Homologs in group_534

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01185 FBDBKF_01185 87.6 Morganella morganii S1 qseF two-component system response regulator QseF/GlrR
EHELCC_00360 EHELCC_00360 87.6 Morganella morganii S2 qseF two-component system response regulator QseF/GlrR
NLDBIP_03100 NLDBIP_03100 87.6 Morganella morganii S4 qseF two-component system response regulator QseF/GlrR
LHKJJB_04615 LHKJJB_04615 87.6 Morganella morganii S3 qseF two-component system response regulator QseF/GlrR
HKOGLL_02430 HKOGLL_02430 87.6 Morganella morganii S5 qseF two-component system response regulator QseF/GlrR
F4V73_RS07255 F4V73_RS07255 88.3 Morganella psychrotolerans glrR two-component system response regulator GlrR

Distribution of the homologs in the orthogroup group_534

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_534

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFU5 0.0 756 84 0 442 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 0.0 756 84 0 442 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P14375 3.91e-120 360 43 3 443 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P25852 1.08e-118 357 44 3 439 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X613 2.57e-118 355 43 2 439 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q8Z333 5.8e-118 355 44 3 438 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q9APD9 1.16e-113 343 42 5 450 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q06065 2.66e-111 338 41 5 455 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P03029 4.34e-105 323 40 5 466 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P0AFB8 1.97e-104 321 39 4 471 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.97e-104 321 39 4 471 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P28787 2.47e-104 321 38 6 480 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P41789 6.16e-103 317 39 6 475 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q00934 9.19e-103 316 44 1 360 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13632 6.74e-101 311 40 3 450 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q9I4N3 3.14e-97 303 44 1 371 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10046 4.34e-96 299 39 3 443 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q9HU19 8.87e-96 298 40 4 445 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23747 7.08e-94 293 39 3 445 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 1.53e-91 287 39 5 447 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88RJ6 2.61e-90 284 43 2 370 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P10577 1.45e-88 281 39 3 384 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q87MX7 2.79e-88 279 41 3 371 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C5S5 3.04e-88 279 41 3 371 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 3.04e-88 279 41 3 371 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P45671 5.82e-88 279 35 5 466 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q04848 1.45e-87 278 34 5 465 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P29267 2.1e-86 275 36 7 478 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7MM78 1.73e-85 271 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.73e-85 271 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q9KT84 2.84e-85 271 36 5 442 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10576 7.76e-85 271 36 7 465 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P71229 9e-82 268 54 0 233 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
O25408 1.72e-77 249 38 5 376 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P31908 2.29e-77 251 35 9 477 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P17899 1.31e-76 249 35 7 433 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0CL46 2.94e-76 254 42 4 332 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09570 3.69e-76 249 48 3 258 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
E1WAA4 6.72e-76 253 42 4 332 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
Q04849 8.91e-76 246 34 4 453 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P19323 1.06e-75 253 43 4 330 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P27713 1.97e-75 248 50 0 240 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P26047 5.32e-75 249 37 5 353 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P12627 2e-74 245 39 3 353 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q3K999 6.57e-74 239 52 0 236 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
G3XCV0 2.16e-73 241 53 1 220 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P05407 3.84e-73 243 51 2 239 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q01265 5.79e-73 234 46 2 240 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q9ZCY9 1.27e-71 236 30 10 468 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q9KN48 2.04e-71 237 39 8 359 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4UL27 4.41e-71 235 30 10 459 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q845S7 5.78e-71 231 52 0 228 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
O85057 1.83e-70 235 39 8 354 1 None Limonene hydroxylase Geobacillus stearothermophilus
A8ANR6 1.85e-70 234 41 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P12626 2.92e-70 234 39 1 312 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P03027 6.82e-70 233 47 1 244 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
B5F363 6.94e-70 233 40 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
P56266 8.16e-70 233 47 1 244 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
O31551 8.38e-70 235 42 7 314 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P54930 8.94e-70 233 47 1 244 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
B4T3B0 1.06e-69 232 40 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B5FSZ0 1.26e-69 232 42 4 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
B4TF23 2e-69 231 40 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
P09133 2.26e-69 234 50 1 238 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q68WH4 2.44e-69 230 29 10 468 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B6I695 4.21e-69 231 41 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
Q32CL9 6.17e-69 230 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
C0PWN2 6.33e-69 230 40 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
P59402 7.08e-69 230 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 7.08e-69 230 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B5Z370 7.08e-69 230 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 7.08e-69 230 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
A7ZQD8 9.42e-69 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8ZMJ8 9.46e-69 229 40 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 9.46e-69 229 40 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
P37013 1.09e-68 229 40 2 316 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.09e-68 229 40 2 316 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.09e-68 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q46802 2.19e-68 231 45 2 266 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
B7LW25 2.22e-68 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R7Z1 2.26e-68 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 2.26e-68 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 2.26e-68 229 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
A4WDR5 3.8e-68 228 45 0 246 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P74839 3.84e-68 229 42 9 327 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7N6T9 3.92e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TEH1 4.09e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LQ27 4.32e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B7NSI9 5.11e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8Z4C6 5.25e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 5.25e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 5.25e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 5.25e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 5.3e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 6.28e-68 228 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7MZ04 6.31e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q8FEN6 6.38e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHC1 6.38e-68 228 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A9MFX7 6.62e-68 228 39 3 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XVA2 7.37e-68 228 40 3 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
A6TCX4 8.36e-68 228 39 2 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7M9E6 8.67e-68 227 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q1RJS1 9.43e-68 226 29 9 460 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
B7LEC0 1.14e-67 227 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
Q3YYF5 1.53e-67 226 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B1IUX0 2.47e-67 226 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3I6 2.52e-67 226 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
Q31X73 2.68e-67 226 40 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
P54929 4.35e-67 228 46 1 255 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 8.65e-67 228 46 1 255 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54931 1.07e-66 226 46 2 251 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q53206 1.66e-66 226 48 2 242 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D5ARW9 4.2e-65 222 48 1 237 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 4.97e-65 222 48 1 237 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
O87455 9.02e-65 220 37 4 337 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A4STH5 9.65e-65 219 38 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q92HC2 1.22e-64 218 30 10 459 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P24426 5.47e-64 213 46 1 238 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P54529 9.63e-64 221 37 4 338 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P77743 1.82e-63 216 41 9 315 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P38022 3.15e-63 214 38 3 320 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
A0KEJ0 3.83e-63 215 38 2 324 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P06519 5.41e-63 216 42 3 269 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P09828 9.13e-62 212 45 2 245 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q43965 1.01e-61 213 40 4 295 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q6D8R9 1.78e-61 211 38 5 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9K4U8 2.07e-60 208 43 0 237 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7MFY9 4.92e-60 207 37 3 325 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q8D4F9 8.93e-60 206 37 4 325 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
A8GG93 1.1e-59 206 38 3 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
Q9ZIB7 1.43e-59 206 37 5 319 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P37344 6.45e-59 199 36 4 321 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q5E3W8 8.04e-59 204 35 2 322 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P28614 5.31e-58 205 38 6 316 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P03028 1.61e-55 196 45 1 240 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
Q9K4V0 3.83e-54 191 38 4 327 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P26408 2.07e-53 189 29 8 475 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P07604 4.46e-52 186 41 1 225 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P09432 5.5e-52 184 32 8 425 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0A2D7 6.97e-51 182 41 1 225 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 6.97e-51 182 41 1 225 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P37931 5.28e-50 174 43 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
O54426 9.55e-50 179 39 1 235 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P26316 7.51e-49 172 43 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P37930 2.99e-48 170 42 1 200 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P36219 6.66e-48 170 41 1 204 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P38035 3.08e-42 159 37 4 248 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P44694 5.41e-41 151 32 5 315 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P76016 5.8e-40 154 33 6 314 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P45512 7.09e-33 134 30 4 312 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P54156 9.78e-32 127 34 5 223 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P06184 5.93e-31 126 25 9 398 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55610 4.99e-24 108 29 7 328 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 7.99e-19 93 34 5 188 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 2.58e-16 85 32 6 215 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P23221 4.12e-14 74 31 2 147 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1XDE4 4.14e-14 74 33 1 119 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q9TLQ4 7.72e-14 74 37 1 104 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
O78428 1.36e-13 73 38 1 100 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P51586 1.38e-13 70 40 1 105 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
O69730 1.8e-13 73 31 0 107 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P51358 5.59e-13 72 33 1 105 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 7.64e-13 71 33 1 105 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q7A039 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.02e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 1.18e-12 70 33 1 138 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q7D9K0 3.32e-12 69 33 0 108 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 3.32e-12 69 33 0 108 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q99U73 3.39e-12 68 30 2 139 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
A6QJK3 3.74e-12 68 37 1 101 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 3.74e-12 68 37 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P10958 3.98e-12 68 29 3 179 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P43501 5.59e-12 65 33 1 118 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06628 9.59e-12 65 31 0 116 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P0C001 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 9.61e-12 67 31 2 130 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 9.61e-12 67 31 2 130 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P48259 1.1e-11 68 34 1 100 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q2YZ24 1.61e-11 67 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P28257 1.69e-11 67 32 1 104 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P13792 1.7e-11 67 32 0 103 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P28835 2.13e-11 67 31 1 100 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q53228 3.27e-11 65 31 0 111 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q04942 3.38e-11 66 34 1 102 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7A0U4 6.07e-11 65 33 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 6.07e-11 65 33 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 6.07e-11 65 33 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 6.07e-11 65 33 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 6.07e-11 65 33 1 103 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 6.07e-11 65 33 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 6.07e-11 65 33 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 6.07e-11 65 33 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q56128 7.73e-11 68 37 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q8DPL7 8.03e-11 65 33 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 8.03e-11 65 33 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 8.03e-11 65 33 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7A1J1 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 9.24e-11 65 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 9.24e-11 65 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 9.24e-11 65 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 9.24e-11 65 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 9.24e-11 65 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P48359 9.67e-11 64 30 1 118 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P42508 1.14e-10 63 28 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P94504 1.17e-10 65 29 3 158 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q6H805 1.28e-10 67 39 2 103 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 1.3e-10 67 39 2 103 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
L7N689 2.1e-10 64 33 0 100 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P42244 2.2e-10 63 29 2 157 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P58662 2.48e-10 66 36 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0DMC5 2.75e-10 66 36 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
A7HD44 2.79e-10 63 37 0 100 1 Anae109_2439 Response regulator receiver protein Anae109_2439 Anaeromyxobacter sp. (strain Fw109-5)
P52942 4.03e-10 60 29 0 114 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
O49397 4.35e-10 65 38 2 103 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
P62598 4.47e-10 65 39 2 103 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P51343 5.8e-10 62 36 1 115 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q3LWR6 5.98e-10 62 30 0 120 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 5.98e-10 62 30 0 120 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 5.98e-10 62 30 0 120 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q49ZT8 6.66e-10 62 32 1 101 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A216 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 6.8e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 6.8e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 6.8e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 6.8e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQK0 6.93e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 6.93e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P50350 7.51e-10 62 36 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q4A160 8.12e-10 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q44929 8.7e-10 62 30 1 105 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
A1TEL7 1.04e-09 62 31 0 100 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1W0A5 1.04e-09 59 30 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.04e-09 59 30 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.04e-09 59 30 3 118 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P9WGN1 1.05e-09 62 33 1 104 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.05e-09 62 33 1 104 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P50351 1.11e-09 62 36 1 101 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0DMC6 1.14e-09 64 35 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q4LAJ9 1.2e-09 62 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q9FXD6 1.21e-09 63 34 2 103 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q04803 1.22e-09 62 33 1 103 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P35163 1.27e-09 62 33 1 108 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q8CQ17 1.66e-09 61 32 1 102 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 1.66e-09 61 32 1 102 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O82868 2.4e-09 60 27 1 143 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
P0C5S3 2.49e-09 60 30 0 111 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
Q8CN92 2.86e-09 60 32 1 125 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN2 2.88e-09 60 32 1 125 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2FWH6 3.16e-09 60 28 1 108 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5N6V8 3.3e-09 62 35 2 103 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
P48027 3.38e-09 62 32 2 119 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q4L6C6 3.57e-09 60 28 1 112 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P72781 3.71e-09 60 35 2 110 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37478 3.76e-09 60 30 2 130 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
A6UEL7 3.85e-09 59 30 0 111 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
A0A4P7TS68 4.67e-09 60 28 0 107 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 4.67e-09 60 28 0 107 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 4.67e-09 60 28 0 107 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 4.67e-09 60 28 0 107 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 4.67e-09 60 28 0 107 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 4.67e-09 60 28 0 107 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 4.67e-09 60 28 0 107 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 4.67e-09 60 28 0 107 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
Q4L8L9 4.83e-09 60 32 1 101 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q8KR08 5.07e-09 59 31 0 116 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
A0PWB4 6.05e-09 59 29 0 103 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q1B3X8 6.13e-09 59 31 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 6.13e-09 59 31 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 6.13e-09 59 31 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
A1KHB7 6.42e-09 59 29 0 103 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 6.42e-09 59 29 0 103 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P21710 6.51e-09 54 96 0 26 4 yfhA Uncharacterized protein in glnB 5'region (Fragment) Klebsiella oxytoca
Q6K8X6 6.52e-09 62 36 2 103 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
O34903 6.62e-09 59 27 0 118 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
B8AEH1 6.69e-09 61 36 2 103 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q5SML5 7.09e-09 61 36 2 103 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
P0A4H5 7.1e-09 57 33 1 115 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 7.1e-09 57 33 1 115 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8B3I4 7.41e-09 61 36 2 103 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q07783 8.13e-09 59 34 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q55890 8.36e-09 59 30 1 104 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGM9 1.06e-08 58 29 0 103 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.06e-08 58 29 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.06e-08 58 29 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P0DOA0 1.1e-08 61 33 3 121 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P24072 1.28e-08 56 31 1 115 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P26487 1.44e-08 58 30 0 112 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9CD68 1.55e-08 58 29 0 100 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A0QTK2 1.62e-08 58 33 1 100 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P15940 2.06e-08 58 28 1 126 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q742C1 2.45e-08 57 29 0 100 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.45e-08 57 29 0 100 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q8D0P1 2.96e-08 55 31 2 122 3 cheY Chemotaxis protein CheY Yersinia pestis
A0R3I8 3.03e-08 57 29 0 103 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7CQM8 3.24e-08 57 29 0 116 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B8GZM2 4.51e-08 58 30 1 115 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 4.51e-08 58 30 1 115 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B8H358 5.88e-08 57 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 5.88e-08 57 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P96602 6.25e-08 56 30 5 149 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P21866 7.11e-08 56 32 1 101 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q9ZWJ9 7.8e-08 58 35 3 112 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q8FZ93 7.94e-08 56 27 0 106 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 7.94e-08 56 27 0 106 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 7.94e-08 56 27 0 106 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 7.94e-08 56 27 0 106 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 7.94e-08 56 27 0 106 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 7.94e-08 56 27 0 106 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 7.94e-08 56 27 0 106 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 7.94e-08 56 27 0 106 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 8.01e-08 56 27 0 106 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q940D0 8.23e-08 58 34 2 108 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q31S42 8.85e-08 56 30 1 104 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9KM66 9.27e-08 58 31 3 110 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P26275 1.01e-07 56 33 4 120 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54443 1.19e-07 55 31 2 107 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
O32192 1.35e-07 55 26 3 182 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
Q9F8D7 1.49e-07 57 30 1 119 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9AE24 1.55e-07 55 29 0 124 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q9LYP5 1.58e-07 57 25 5 154 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q9WY30 1.76e-07 56 28 1 114 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9CCJ2 1.82e-07 55 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P9WGM7 1.84e-07 55 32 1 100 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.84e-07 55 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.84e-07 55 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93CB8 1.86e-07 55 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q49XM7 1.96e-07 55 28 1 106 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P37740 1.98e-07 54 33 1 102 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
A7N6S2 2.04e-07 57 28 1 113 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q8ZPP5 2.16e-07 57 32 1 119 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87940 2.21e-07 55 26 0 130 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
Q9ZHD3 2.32e-07 55 32 0 100 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P32040 2.68e-07 55 29 1 109 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P94413 2.76e-07 54 28 1 101 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q93P00 3.11e-07 52 30 2 122 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P30843 3.11e-07 54 30 0 110 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q8DN02 3.73e-07 54 33 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 3.73e-07 54 33 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
O31432 4.08e-07 54 31 2 106 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q9K621 4.68e-07 54 25 1 124 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
G3XCY6 5.34e-07 54 33 1 103 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q70FH0 8.04e-07 53 35 0 100 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q9KQD5 8.42e-07 51 28 2 123 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 8.42e-07 51 28 2 123 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9FAD7 8.57e-07 51 35 3 108 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P9WGM3 1.01e-06 52 30 3 150 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.01e-06 52 30 3 150 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9LZJ8 1.07e-06 54 31 4 114 2 ARR20 Putative two-component response regulator ARR20 Arabidopsis thaliana
Q06239 1.12e-06 53 28 1 103 3 vanR Regulatory protein VanR Enterococcus faecium
Q2SFK0 1.13e-06 53 31 3 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P0AEC5 1.21e-06 54 30 2 111 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.21e-06 54 30 2 111 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.21e-06 54 30 2 111 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q56312 1.25e-06 50 27 1 113 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P44895 1.28e-06 52 41 4 115 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A2D5 1.29e-06 50 29 2 122 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 1.29e-06 50 29 2 122 3 cheY Chemotaxis protein CheY Salmonella typhi
P0ACZ8 1.38e-06 52 30 0 100 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.38e-06 52 30 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.38e-06 52 30 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P0AE69 1.42e-06 50 30 2 122 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 1.42e-06 50 30 2 122 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 1.42e-06 50 30 2 122 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P36556 1.42e-06 52 28 0 110 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FGP6 1.55e-06 50 30 2 122 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P24086 1.57e-06 50 29 4 112 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 1.57e-06 50 29 4 112 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P59342 1.83e-06 54 30 1 110 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q9I4F9 2.25e-06 52 31 0 101 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2KCH7 2.34e-06 50 34 3 115 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A2YQ93 2.71e-06 53 26 2 114 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
Q0D3B6 2.85e-06 53 26 2 114 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
P0AEV3 3.06e-06 52 33 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 3.06e-06 52 33 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 3.06e-06 52 33 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P45337 3.33e-06 51 29 0 100 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P71403 4.35e-06 49 28 4 126 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q86AT9 4.41e-06 53 29 3 120 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q93WK5 5.16e-06 52 27 2 110 1 APRR7 Two-component response regulator-like APRR7 Arabidopsis thaliana
Q9KSB1 5.3e-06 52 31 2 105 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9ZM64 5.34e-06 48 28 4 126 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q7Y0W3 5.36e-06 52 29 2 103 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
O31517 5.44e-06 52 26 1 118 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
Q7Y0W5 5.55e-06 52 29 2 103 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
P39663 7e-06 50 26 1 116 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P76340 7.28e-06 50 31 1 100 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
O29221 7.32e-06 51 36 5 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O05251 7.74e-06 50 28 2 115 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
P52940 7.76e-06 50 30 3 136 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q01473 8.26e-06 52 28 0 102 3 rcaC Protein RcaC Microchaete diplosiphon
Q5A4X5 8.27e-06 52 28 0 114 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8L9Y3 8.71e-06 51 28 1 103 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q12YX1 1.01e-05 51 29 9 186 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
P31079 1.03e-05 50 27 2 147 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P96126 1.04e-05 48 29 2 118 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
P58253 1.04e-05 50 29 4 128 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P42421 1.06e-05 50 28 1 104 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P0CL17 1.11e-05 50 30 0 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.11e-05 50 30 0 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q44006 1.21e-05 49 30 1 100 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P23620 1.28e-05 49 26 1 103 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A2XFB7 1.29e-05 51 26 2 114 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. indica
Q10N34 1.3e-05 51 26 2 114 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. japonica
T2KMF4 1.48e-05 51 28 1 121 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P44918 1.57e-05 49 26 2 121 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52936 1.76e-05 49 31 3 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8X738 1.92e-05 49 29 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P0A4I0 2.09e-05 49 26 0 106 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.09e-05 49 26 0 106 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P52929 2.27e-05 48 29 3 118 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q2WAJ8 2.38e-05 50 33 5 129 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P52934 2.39e-05 49 30 3 128 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q9HUI2 2.61e-05 48 28 2 107 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z7H2 2.69e-05 48 30 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P38889 2.72e-05 50 28 0 111 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0DM78 2.81e-05 48 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 2.81e-05 48 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 2.81e-05 48 30 0 100 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 2.81e-05 48 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 2.81e-05 48 30 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q02540 2.89e-05 48 29 0 101 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
B0R4K1 2.91e-05 46 30 2 118 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q2YIF7 3.18e-05 46 27 1 98 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
Q8NYJ9 3.24e-05 48 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 3.24e-05 48 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 3.24e-05 48 36 1 82 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 3.24e-05 48 36 1 82 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 3.24e-05 48 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
P52931 3.25e-05 48 30 2 113 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q6GK93 3.27e-05 48 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
Q2YV56 3.4e-05 48 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WGM1 3.41e-05 48 32 2 96 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 3.41e-05 48 32 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 3.41e-05 48 32 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23836 3.54e-05 48 29 0 100 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 3.81e-05 48 29 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 3.81e-05 48 29 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I0I1 4.11e-05 48 33 0 100 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1A698 4.22e-05 49 27 4 138 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
O34951 4.26e-05 48 26 1 110 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
P24908 4.28e-05 48 29 1 102 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HV32 4.8e-05 48 31 1 92 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q51455 4.84e-05 46 26 2 121 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47456 4.85e-05 48 27 0 102 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P0A4I4 5.35e-05 48 31 3 116 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 5.35e-05 48 31 3 116 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P45607 5.51e-05 47 25 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q5HPC3 6.45e-05 47 30 1 108 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5L0L0 6.85e-05 48 26 7 197 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P45606 6.88e-05 47 25 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 7e-05 47 25 1 126 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 7e-05 47 25 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
A0A0H3GGB5 7.39e-05 47 39 2 102 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
O07528 7.39e-05 47 29 3 111 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q8H7S7 7.95e-05 48 31 2 103 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 8.02e-05 48 31 2 103 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
P0DMK7 8.19e-05 47 30 1 102 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 8.19e-05 47 30 1 102 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q7A7X9 8.37e-05 47 36 1 82 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)
Q99X00 8.37e-05 47 36 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P52928 8.42e-05 47 31 3 116 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q9KA55 9.02e-05 48 26 11 236 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0C0F6 9.2e-05 48 30 4 110 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8CP82 9.25e-05 47 30 1 108 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0C0F7 0.0001 48 30 4 110 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q9KL96 0.000102 47 33 6 113 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K998 0.000104 47 27 3 139 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9F868 0.000106 47 30 1 101 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q57QC3 0.000107 47 29 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q3ADG9 0.000111 47 31 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9FGT7 0.000112 48 33 3 103 2 ARR18 Two-component response regulator ARR18 Arabidopsis thaliana
Q8GP20 0.000113 47 28 0 127 1 rssB Swarming motility regulation protein RssB Serratia marcescens
Q4L8V4 0.000123 47 26 4 140 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09240
Feature type CDS
Gene glrR
Product two-component system response regulator GlrR
Location 2013877 - 2015214 (strand: -1)
Length 1338 (nucleotides) / 445 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_534
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07715 two-component system, NtrC family, response regulator GlrR Two-component system
Quorum sensing
-

Protein Sequence

MAGHKSANLLLVDDDPGLLKLLGMRLTSEGFHIVTAESGQEALKLLLKEKIDLVISDLRMDEMDGMALFAEIQRQQPGMPVIILTAHGSIPDAVAATQQGVFSFLTKPVDRDALYKAIDEALELVTTVSDEEWSKDIVTRSPQMLRLLEQAKLVAQSDVSVLINGQSGTGKEVLAQAIHRASPRAKKPFIAINCGALPEQLLESELFGHAKGAFTGAVSSREGLFQAAEGGTLFLDEIGDMPMALQVKLLRVLQERKVRPLGSNRDIDIDVRILSATHRDLPKAMERNEFREDLYYRLNVVNLRIPTLSERAEDIPVLANHLLRESAKRHKPFVRSFSTDAMKCLMTASWPGNVRQLVNVIEQCVALTTAPVISEALVTQALQGENTALPTFAEARGHFEMTYLRKLLQMTKGNVTQAARMAGRNRTEFYKLLSRHGLDANDFKE

Flanking regions ( +/- flanking 50bp)

AGCGCAACGGTTAAACCTACTGAAACAGGATCTAAATAAGGAGAATGTGCATGGCTGGCCATAAATCAGCGAATCTTTTACTTGTCGATGATGATCCGGGATTATTAAAGCTACTGGGTATGCGATTAACAAGTGAAGGGTTTCATATCGTTACCGCTGAAAGTGGGCAAGAAGCACTTAAACTATTATTAAAAGAAAAAATCGATCTGGTGATCAGCGATTTACGTATGGATGAAATGGATGGTATGGCGCTATTTGCAGAAATACAGCGCCAACAACCCGGTATGCCTGTGATTATTTTAACTGCACATGGCTCCATTCCTGATGCTGTCGCGGCAACTCAACAGGGGGTGTTTAGTTTCTTGACTAAACCTGTTGATAGAGATGCGCTTTATAAAGCTATCGATGAAGCATTAGAATTAGTGACGACGGTATCTGATGAAGAGTGGTCAAAAGATATCGTGACCCGTAGCCCCCAAATGTTACGTTTATTAGAGCAAGCCAAGTTAGTTGCACAATCCGATGTTAGCGTACTGATTAATGGGCAAAGCGGTACAGGTAAAGAAGTCCTTGCTCAAGCAATCCACCGCGCCAGCCCACGAGCTAAAAAACCCTTTATTGCTATTAACTGCGGTGCTTTACCTGAACAATTATTAGAATCTGAACTATTTGGGCATGCTAAAGGTGCTTTTACTGGCGCGGTAAGTAGTCGTGAAGGACTTTTCCAAGCGGCAGAAGGAGGCACTCTATTTTTGGATGAAATTGGTGATATGCCAATGGCATTGCAAGTGAAATTACTGCGTGTATTACAAGAGCGTAAAGTGCGGCCATTAGGCAGTAATCGTGATATTGATATTGATGTGCGTATTCTTTCTGCAACCCACCGTGACTTACCAAAAGCGATGGAGCGTAATGAATTTCGAGAAGATTTATACTATCGTTTAAATGTGGTGAATTTACGTATCCCCACGTTGAGCGAAAGAGCCGAGGATATTCCTGTTCTTGCTAACCATTTATTGCGCGAATCAGCAAAACGACATAAACCTTTTGTGCGTAGCTTCTCAACGGATGCGATGAAATGCCTAATGACAGCAAGTTGGCCGGGAAATGTGCGTCAGTTAGTTAACGTCATCGAGCAATGTGTCGCTTTAACGACTGCACCTGTGATTAGCGAAGCCCTTGTCACACAAGCATTGCAAGGGGAAAATACCGCATTACCTACTTTTGCTGAAGCACGAGGCCATTTTGAGATGACCTATTTAAGGAAGTTATTGCAGATGACAAAGGGCAATGTCACTCAAGCTGCAAGGATGGCAGGGCGAAATCGAACAGAATTTTATAAATTGTTGTCACGTCATGGACTTGATGCCAATGATTTCAAAGAATGATCTTTGTAGATAACAAAAATTTTTTTAAACTTGCTTTCTTTAGATAGCAA