (nucleotides) / 601 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_83
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00175 Oxidoreductase NAD-binding domain
PF00258 Flavodoxin
PF00667 FAD binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0369 Nucleotide transport and metabolism (F)
Inorganic ion transport and metabolism (P)		 FP Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00380 sulfite reductase (NADPH) flavoprotein alpha-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MIKKQSPVSVFPISAEQLSALQTITDNVTSHQLAWISGYLWGKVSEELSTDIPVTVTASSNDIITIISASQTGNARRLSEELNVHLINEGFSVNLISAGKFKYKQLAREKIIIIVTSTQGDGEPPEEAVAFYKYLHSEKRPDLSEMVYAVFSLGDSSYEKFCRAGIGFDTQLAKSGAKSLLSRVDADVDYQSVAGEWINELTQLLKKRVSEQGDGQQAATPVGCTGGINTHAYTKTTPLTASLLVNQKITGRGSRKDVRHIEISLGDSGLRYQPGDALGVWFENDPALADEVLSLLQLNGEERIFITGQSYPLREALICHLELTQNNSVTVSKYAQLAQNDVLLSLISDKQATVHYAKTTPVAAMLRMTASQPSAQAFADILRPLTPRLYSVSSSQAETENEVHLTVGVIRYETDGYARTGGASGFLADHIKEGGDLRIFIEHNDNFRLPADPAAPVIMIGAGTGIAPFRAFMQQRENDNATGKNWLFYGNQCFTEDFLYQTQWQRYVTEGLLTSVSLAWSRDKPVRTYVQDKLYEQGEEVWRWIDAGAHIYVCGNANHMACDTQRALLDIISQYGNMDSGSADEFLSELRTVRRYQRDVY

Flanking regions ( +/- flanking 50bp)

TGGGAAGTACCGGAATAATAATTTATATATAATACGGGAGCAACAGGGTAATGATAAAAAAGCAATCTCCGGTATCGGTGTTCCCGATATCAGCGGAGCAGCTTTCTGCTCTGCAAACAATAACTGACAATGTCACGTCTCATCAACTGGCCTGGATATCCGGTTATTTATGGGGAAAGGTTAGCGAAGAACTGTCCACCGATATTCCTGTTACGGTAACAGCCTCATCAAACGATATTATTACTATTATATCAGCATCGCAGACCGGTAATGCACGACGTCTGTCAGAAGAATTAAACGTACATTTAATTAATGAAGGTTTCAGTGTTAATTTGATAAGTGCGGGTAAATTTAAATATAAACAGCTTGCCCGCGAAAAAATAATTATTATTGTGACCTCCACTCAGGGAGACGGAGAACCACCGGAAGAAGCGGTGGCGTTTTATAAATATCTGCATTCAGAAAAAAGACCTGATCTCAGTGAAATGGTTTATGCGGTCTTTTCATTGGGTGATTCGTCATATGAAAAATTTTGCCGTGCAGGTATAGGGTTTGATACTCAGTTAGCGAAATCAGGGGCGAAATCGTTACTGTCCCGGGTGGATGCAGATGTGGATTATCAGTCTGTTGCCGGGGAATGGATTAACGAACTCACTCAATTGCTTAAAAAACGGGTATCAGAACAGGGAGATGGTCAGCAGGCGGCAACACCTGTGGGTTGCACCGGCGGGATTAACACTCATGCCTATACAAAAACCACGCCACTGACCGCATCACTCTTGGTTAATCAAAAAATTACCGGACGGGGATCACGCAAGGATGTGCGCCATATTGAAATCTCACTGGGGGATTCCGGCTTGCGTTATCAGCCCGGGGATGCACTCGGTGTTTGGTTTGAAAATGATCCGGCGTTGGCGGATGAAGTACTCAGCTTATTACAACTGAACGGGGAGGAACGTATTTTTATCACCGGTCAGTCATACCCGCTGAGGGAGGCGTTGATTTGTCATCTGGAATTAACACAGAATAATAGCGTGACGGTCAGTAAATACGCGCAGTTAGCACAGAATGACGTGCTGTTAAGCCTTATCAGCGATAAACAGGCCACTGTGCATTATGCGAAAACAACGCCTGTTGCAGCAATGCTCAGGATGACTGCCTCACAGCCATCCGCTCAGGCATTCGCCGATATCCTCAGACCGCTTACTCCCAGACTGTACTCAGTTTCCTCTTCACAGGCTGAAACAGAAAATGAAGTTCATCTTACCGTCGGAGTGATCCGTTATGAAACAGACGGATATGCACGTACGGGCGGCGCTTCAGGGTTCCTGGCTGATCATATAAAAGAGGGCGGGGATCTGCGGATCTTTATTGAGCACAATGATAATTTCCGCCTTCCGGCTGATCCGGCTGCTCCCGTTATTATGATCGGAGCCGGAACCGGTATTGCGCCATTCAGGGCATTTATGCAACAACGTGAAAATGATAATGCGACAGGAAAAAACTGGCTTTTTTACGGAAATCAGTGTTTTACAGAAGATTTTCTGTATCAGACTCAATGGCAGCGTTATGTCACAGAGGGTTTATTAACCTCAGTGTCTTTAGCCTGGTCGCGTGATAAGCCGGTCAGAACCTATGTACAGGACAAGTTGTATGAGCAGGGTGAGGAAGTGTGGCGCTGGATTGATGCCGGCGCACATATCTATGTCTGTGGTAATGCAAATCATATGGCCTGTGATACGCAACGGGCATTGCTGGATATCATCAGCCAATACGGAAATATGGATAGCGGATCGGCTGATGAGTTTTTAAGTGAACTGCGCACTGTGCGCCGGTATCAGAGGGATGTTTATTAATGAGTGATAAAAAATACGGACCTTTAATTGTTGAGGGTAAACTGAGCGAC