Homologs in group_426

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11000 FBDBKF_11000 100.0 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_05225 EHELCC_05225 100.0 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_05545 NLDBIP_05545 100.0 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_15805 HKOGLL_15805 100.0 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
F4V73_RS08225 F4V73_RS08225 87.6 Morganella psychrotolerans - universal stress protein
PMI_RS09630 PMI_RS09630 53.1 Proteus mirabilis HI4320 - universal stress protein

Distribution of the homologs in the orthogroup group_426

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_426

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 4.62e-35 121 45 3 148 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 4.62e-35 121 45 3 148 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 3.47e-34 119 45 3 148 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 3.47e-34 119 45 3 148 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 3.47e-34 119 45 3 148 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 3.47e-34 119 45 3 148 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 1.96e-33 117 44 3 148 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8FK07 1.46e-21 87 32 3 146 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39177 9.35e-21 85 32 3 146 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8XBT3 1.47e-20 84 32 3 146 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 1.02e-19 82 31 3 146 3 uspG Universal stress protein G Shigella flexneri
P67093 9.81e-19 80 31 3 146 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 9.81e-19 80 31 3 146 3 uspG Universal stress protein G Salmonella typhi
Q83AC1 2.36e-05 45 27 4 144 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q57951 8.83e-05 43 26 7 152 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45680 0.000134 42 41 0 53 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P60005 0.00066 42 26 5 134 3 uspE Universal stress protein E Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_02425
Feature type CDS
Gene uspA
Product Nucleotide-binding universal stress protein, UspA family
Location 56121 - 56558 (strand: 1)
Length 438 (nucleotides) / 145 (amino acids)
In genomic island -

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_426
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14061 universal stress protein F - -

Protein Sequence

MYNTILVPIDILEDDLTDKMLPHVEALAKIDNPKIHFFTVIPNVEMFFGVEYASMPVSMRESGERIELALAALKEIIKGIAVPESQYTLHAAIGSAKNEILSYAKDINADLILMGSHRPGAATFLLGSTAATIVRHAKTSVMVIR

Flanking regions ( +/- flanking 50bp)

GCTGTCATTTTTTGTCATAATGTAACTGATTTCAGTTAACAGGAGGCTGTATGTACAACACGATTCTGGTTCCGATTGATATTCTTGAAGATGACCTGACAGACAAAATGCTGCCCCATGTGGAAGCACTGGCGAAAATTGATAATCCGAAGATCCACTTCTTTACCGTTATCCCTAACGTGGAAATGTTCTTCGGGGTGGAATACGCCTCAATGCCGGTCAGTATGCGGGAATCCGGAGAGCGCATTGAGCTGGCGCTTGCCGCACTGAAAGAAATTATTAAAGGAATTGCTGTGCCGGAAAGTCAGTACACCCTGCACGCGGCTATCGGATCAGCCAAAAACGAAATTCTCTCTTATGCCAAAGATATTAACGCCGACCTGATCCTGATGGGCTCTCACCGCCCGGGTGCGGCAACATTCCTGCTCGGCTCTACCGCCGCAACGATTGTCCGTCACGCCAAAACCTCGGTGATGGTTATCCGCTGATCCCGTCAGTCTGTTTATTCTGCCCCGCGTCACTGCGGGGCATGTTATTT