Homologs in group_611

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01185 FBDBKF_01185 100.0 Morganella morganii S1 qseF two-component system response regulator QseF/GlrR
EHELCC_00360 EHELCC_00360 100.0 Morganella morganii S2 qseF two-component system response regulator QseF/GlrR
NLDBIP_03100 NLDBIP_03100 100.0 Morganella morganii S4 qseF two-component system response regulator QseF/GlrR
HKOGLL_02430 HKOGLL_02430 100.0 Morganella morganii S5 qseF two-component system response regulator QseF/GlrR
F4V73_RS07255 F4V73_RS07255 96.2 Morganella psychrotolerans glrR two-component system response regulator GlrR
PMI_RS09240 PMI_RS09240 87.6 Proteus mirabilis HI4320 glrR two-component system response regulator GlrR

Distribution of the homologs in the orthogroup group_611

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_611

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFU5 0.0 746 83 1 444 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 0.0 746 83 1 444 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q8Z333 4.69e-119 357 44 4 443 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P14375 5.12e-119 357 44 4 440 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P25852 1.02e-118 357 44 3 443 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X613 2.65e-117 353 44 5 440 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q9APD9 1.24e-115 349 44 3 437 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q06065 3.63e-112 340 41 5 454 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P03029 1.06e-101 314 39 6 467 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P0AFB8 5.66e-101 312 38 4 465 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 5.66e-101 312 38 4 465 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q00934 1.6e-100 310 43 0 359 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P41789 5.51e-100 310 38 6 469 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28787 9.75e-100 309 38 8 492 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P13632 1.34e-99 308 40 5 448 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q9I4N3 5.63e-96 299 44 2 372 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10046 1.6e-94 295 39 4 443 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q9HU19 2.12e-91 287 39 5 442 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23747 4.71e-91 286 42 1 370 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87MX7 4.61e-88 278 41 3 366 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C5S5 6.3e-88 278 41 3 366 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 6.3e-88 278 41 3 366 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q88RJ6 2.62e-87 276 41 1 363 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88AQ2 3.35e-87 276 41 1 363 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P10577 5.05e-87 276 39 4 386 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45671 1.61e-85 273 36 7 468 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q7MM78 2.14e-85 271 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.14e-85 271 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q04848 2.54e-84 270 38 2 383 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9KT84 2.7e-83 266 39 3 364 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10576 1.74e-82 265 34 5 465 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P29267 8.85e-80 258 35 7 478 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P71229 4.4e-79 261 54 0 232 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
O25408 3.68e-77 248 38 5 374 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P05407 1.58e-75 249 54 2 235 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P09570 3.25e-75 247 48 3 258 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P27713 4.95e-75 247 51 0 241 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P19323 1.42e-74 249 43 2 331 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P0CL46 1.75e-74 249 42 2 329 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
G3XCV0 4.15e-74 243 53 1 220 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
E1WAA4 4.44e-74 248 42 2 329 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
Q4UL27 7.46e-74 242 31 9 458 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZCY9 1.2e-73 241 31 9 458 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q3K999 1.75e-73 238 54 2 228 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P26047 8.31e-73 243 37 6 354 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q04849 8.88e-73 239 34 6 449 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P31908 1.29e-72 239 35 9 474 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q01265 2.83e-72 232 46 2 238 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q68WH4 5.84e-72 237 30 9 458 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q46802 3.97e-71 238 48 1 245 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P17899 4.93e-71 234 38 6 369 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O31551 5.51e-71 238 43 7 318 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
Q9KN48 5.99e-71 236 40 8 360 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P12627 5.36e-70 233 41 2 313 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q845S7 6.53e-70 229 52 0 219 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P09133 2.23e-69 234 50 1 239 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P03027 2.31e-69 232 47 1 244 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 2.71e-69 231 47 1 244 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
Q1RJS1 3.27e-69 230 29 8 459 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
B4TF23 4.55e-69 231 40 3 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B5FSZ0 1.53e-68 229 39 2 314 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
A4WDR5 3.07e-68 228 46 0 245 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B5F363 3.15e-68 228 40 3 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A8ANR6 5.01e-68 228 40 2 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0PWN2 1.92e-67 226 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
P54930 2.51e-67 226 46 1 244 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
O85057 2.6e-67 227 41 7 315 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q8ZMJ8 3.57e-67 226 40 3 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 3.57e-67 226 40 3 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q92HC2 4.39e-67 224 31 9 458 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8Z4C6 1.76e-66 224 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.76e-66 224 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.76e-66 224 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.76e-66 224 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
A9MFX7 1.85e-66 224 46 0 241 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5RDG4 2.06e-66 224 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 2.24e-66 223 48 0 228 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P74839 2.89e-66 224 41 8 323 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B6I695 3.26e-66 223 40 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B7LW25 3.33e-66 223 40 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Z370 4.25e-66 223 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 4.25e-66 223 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
A7ZQD8 4.34e-66 223 40 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P59402 4.62e-66 223 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 4.62e-66 223 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B4T3B0 6.5e-66 222 39 3 311 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
P37013 6.61e-66 222 39 2 312 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 6.61e-66 222 39 2 312 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 6.61e-66 222 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q32CL9 6.97e-66 222 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
Q1R7Z1 1.96e-65 221 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 1.96e-65 221 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 1.96e-65 221 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
P12626 2.37e-65 221 39 2 312 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q53206 2.53e-65 223 48 1 232 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P54931 2.92e-65 223 47 1 234 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B7LEC0 3.85e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B7UHC1 4.41e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TEH1 4.9e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MZ04 4.9e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
B7N6T9 5.17e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FEN6 5.22e-65 220 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B5XVA2 5.27e-65 220 47 2 233 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
A6TCX4 5.92e-65 220 39 4 317 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1LQ27 6.25e-65 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
P54929 6.8e-65 223 49 1 237 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
Q3YYF5 9.32e-65 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7M9E6 9.42e-65 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B7NSI9 1.01e-64 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1IUX0 1.24e-64 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 1.35e-64 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
A8A3I6 1.47e-64 219 39 2 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
P30667 1.82e-64 221 47 1 253 1 nifA Nif-specific regulatory protein Azospirillum brasilense
A4STH5 2.05e-64 218 37 2 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P24426 8.51e-64 212 45 1 237 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
A0KEJ0 1.75e-63 216 45 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
D5ARW9 4.03e-63 217 47 1 234 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 5.12e-63 216 47 1 234 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P06519 4.88e-62 213 39 4 310 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q43965 8.01e-62 213 39 4 302 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P09828 1.07e-61 211 46 1 240 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P38022 1.62e-61 209 38 4 313 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
O87455 3.14e-61 211 43 1 239 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q5E3W8 1.1e-60 209 36 2 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P77743 1.66e-60 209 39 8 318 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q9ZIB7 8.12e-60 206 43 2 244 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
Q7MFY9 1.22e-59 206 40 3 290 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P54529 1.22e-59 209 45 1 226 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
A8GG93 2.69e-59 205 44 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
Q8D4F9 3.93e-59 204 37 5 329 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P37344 1.36e-58 198 38 5 311 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q6D8R9 2.95e-58 202 44 0 234 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P28614 1.03e-57 204 38 7 320 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9K4U8 2.25e-57 200 44 2 229 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P03028 4.28e-56 197 44 1 242 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P07604 2.64e-52 186 42 3 240 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
Q9K4V0 4.76e-52 186 44 3 236 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0A2D7 1.14e-51 185 42 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.14e-51 185 42 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P37931 1.49e-51 179 44 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P26316 2.3e-51 178 45 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P26408 3.5e-51 183 29 8 475 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
O54426 8.4e-51 182 41 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P09432 2.61e-48 174 30 8 472 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P36219 1.01e-47 169 42 1 204 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P37930 1.24e-47 169 43 1 200 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P38035 1.76e-41 157 37 6 250 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P44694 1.87e-41 152 34 4 282 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P76016 1.32e-38 151 33 6 314 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P45512 1.67e-33 136 30 7 323 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P54156 2.46e-33 131 36 6 226 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P06184 1.73e-32 130 25 8 425 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55610 1.76e-21 100 31 3 228 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 3.85e-18 90 34 5 179 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P51586 6.13e-15 74 41 1 105 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q9TLQ4 6.33e-15 77 40 1 105 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P23914 1.05e-14 80 32 6 207 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
Q1XDE4 4.04e-14 74 35 1 120 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P23221 1.64e-13 72 29 0 135 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P43501 7.27e-13 68 35 1 119 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A039 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 8.31e-13 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
O78428 8.65e-13 71 39 1 100 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q6GE73 1.2e-12 70 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q3LWR6 1.63e-12 70 31 0 127 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.63e-12 70 31 0 127 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.63e-12 70 31 0 127 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P06628 1.76e-12 67 31 2 119 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
A6QJK3 2.65e-12 69 36 1 101 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.65e-12 69 36 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q56128 3.48e-12 72 38 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P28257 4.58e-12 69 36 1 105 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P48259 6.27e-12 68 33 2 131 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
O69730 7.8e-12 68 30 0 101 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P52942 8.39e-12 65 30 0 116 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q7CQM8 1.04e-11 67 30 0 124 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1XDC9 1.05e-11 68 37 1 100 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P58662 1.17e-11 70 37 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YZ24 1.26e-11 67 35 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0DMC5 1.29e-11 70 37 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P51358 1.5e-11 67 36 1 100 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
O34903 1.7e-11 67 30 0 126 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
A0R3I8 1.92e-11 67 32 1 141 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8KR08 1.97e-11 67 33 0 117 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q04942 1.98e-11 67 34 1 102 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P51343 2.28e-11 66 36 1 119 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P48359 4.5e-11 65 29 1 117 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q7D9K0 4.9e-11 66 31 0 108 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 4.9e-11 66 31 0 108 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0DMC6 5.62e-11 68 36 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P28835 6.13e-11 65 34 1 100 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P72781 8.25e-11 65 34 2 119 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
L7N689 8.69e-11 65 33 0 100 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q53228 2.04e-10 63 30 0 111 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8DPL7 2.24e-10 63 34 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 2.24e-10 63 34 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 2.24e-10 63 34 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6H805 2.99e-10 65 39 2 103 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 2.99e-10 65 39 2 103 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
A1TEL7 3.89e-10 63 33 0 100 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0PWB4 4.13e-10 63 32 0 103 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1KHB7 4.5e-10 63 32 0 103 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 4.5e-10 63 32 0 103 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5HLN2 5.7e-10 62 34 1 103 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0C5S3 6.06e-10 62 31 0 111 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
Q1B3X8 6.19e-10 62 33 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 6.19e-10 62 33 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 6.19e-10 62 33 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q8CN92 6.44e-10 62 34 1 103 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A1W0A5 6.71e-10 60 31 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 6.71e-10 60 31 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 6.71e-10 60 31 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P9WGM9 7.06e-10 62 32 0 103 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 7.06e-10 62 32 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 7.06e-10 62 32 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
B8GZM2 8.55e-10 64 33 1 112 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 8.55e-10 64 33 1 112 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P42508 8.76e-10 61 27 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q44929 9.5e-10 62 30 1 105 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
A6UEL7 9.66e-10 61 31 0 111 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q04803 1.07e-09 63 33 1 103 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A1J1 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.11e-09 62 30 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.11e-09 62 30 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.11e-09 62 30 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.11e-09 62 30 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.11e-09 62 30 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q9CD68 1.25e-09 61 32 0 100 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P13792 1.3e-09 62 32 0 103 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q49ZT8 1.5e-09 61 30 1 123 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2FWH6 1.59e-09 61 27 1 108 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q742C1 1.63e-09 61 31 0 101 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.63e-09 61 31 0 101 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P10958 1.72e-09 60 30 0 111 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
O49397 1.73e-09 63 37 2 103 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
A7N6S2 2.22e-09 63 29 2 124 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P37478 2.36e-09 61 33 1 100 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P94504 3.59e-09 60 29 3 157 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q7A0U4 3.66e-09 60 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 3.66e-09 60 31 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 3.66e-09 60 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 3.66e-09 60 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 3.66e-09 60 31 1 103 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 3.66e-09 60 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 3.66e-09 60 31 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 3.66e-09 60 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
A7HD44 3.74e-09 60 30 2 145 1 Anae109_2439 Response regulator receiver protein Anae109_2439 Anaeromyxobacter sp. (strain Fw109-5)
A0QTK2 4.12e-09 60 33 1 100 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P62598 4.41e-09 62 38 2 103 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
Q8CQ17 4.54e-09 60 31 1 102 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 4.54e-09 60 31 1 102 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A216 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 5.39e-09 60 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 5.39e-09 60 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 5.39e-09 60 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 5.39e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CQK0 5.55e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 5.55e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P50350 5.82e-09 60 35 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P0DOA0 6.35e-09 62 36 3 106 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P48027 6.48e-09 62 30 3 158 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q4A160 8.06e-09 59 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P50351 8.55e-09 59 35 1 101 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4L8L9 8.67e-09 59 32 1 101 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q5SML5 9.26e-09 61 36 2 103 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 9.59e-09 61 36 2 103 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
B8AEH1 1.02e-08 61 37 2 103 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q6K8X6 1.04e-08 61 37 2 103 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
P21710 1.05e-08 53 92 0 26 4 yfhA Uncharacterized protein in glnB 5'region (Fragment) Klebsiella oxytoca
P26487 1.14e-08 58 31 0 115 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q07783 1.15e-08 58 35 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P9WGN1 1.17e-08 58 32 1 104 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.17e-08 58 32 1 104 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O82868 1.57e-08 57 27 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q9FXD6 1.57e-08 60 33 2 103 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q50136 1.67e-08 58 36 1 86 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q5N6V8 1.75e-08 60 35 2 103 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q4LAJ9 1.82e-08 58 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P24072 1.87e-08 55 30 1 115 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P0C001 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 3.07e-08 57 30 1 106 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 3.07e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
A6WZ81 3.23e-08 57 24 3 192 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q99U73 3.28e-08 57 30 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q93CB8 4.23e-08 57 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q55890 4.39e-08 57 26 2 140 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9CCJ2 4.6e-08 57 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P9WGM7 4.95e-08 57 32 1 100 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.95e-08 57 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.95e-08 57 32 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P44895 5.08e-08 57 39 2 130 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37740 5.11e-08 56 33 1 102 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q9F8D7 5.79e-08 58 31 1 119 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P94413 7.24e-08 56 30 1 100 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q8FZ93 7.82e-08 56 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 7.82e-08 56 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 7.82e-08 56 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 7.82e-08 56 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 7.82e-08 56 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 7.82e-08 56 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 7.82e-08 56 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 7.82e-08 56 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q9KM66 7.96e-08 58 28 1 115 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O31432 8.23e-08 56 33 2 106 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q06239 1.04e-07 56 29 1 103 3 vanR Regulatory protein VanR Enterococcus faecium
Q70FH0 1.07e-07 55 36 0 100 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q9ZWJ9 1.21e-07 57 35 2 108 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q9I4F9 1.31e-07 55 26 1 155 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P35163 1.37e-07 55 30 1 108 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P0A4H5 1.41e-07 53 32 1 115 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.41e-07 53 32 1 115 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P54443 1.42e-07 55 32 2 107 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
A0A4P7TS68 1.78e-07 55 28 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.78e-07 55 28 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.78e-07 55 28 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.78e-07 55 28 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.78e-07 55 28 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.78e-07 55 28 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.78e-07 55 28 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.78e-07 55 28 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
P30843 1.78e-07 55 30 0 110 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
P26275 1.89e-07 55 33 4 120 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9AE24 2.01e-07 55 30 0 106 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P45337 2.7e-07 54 29 0 100 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8X738 2.9e-07 54 31 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P21866 2.97e-07 54 32 1 101 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q940D0 3.51e-07 56 34 2 108 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q8Z7H2 3.77e-07 54 32 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DM78 3.81e-07 54 32 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 3.81e-07 54 32 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 3.81e-07 54 32 0 100 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 3.81e-07 54 32 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 3.81e-07 54 32 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B8H358 3.9e-07 54 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 3.9e-07 54 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O87940 4.21e-07 54 29 1 128 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
O05251 4.94e-07 54 29 2 115 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
B0R4K1 5.29e-07 51 30 0 117 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P23836 5.52e-07 53 31 0 100 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 5.73e-07 53 31 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 5.73e-07 53 31 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
G3XCY6 5.77e-07 53 33 1 103 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31S42 5.94e-07 53 29 1 104 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9K621 5.97e-07 53 25 2 135 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q93P00 7.43e-07 51 31 2 109 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q8D0P1 7.51e-07 51 31 2 109 3 cheY Chemotaxis protein CheY Yersinia pestis
P0AE69 7.65e-07 51 32 2 109 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 7.65e-07 51 32 2 109 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 7.65e-07 51 32 2 109 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P0A2D5 7.73e-07 51 31 2 109 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 7.73e-07 51 31 2 109 3 cheY Chemotaxis protein CheY Salmonella typhi
Q9FAD7 9.65e-07 51 32 2 109 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P0AEV3 9.71e-07 54 33 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 9.71e-07 54 33 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 9.71e-07 54 33 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P38889 9.97e-07 54 28 0 115 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8FGP6 1.02e-06 51 32 2 109 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42244 1.09e-06 53 24 2 158 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P36556 1.11e-06 52 28 0 110 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P24086 1.39e-06 50 28 4 121 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 1.39e-06 50 28 4 121 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q57QC3 1.63e-06 52 31 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q9KSB1 1.79e-06 53 32 3 105 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0CL17 2.07e-06 52 31 0 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 2.07e-06 52 31 0 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q44006 2.23e-06 52 32 1 100 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9ZHD3 2.24e-06 52 31 0 100 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q4L6C6 2.32e-06 52 25 1 112 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P32040 2.56e-06 52 29 1 109 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P9WGL9 2.72e-06 52 31 1 101 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 2.72e-06 52 31 1 101 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 2.72e-06 52 31 1 101 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9F868 2.85e-06 51 31 1 101 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0DMK7 3.31e-06 51 30 1 103 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 3.31e-06 51 30 1 103 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q9ZM64 3.63e-06 49 29 3 104 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q6K9T0 3.7e-06 49 30 2 105 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 3.7e-06 49 30 2 105 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q7Y0W5 4.23e-06 52 30 2 103 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
Q7Y0W3 4.26e-06 52 30 2 103 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
P96602 4.61e-06 51 27 2 119 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q49XM7 4.79e-06 50 26 1 106 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9LYP5 4.84e-06 52 27 2 118 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q8L9Y3 5.01e-06 52 29 1 103 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q5A4X5 5.96e-06 52 29 0 108 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
P15940 5.98e-06 50 27 0 116 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P71403 6.18e-06 48 29 3 104 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q47456 6.31e-06 50 27 0 102 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
A1A698 6.37e-06 52 28 4 139 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q23917 7.75e-06 52 32 4 121 1 regA 3',5'-cyclic-nucleotide phosphodiesterase regA Dictyostelium discoideum
Q56312 7.82e-06 48 27 1 112 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2SFK0 8.17e-06 51 31 3 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
P0AEC5 8.22e-06 52 28 3 121 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 8.22e-06 52 28 3 121 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 8.22e-06 52 28 3 121 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q01473 8.3e-06 52 25 2 152 3 rcaC Protein RcaC Microchaete diplosiphon
Q6H468 8.8e-06 48 31 4 106 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 8.8e-06 48 31 4 106 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
P0ACZ8 8.9e-06 50 29 0 100 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 8.9e-06 50 29 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 8.9e-06 50 29 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q54YZ9 9.65e-06 52 30 3 130 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q2HWH1 1.03e-05 48 30 2 105 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 1.03e-05 48 30 2 105 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
P9WGM1 1.04e-05 50 34 2 96 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.04e-05 50 34 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.04e-05 50 34 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54YH4 1.08e-05 52 28 1 121 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P59342 1.12e-05 51 28 3 121 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0C0F6 1.18e-05 51 32 6 152 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8NYJ9 1.38e-05 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 1.38e-05 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 1.38e-05 50 34 1 82 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 1.38e-05 50 34 1 82 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 1.38e-05 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
P0C0F7 1.39e-05 51 32 6 152 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q9LVG4 1.42e-05 50 29 2 114 1 APRR3 Two-component response regulator-like APRR3 Arabidopsis thaliana
Q2YV56 1.46e-05 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GK93 1.47e-05 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
A1A699 1.53e-05 51 27 4 137 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q93WK5 1.53e-05 51 28 2 114 1 APRR7 Two-component response regulator-like APRR7 Arabidopsis thaliana
P31079 1.58e-05 49 29 1 103 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9I0I1 1.83e-05 49 33 0 100 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96126 1.85e-05 47 29 2 118 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
A2XE31 1.89e-05 50 32 2 103 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q8H7S7 1.97e-05 50 32 2 103 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
P52934 2.27e-05 49 29 2 127 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q86AT9 2.64e-05 50 27 3 120 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q8GP20 2.84e-05 48 27 1 137 1 rssB Swarming motility regulation protein RssB Serratia marcescens
Q9KQD5 2.92e-05 47 27 2 118 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 2.92e-05 47 27 2 118 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q2KCH7 3.86e-05 46 28 2 122 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8ZPP5 4.15e-05 49 30 1 117 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q10WZ6 4.26e-05 49 31 3 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P52076 4.64e-05 48 32 0 100 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
A0A0H3GGB5 4.86e-05 48 39 2 102 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q8XBS3 4.86e-05 48 32 0 100 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P0A4I0 4.96e-05 48 26 0 106 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 4.96e-05 48 26 0 106 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P66795 5.74e-05 47 33 0 100 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 5.74e-05 47 33 0 100 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
O06978 5.76e-05 48 32 1 100 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P52929 6.04e-05 47 29 4 143 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q9P896 6.28e-05 49 28 2 114 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P08368 6.41e-05 47 28 0 101 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
E0X9C7 6.6e-05 49 32 2 102 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
O32192 6.78e-05 47 29 1 103 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P58253 6.97e-05 48 29 3 118 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q02540 7.16e-05 47 29 0 101 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
O31517 7.62e-05 48 25 1 119 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
P76340 7.86e-05 47 29 1 100 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P52940 8.59e-05 47 32 3 114 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
P30855 8.59e-05 48 29 0 114 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
O34951 8.59e-05 47 23 2 135 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q8DN02 8.94e-05 47 31 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 8.94e-05 47 31 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8GVV6 9.24e-05 45 30 4 108 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 9.24e-05 45 30 4 108 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
A5W4E3 9.57e-05 48 32 2 102 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P24908 9.82e-05 47 28 1 102 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07597 0.000109 47 27 1 100 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
O14283 0.000117 48 28 0 105 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P44918 0.000119 47 27 2 121 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42421 0.000121 47 27 1 104 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q67W50 0.000125 48 33 2 103 3 RR25 Two-component response regulator ORR25 Oryza sativa subsp. japonica
Q82EB1 0.000154 46 28 1 103 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q689G6 0.000165 47 28 3 119 2 PRR95 Two-component response regulator-like PRR95 Oryza sativa subsp. japonica
Q9ZEP4 0.000169 46 28 1 103 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4UU85 0.000208 47 33 1 71 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
T2KMF4 0.000213 47 27 2 112 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q9ZWS7 0.000235 45 27 2 115 1 ARR7 Two-component response regulator ARR7 Arabidopsis thaliana
Q9HUI2 0.000235 46 28 2 107 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9SXL4 0.000244 47 24 2 147 1 AHK1 Histidine kinase 1 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_04615
Feature type CDS
Gene qseF
Product two-component system response regulator QseF/GlrR
Location 199440 - 200780 (strand: -1)
Length 1341 (nucleotides) / 446 (amino acids)
In genomic island -

Contig

Accession ZDB_361
Length 286024 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_611
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07715 two-component system, NtrC family, response regulator GlrR Two-component system
Quorum sensing
-

Protein Sequence

MTARRSANLLLVDDDPGLLKLLGMRLSSEGFRVSTAESGPEALKVLNKEKIDLVISDLRMDEMDGMALFAEIQKTHSGMPVIILTAHGSIPDAVAATREGVFSFLTKPVDRDALYKAIDDALALSTTTVSDESWCEGVVTRSPLMLRLLEQARMVAQSDVSVLINGQSGTGKEVLAQAIHKASPRAKKPFIAINCGALPEQLLESELFGHAKGAFTGAVSSREGLFQAAESGTLFLDEIGDMPMPLQVKLLRVLQERKVRPLGSNRDIDIDVRVISATHRDLPKAMEKHEFREDLYYRLNVVNLKIPTLHERAEDIPLLANHILREAAKKHKPFVRSFSPDAMKCLMGASWPGNVRQLLNVIEQCVALSTVPVISEALVTQALEGENTALPTFAEARNQFELNYLRKLLQMTKGNVTNAARLAGRNRTEFYKLLSRHELDAADFKE

Flanking regions ( +/- flanking 50bp)

AAAAGCCGCAGAAACAAAACCGGCACAGGAAAAAAAGGAGTAACCCCGGCATGACAGCACGCCGCAGCGCAAACTTATTATTGGTTGATGATGATCCGGGTTTACTGAAACTACTGGGTATGCGCCTGAGCAGTGAAGGTTTCCGGGTATCAACGGCAGAAAGCGGCCCTGAAGCGCTGAAGGTACTCAATAAAGAAAAAATCGATCTGGTCATCAGCGACCTGCGGATGGATGAAATGGATGGTATGGCGCTGTTTGCCGAGATCCAGAAAACCCATTCCGGCATGCCTGTGATTATCCTGACGGCTCACGGCTCCATTCCGGATGCCGTGGCCGCCACCCGTGAGGGCGTGTTCAGCTTCCTGACCAAACCAGTGGATCGCGATGCATTATATAAAGCGATTGACGATGCGCTGGCACTTTCCACCACCACGGTCAGTGATGAATCCTGGTGTGAGGGGGTTGTGACCCGCAGCCCGCTGATGCTGCGTCTGCTGGAACAGGCACGTATGGTGGCGCAGTCCGACGTCAGTGTGCTGATCAACGGTCAGAGCGGTACCGGGAAAGAGGTACTGGCCCAGGCTATCCACAAAGCCAGTCCGAGAGCGAAAAAACCGTTTATCGCCATCAACTGTGGTGCACTGCCGGAGCAGTTGCTGGAATCCGAGTTGTTCGGCCATGCCAAAGGTGCCTTTACCGGCGCGGTGAGCAGCCGGGAAGGGCTGTTCCAGGCGGCAGAGAGCGGAACACTGTTTCTCGATGAAATCGGGGATATGCCGATGCCGCTGCAGGTCAAACTGCTGCGTGTTCTGCAGGAGCGCAAAGTGCGCCCGCTCGGCAGTAACCGCGACATTGATATTGATGTCCGCGTCATTTCCGCGACACACCGCGATTTACCCAAGGCGATGGAAAAACACGAATTCCGTGAAGATCTCTACTACCGCCTCAATGTGGTTAACCTGAAAATTCCGACACTCCATGAGCGGGCTGAAGATATCCCGCTGCTGGCCAATCATATTCTGCGCGAAGCGGCGAAAAAACATAAGCCGTTTGTCCGCAGCTTCTCTCCGGATGCCATGAAATGCCTGATGGGCGCGAGCTGGCCGGGCAACGTCCGTCAGCTGCTTAACGTTATCGAGCAGTGTGTGGCGCTGTCCACCGTGCCGGTGATCAGTGAGGCGCTGGTGACTCAGGCGCTGGAAGGGGAAAACACGGCGCTGCCGACCTTTGCGGAAGCCCGTAACCAGTTTGAACTTAATTATTTACGCAAACTTCTCCAGATGACCAAAGGTAACGTGACCAACGCGGCCCGTCTGGCGGGGCGTAACCGGACAGAGTTCTATAAATTACTGTCCCGTCATGAGCTGGATGCGGCCGACTTTAAAGAATAAGCAAAGAATCGGTGTGAACCGGCACATTTTGCTATCATCTTCATTATTAG