Homologs in group_195

Help

8 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11000 FBDBKF_11000 53.1 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_05225 EHELCC_05225 53.1 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_05545 NLDBIP_05545 53.1 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
LHKJJB_02425 LHKJJB_02425 53.1 Morganella morganii S3 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_15805 HKOGLL_15805 53.1 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
F4V73_RS08225 F4V73_RS08225 55.2 Morganella psychrotolerans - universal stress protein
PMI_RS07865 PMI_RS07865 35.4 Proteus mirabilis HI4320 - universal stress protein
PMI_RS07875 PMI_RS07875 47.7 Proteus mirabilis HI4320 - universal stress protein

Distribution of the homologs in the orthogroup group_195

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_195

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37903 9.91e-35 120 42 2 147 1 uspF Universal stress protein F Escherichia coli (strain K12)
P0A4P8 2.17e-34 120 42 2 147 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 2.17e-34 120 42 2 147 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 2.17e-34 120 42 2 147 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 2.17e-34 120 42 2 147 3 uspF Universal stress protein F Escherichia coli O157:H7
P67091 9.04e-34 118 40 2 147 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 9.04e-34 118 40 2 147 3 uspF Universal stress protein F Salmonella typhi
Q8FK07 2.92e-26 99 39 2 145 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39177 1.12e-24 95 37 2 145 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8XBT3 1.24e-24 95 37 2 145 3 uspG Universal stress protein G Escherichia coli O157:H7
P67093 1.35e-24 95 37 2 145 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 1.35e-24 95 37 2 145 3 uspG Universal stress protein G Salmonella typhi
Q83M07 1.54e-24 94 37 2 145 3 uspG Universal stress protein G Shigella flexneri
Q50777 3.39e-08 52 30 4 150 3 MTBMA_c15380 Universal stress protein MTBMA_c15380 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
O27222 1.73e-07 50 30 4 150 3 MTH_1154 Universal stress protein MTH_1154 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q83AC1 6e-07 49 29 3 143 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P45680 2.71e-05 44 28 4 147 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
E1VBK4 0.000351 41 25 5 152 1 teaD TRAP-T-associated universal stress protein TeaD Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
P74148 0.000519 41 24 7 155 3 sll1388 Universal stress protein Sll1388 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09630
Feature type CDS
Gene -
Product universal stress protein
Location 2104440 - 2104877 (strand: 1)
Length 438 (nucleotides) / 145 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_195
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14061 universal stress protein F - -

Protein Sequence

MYKKILVPIDILEDELSQELITHIEQIAQVGKPEIHFLTVIPNAELFFGIEFAAIPEKFKDSSERTRLAFIALQDMIKDTKIPDEQIVCNVGVGNAKDEILEYARQIDADLIAIASHRPNVSSYLLGSTASSIVRHAKMSVLVIR

Flanking regions ( +/- flanking 50bp)

TCAGTGATAATAGAGTTATATTTTAAAACTAACGTTAAGTGAGGTTTGTAATGTACAAAAAAATTCTAGTTCCTATCGATATTCTAGAAGATGAGCTTTCTCAGGAACTGATCACTCACATTGAACAAATTGCTCAAGTTGGCAAACCCGAGATCCACTTCCTCACCGTTATTCCAAATGCAGAACTTTTCTTCGGTATTGAGTTTGCCGCTATTCCTGAAAAATTTAAAGACTCTTCAGAGCGCACTCGCCTCGCTTTTATTGCTCTGCAAGATATGATCAAAGATACGAAAATTCCCGATGAGCAAATTGTTTGCAATGTCGGTGTTGGTAATGCAAAAGATGAAATTTTAGAGTATGCACGTCAAATCGATGCAGATTTAATTGCTATTGCTTCACATCGTCCTAATGTTTCTTCCTACTTATTAGGCTCAACAGCATCATCTATTGTTCGCCATGCAAAAATGTCGGTATTAGTGATCCGTTAGTTGTAAAAAAAGCCCTTTGAAAACAAAGGGCTTTCCACTCAATAATAATT