Homologs in group_426

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11000 FBDBKF_11000 87.6 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_05225 EHELCC_05225 87.6 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_05545 NLDBIP_05545 87.6 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
LHKJJB_02425 LHKJJB_02425 87.6 Morganella morganii S3 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_15805 HKOGLL_15805 87.6 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
PMI_RS09630 PMI_RS09630 55.2 Proteus mirabilis HI4320 - universal stress protein

Distribution of the homologs in the orthogroup group_426

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_426

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 3.65e-36 124 45 3 148 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 3.65e-36 124 45 3 148 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 2.08e-34 120 45 3 148 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 2.08e-34 120 45 3 148 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 2.08e-34 120 45 3 148 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 2.08e-34 120 45 3 148 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 1.1e-33 118 44 3 148 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8FK07 1.56e-22 89 35 3 146 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39177 9.18e-22 87 34 3 146 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8XBT3 1.3e-21 87 34 3 146 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 7.87e-21 85 34 3 146 3 uspG Universal stress protein G Shigella flexneri
P67093 4.23e-20 83 34 3 146 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 4.23e-20 83 34 3 146 3 uspG Universal stress protein G Salmonella typhi
Q83AC1 3.06e-07 50 28 4 144 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P45680 6.58e-05 43 43 0 53 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q57951 8.07e-05 43 26 6 150 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57997 0.000164 42 26 5 159 1 MJ0577 Universal stress protein MJ0577 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2FXL6 0.00064 41 51 1 43 3 SAOUHSC_01819 Putative universal stress protein SAOUHSC_01819 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFZ7 0.00064 41 51 1 43 3 SAR1788 Putative universal stress protein SAR1788 Staphylococcus aureus (strain MRSA252)
Q5HF64 0.00064 41 51 1 43 3 SACOL1759 Putative universal stress protein SACOL1759 Staphylococcus aureus (strain COL)
Q99TF3 0.00064 41 51 1 43 3 SAV1710 Putative universal stress protein SAV1710 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FG28 0.00064 41 51 1 43 3 SAUSA300_1656 Putative universal stress protein SAUSA300_1656 Staphylococcus aureus (strain USA300)
Q7A0N0 0.00064 41 51 1 43 3 MW1653 Putative universal stress protein MW1653 Staphylococcus aureus (strain MW2)
Q6G8L7 0.00064 41 51 1 43 3 SAS1637 Putative universal stress protein SAS1637 Staphylococcus aureus (strain MSSA476)
Q2YTD0 0.00064 41 51 1 43 3 SAB1569 Putative universal stress protein SAB1569 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A551 0.00064 41 51 1 43 1 SA1532 Putative universal stress protein SA1532 Staphylococcus aureus (strain N315)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08225
Feature type CDS
Gene -
Product universal stress protein
Location 1711015 - 1711452 (strand: 1)
Length 438 (nucleotides) / 145 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_426
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14061 universal stress protein F - -

Protein Sequence

MYNTILVPIDILEDDLTDKMLPHVEALAKIDNPKIHFLTVIPNVEMFFGVEYASLPVSLRESGERIELALAALQDLLKDISVPARQYTLHAVIGSAKNEILTYAKEINADLILMGSHRPDAATFLLGSTASGIVRHAKTSVMVVR

Flanking regions ( +/- flanking 50bp)

CCTGCAGTTTGAATGAATAAGGGTATAGAGTTCAATTAACAGGAGGCAATATGTACAACACGATTCTGGTTCCTATTGATATTCTGGAAGATGACCTGACCGATAAAATGCTGCCCCATGTGGAAGCACTGGCAAAAATTGATAATCCGAAAATTCACTTTTTGACCGTAATCCCGAATGTGGAAATGTTTTTTGGTGTGGAATATGCCTCACTGCCGGTCAGTCTGCGTGAATCCGGCGAGCGTATTGAATTAGCACTTGCTGCGTTGCAGGACTTACTGAAAGATATTTCTGTCCCGGCACGTCAATACACACTGCACGCCGTAATCGGCTCGGCAAAAAATGAAATTCTGACTTATGCCAAAGAGATTAATGCTGATTTAATTCTGATGGGCTCTCACCGCCCGGATGCCGCAACGTTTCTGCTCGGCTCAACGGCCTCAGGTATTGTCCGTCACGCCAAAACCTCTGTAATGGTTGTCCGGTAAACCCGGATAAATAATCCTATACCCGACGTCATTCAAGCTGCAGCCAACAC