Homologs in group_611

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01185 FBDBKF_01185 96.2 Morganella morganii S1 qseF two-component system response regulator QseF/GlrR
EHELCC_00360 EHELCC_00360 96.2 Morganella morganii S2 qseF two-component system response regulator QseF/GlrR
NLDBIP_03100 NLDBIP_03100 96.2 Morganella morganii S4 qseF two-component system response regulator QseF/GlrR
LHKJJB_04615 LHKJJB_04615 96.2 Morganella morganii S3 qseF two-component system response regulator QseF/GlrR
HKOGLL_02430 HKOGLL_02430 96.2 Morganella morganii S5 qseF two-component system response regulator QseF/GlrR
PMI_RS09240 PMI_RS09240 88.3 Proteus mirabilis HI4320 glrR two-component system response regulator GlrR

Distribution of the homologs in the orthogroup group_611

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_611

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFU5 0.0 744 83 1 444 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 0.0 744 83 1 444 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q8Z333 6.34e-118 355 44 4 443 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P14375 1.04e-117 354 44 3 439 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P25852 5.31e-117 352 44 3 443 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X613 1.54e-115 348 44 2 435 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q9APD9 3.55e-113 342 43 3 437 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q06065 6.89e-111 337 41 5 454 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q00934 2.13e-102 315 43 0 360 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFB8 1.42e-101 313 39 4 465 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.42e-101 313 39 4 465 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P03029 1.84e-101 313 40 6 467 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P28787 9.61e-101 311 38 8 493 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P13632 2.63e-100 310 40 5 450 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P41789 4.49e-100 310 39 6 469 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I4N3 2.95e-95 298 44 2 372 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10046 1.01e-93 293 39 4 443 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P23747 5.59e-92 288 43 1 370 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HU19 1.24e-91 288 40 4 442 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 2.86e-88 279 42 1 363 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88AQ2 4.69e-88 278 42 1 363 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P10577 1.28e-87 278 39 4 385 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45671 5.13e-86 274 36 6 466 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q87MX7 1.2e-85 272 40 3 366 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C5S5 1.31e-85 272 40 3 366 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.31e-85 272 40 3 366 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q04848 5.27e-84 269 37 2 383 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q7MM78 1.18e-83 267 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.18e-83 267 37 6 442 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q9KT84 4.38e-83 265 39 3 364 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10576 8.48e-82 263 34 5 465 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P29267 1.2e-80 260 35 7 478 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P71229 2.88e-80 264 54 0 232 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
O25408 3.76e-77 248 38 5 374 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P19323 1.11e-75 253 43 2 331 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P27713 5.33e-75 247 51 0 241 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P09570 1.51e-74 245 48 2 249 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P05407 1.61e-74 247 53 2 235 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0CL46 1.89e-74 249 42 2 329 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAA4 4.99e-74 248 42 2 329 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P26047 7.51e-74 246 38 4 354 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
G3XCV0 1.47e-73 242 53 1 220 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04849 7.1e-73 239 35 7 449 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9ZCY9 9.18e-73 239 30 9 458 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 1.08e-72 239 30 9 458 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P31908 2.57e-72 238 35 10 474 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q01265 3.22e-72 232 47 2 238 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q3K999 7.68e-72 234 53 2 228 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
O31551 1.81e-71 239 42 6 315 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P17899 2.17e-71 235 37 5 369 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9KN48 3.05e-71 237 40 8 360 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P12627 3.25e-71 236 41 2 313 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q68WH4 5.1e-71 235 30 9 458 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P09133 1.49e-70 237 51 1 239 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q46802 7.77e-70 235 48 1 245 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P03027 1.09e-68 230 47 1 244 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
Q1RJS1 1.28e-68 229 29 9 459 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P56266 1.31e-68 230 47 1 244 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
Q845S7 1.4e-68 225 52 0 219 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
B4TF23 2.8e-68 228 46 0 245 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B5FSZ0 7.73e-68 227 39 2 318 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P54931 1.01e-67 229 48 1 234 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O85057 1.06e-67 228 41 7 315 1 None Limonene hydroxylase Geobacillus stearothermophilus
B5F363 2.13e-67 226 39 3 315 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
B4T3B0 2.6e-67 226 39 3 315 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
A8ANR6 3.93e-67 225 39 2 315 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WDR5 4.04e-67 225 46 0 245 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B6I695 7.37e-67 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
A7ZQD8 1e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
C0PWN2 1.03e-66 224 47 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
P54930 1.05e-66 224 47 1 232 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
Q32CL9 1.29e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B5Z370 1.32e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.32e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P59402 1.53e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 1.53e-66 224 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q92HC2 1.63e-66 223 31 10 458 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P37013 2.28e-66 223 39 2 316 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 2.28e-66 223 39 2 316 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 2.28e-66 223 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q8ZMJ8 2.71e-66 223 39 3 315 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 2.71e-66 223 39 3 315 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
B7LW25 3.86e-66 223 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R7Z1 4.29e-66 223 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 4.29e-66 223 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 4.29e-66 223 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
P12626 4.46e-66 223 40 2 312 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q53206 5.34e-66 224 49 1 234 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B7LEC0 9.88e-66 222 39 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B7UHC1 1.07e-65 222 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N6T9 1.09e-65 222 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TEH1 1.1e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MZ04 1.13e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
B5RDG4 1.17e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B1LQ27 1.23e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q8FEN6 1.23e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z4C6 1.25e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.25e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.25e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.25e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B7NSI9 1.33e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A9MFX7 1.36e-65 221 44 0 245 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5PF20 1.59e-65 221 46 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P74839 1.71e-65 222 41 8 326 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5XVA2 1.84e-65 221 47 2 233 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
Q3YYF5 2.15e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
D5ARW9 2.17e-65 223 49 1 234 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
B7M9E6 2.22e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
P0CY94 2.38e-65 223 49 1 234 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
A8A3I6 2.6e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 2.8e-65 221 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 3.15e-65 220 38 2 316 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
A6TCX4 3.81e-65 221 39 4 317 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P54929 1.17e-64 222 46 1 253 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 1.7e-64 221 46 1 253 1 nifA Nif-specific regulatory protein Azospirillum brasilense
A4STH5 1.81e-63 216 37 2 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P38022 6.42e-63 213 40 4 313 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
P24426 1.17e-62 209 45 1 237 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P06519 2.38e-62 214 39 4 310 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q43965 2.94e-62 214 39 4 302 1 mopR Phenol regulator MopR Acinetobacter guillouiae
O87455 6.01e-62 213 44 1 239 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0KEJ0 2.57e-61 210 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P09828 3.9e-61 210 46 1 242 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q9ZIB7 1.11e-60 209 44 2 240 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
A8GG93 1.84e-60 208 45 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
P54529 6.34e-60 210 45 1 228 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P77743 1.8e-59 206 38 8 318 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q5E3W8 5.61e-59 204 36 2 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P37344 7.06e-59 199 36 5 322 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q9K4U8 2.77e-58 202 45 2 229 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7MFY9 5.52e-58 201 40 2 285 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q6D8R9 8.48e-58 201 44 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8D4F9 1.55e-57 200 37 4 324 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P03028 5.2e-57 199 45 1 243 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P28614 2.28e-55 197 37 5 312 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9K4V0 3.29e-53 189 44 4 239 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P07604 5.31e-53 188 42 3 240 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P0A2D7 1.11e-51 185 41 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.11e-51 185 41 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P26408 9.37e-51 182 29 8 475 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
O54426 9.51e-51 182 41 3 240 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P37931 2.16e-50 176 43 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P26316 1.04e-49 174 44 1 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P36219 4.2e-48 170 42 1 204 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P09432 5.05e-48 174 30 8 472 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P37930 5.11e-48 170 42 1 200 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P38035 1.06e-42 160 38 6 250 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P44694 9.44e-42 153 34 4 282 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P76016 3.35e-37 147 32 6 314 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P54156 1.1e-32 129 36 5 219 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P45512 2.1e-32 133 30 7 319 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P06184 1.07e-30 125 25 9 425 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55610 3.03e-22 103 31 3 228 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 5.56e-18 90 33 5 188 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 5e-15 81 32 6 207 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P51586 6.5e-15 74 42 1 105 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q9TLQ4 4.74e-14 75 37 1 105 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q1XDE4 5.98e-14 74 26 4 195 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P28257 1.18e-13 73 26 5 237 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P23221 1.97e-13 72 31 0 134 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O78428 7.1e-13 71 25 5 232 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q7A039 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 7.35e-13 71 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 1.08e-12 70 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
P06628 1.94e-12 67 30 0 118 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
A6QJK3 2.45e-12 69 38 1 101 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.45e-12 69 38 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P48259 2.68e-12 69 32 2 137 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P52942 3.03e-12 66 31 0 116 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
O69730 3.15e-12 69 32 0 101 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q56128 3.33e-12 72 38 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q04942 3.44e-12 69 36 1 102 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8KR08 4.06e-12 68 33 0 117 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P43501 6.61e-12 65 34 1 119 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1XDC9 8.24e-12 68 25 5 232 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P58662 9.98e-12 70 37 0 110 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34903 1.05e-11 67 30 0 126 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P0DMC5 1.16e-11 70 37 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q04803 1.17e-11 68 35 1 103 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3LWR6 1.18e-11 67 29 0 127 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.18e-11 67 29 0 127 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.18e-11 67 29 0 127 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P51358 1.21e-11 67 36 1 100 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q2YZ24 1.25e-11 67 37 1 101 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P72781 1.86e-11 67 35 2 119 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0R3I8 3.2e-11 66 31 1 141 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P28835 3.56e-11 66 34 1 100 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P0DMC6 4.93e-11 68 36 0 110 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P51343 6.12e-11 65 35 1 119 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q7D9K0 7.4e-11 65 32 0 108 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 7.4e-11 65 32 0 108 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0PWB4 7.41e-11 65 33 0 103 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1TEL7 7.44e-11 65 33 0 101 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1KHB7 9.37e-11 65 33 0 103 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 9.37e-11 65 33 0 103 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1B3X8 1.27e-10 64 34 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.27e-10 64 34 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.27e-10 64 34 0 100 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
L7N689 1.33e-10 65 33 0 101 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM9 1.4e-10 64 33 0 103 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.4e-10 64 33 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.4e-10 64 33 0 103 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7CQM8 1.55e-10 63 29 0 124 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A1J1 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.99e-10 63 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.99e-10 63 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.99e-10 63 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.99e-10 63 32 1 102 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.99e-10 63 32 1 102 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q9CD68 2.1e-10 63 32 0 101 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P48359 2.52e-10 63 29 1 117 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P13792 2.67e-10 63 33 0 103 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q742C1 3.15e-10 63 32 0 101 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 3.15e-10 63 32 0 101 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
B8GZM2 3.62e-10 65 32 1 115 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 3.62e-10 65 32 1 115 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q53228 3.75e-10 62 31 0 111 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6H805 5.53e-10 65 38 2 103 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
Q8DPL7 5.73e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 5.73e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 5.73e-10 62 32 1 101 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A2X1N2 5.83e-10 65 38 2 103 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q44929 6.48e-10 62 29 1 105 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
A1W0A5 8.14e-10 60 30 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 8.14e-10 60 30 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 8.14e-10 60 30 3 119 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P0C5S3 8.22e-10 61 32 0 111 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
Q5HLN2 1.12e-09 62 33 1 103 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42508 1.13e-09 60 28 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q8CN92 1.21e-09 61 33 1 103 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A6UEL7 1.35e-09 60 32 0 111 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q7A216 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 1.44e-09 61 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 1.44e-09 61 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 1.44e-09 61 32 1 101 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 1.44e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7A0U4 1.48e-09 61 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.48e-09 61 31 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.48e-09 61 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.48e-09 61 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.48e-09 61 31 1 103 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.48e-09 61 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.48e-09 61 31 1 103 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.48e-09 61 31 1 103 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CQK0 1.5e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.5e-09 61 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P10958 1.51e-09 61 31 0 111 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q2FWH6 1.84e-09 61 28 1 108 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CQ17 1.85e-09 61 31 1 102 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 1.85e-09 61 31 1 102 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4A160 1.88e-09 61 33 1 100 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49ZT8 2.01e-09 61 30 1 123 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L8L9 2.03e-09 61 33 1 101 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
P37478 2.07e-09 61 33 1 100 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q5N6V8 2.61e-09 62 36 2 103 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q9FXD6 3.03e-09 62 34 2 103 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P94504 3.83e-09 60 29 3 157 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q4LAJ9 4.87e-09 60 32 1 101 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
O49397 5.14e-09 62 36 2 103 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
P26487 6.85e-09 59 33 0 115 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P0DOA0 6.99e-09 62 40 4 107 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P62598 8.6e-09 61 37 2 103 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P9WGN1 1.19e-08 58 31 1 104 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.19e-08 58 31 1 104 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A7N6S2 1.26e-08 60 29 2 124 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q70FH0 1.35e-08 58 36 0 100 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P21710 1.41e-08 53 92 0 26 4 yfhA Uncharacterized protein in glnB 5'region (Fragment) Klebsiella oxytoca
P48027 1.51e-08 60 31 2 119 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P0C001 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.55e-08 58 29 1 106 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.55e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q99U73 1.65e-08 58 29 1 106 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P24072 1.83e-08 55 31 1 115 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q6K8X6 2.01e-08 60 36 2 103 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q5SML5 2.11e-08 60 35 2 103 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 2.13e-08 60 35 2 103 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
O31432 2.18e-08 58 33 2 106 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
B8AEH1 2.23e-08 60 36 2 103 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
P45337 2.23e-08 57 32 0 100 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KM66 2.45e-08 60 31 3 116 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O82868 2.91e-08 57 27 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
P50350 3.38e-08 57 34 1 98 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
A0QTK2 3.92e-08 57 32 1 100 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P50351 4.55e-08 57 33 1 101 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P37740 5.11e-08 56 32 1 102 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
Q55890 5.24e-08 57 26 2 140 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P35163 5.47e-08 57 30 1 108 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
A6WZ81 6.43e-08 56 24 3 192 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9F8D7 7.72e-08 58 31 1 119 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q07783 8.1e-08 56 33 1 101 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q9ZWJ9 8.63e-08 58 35 2 108 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
G3XCY6 9.32e-08 56 34 2 104 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A4P7TS68 1.06e-07 56 29 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.06e-07 56 29 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.06e-07 56 29 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.06e-07 56 29 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.06e-07 56 29 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.06e-07 56 29 0 103 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.06e-07 56 29 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.06e-07 56 29 0 103 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
Q8FZ93 1.33e-07 55 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 1.33e-07 55 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 1.33e-07 55 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 1.33e-07 55 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 1.33e-07 55 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 1.33e-07 55 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 1.33e-07 55 23 3 192 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 1.33e-07 55 23 3 192 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P30843 1.64e-07 55 30 0 110 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
O05251 1.85e-07 55 29 2 115 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
A7HD44 2.02e-07 55 34 0 100 1 Anae109_2439 Response regulator receiver protein Anae109_2439 Anaeromyxobacter sp. (strain Fw109-5)
P26275 2.08e-07 55 34 4 120 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9AE24 2.54e-07 55 31 0 106 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q9I4F9 2.73e-07 54 27 1 155 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q940D0 2.78e-07 56 34 2 108 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q6H468 2.83e-07 53 31 4 106 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 2.83e-07 53 31 4 106 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
P94413 2.87e-07 54 28 1 100 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q8D0P1 3.74e-07 52 33 2 109 3 cheY Chemotaxis protein CheY Yersinia pestis
Q9CCJ2 3.85e-07 54 31 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q2HWH1 3.96e-07 52 30 2 105 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 3.96e-07 52 30 2 105 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
Q06239 4.04e-07 54 28 1 103 3 vanR Regulatory protein VanR Enterococcus faecium
Q93CB8 4.08e-07 54 31 1 100 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q93P00 4.16e-07 52 33 2 109 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P9WGM7 4.29e-07 54 31 1 100 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 4.29e-07 54 31 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 4.29e-07 54 31 1 100 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4H5 4.35e-07 52 32 1 115 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 4.35e-07 52 32 1 115 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q31S42 4.46e-07 54 26 2 141 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P44895 4.75e-07 53 42 4 115 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KSB1 5.08e-07 55 31 2 105 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P38889 6.39e-07 55 29 0 115 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P21866 6.43e-07 53 30 1 101 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P36556 6.63e-07 53 26 3 167 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B8H358 6.74e-07 53 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 6.74e-07 53 27 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0AEV3 7.1e-07 54 32 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 7.1e-07 54 32 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 7.1e-07 54 32 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P0CL17 7.17e-07 53 33 0 106 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 7.17e-07 53 33 0 106 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
O87940 7.21e-07 53 30 1 128 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P9WGL9 9.27e-07 53 29 2 137 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 9.27e-07 53 29 2 137 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 9.27e-07 53 29 2 137 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4L6C6 1.06e-06 52 25 1 112 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q9ZHD3 1.41e-06 52 30 0 100 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q9FAD7 1.45e-06 50 32 2 109 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q2SFK0 1.49e-06 53 32 3 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q49XM7 1.51e-06 52 27 1 106 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KQD5 1.55e-06 50 29 2 118 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.55e-06 50 29 2 118 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q54YZ9 1.73e-06 54 30 3 130 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8L9Y3 1.84e-06 53 30 1 103 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P31079 1.88e-06 52 30 1 110 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8GP20 2e-06 52 29 1 137 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P0A2D5 2.05e-06 50 30 2 109 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 2.05e-06 50 30 2 109 3 cheY Chemotaxis protein CheY Salmonella typhi
P0AE69 2.19e-06 50 31 2 109 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 2.19e-06 50 31 2 109 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 2.19e-06 50 31 2 109 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q5A4X5 2.74e-06 53 31 0 108 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9F868 2.8e-06 52 31 1 101 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B0R4K1 2.97e-06 49 30 0 117 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q8FGP6 3.05e-06 49 31 2 109 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9LVG4 3.29e-06 53 30 2 114 1 APRR3 Two-component response regulator-like APRR3 Arabidopsis thaliana
A0A0H3GGB5 3.47e-06 51 41 2 102 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P54443 3.54e-06 51 29 2 107 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
P32040 3.59e-06 51 28 1 109 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P15940 3.73e-06 51 28 0 116 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9ZM64 3.93e-06 49 28 3 104 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q8X738 3.96e-06 51 29 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q0PVB3 4.09e-06 51 29 4 105 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
P42244 4.48e-06 51 24 2 158 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P0AEC5 4.72e-06 52 28 1 116 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 4.72e-06 52 28 1 116 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 4.72e-06 52 28 1 116 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q8Z7H2 5.14e-06 50 30 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DM78 5.19e-06 50 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 5.19e-06 50 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 5.19e-06 50 30 0 100 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 5.19e-06 50 30 0 100 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 5.19e-06 50 30 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P96602 5.44e-06 50 27 2 119 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q47456 5.65e-06 50 26 0 102 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P0ACZ8 5.81e-06 50 28 0 100 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 5.81e-06 50 28 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 5.81e-06 50 28 0 100 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q93WK5 5.85e-06 52 28 2 114 1 APRR7 Two-component response regulator-like APRR7 Arabidopsis thaliana
Q6K9T0 6e-06 48 29 2 105 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 6e-06 48 29 2 105 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q9K621 6.27e-06 50 26 1 110 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P71403 6.75e-06 48 28 3 104 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q23917 6.92e-06 52 32 4 121 1 regA 3',5'-cyclic-nucleotide phosphodiesterase regA Dictyostelium discoideum
P59342 6.97e-06 52 30 2 116 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P9WGM1 7.08e-06 50 35 2 96 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 7.08e-06 50 35 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 7.08e-06 50 35 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P24086 7.09e-06 48 28 4 121 4 LA_2151 Uncharacterized protein LA_2151 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH6 7.09e-06 48 28 4 121 3 LIC_11769 Uncharacterized protein LIC_11769 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P23836 7.17e-06 50 29 0 100 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q50136 7.28e-06 50 35 2 96 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q83RR0 7.58e-06 50 29 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 7.58e-06 50 29 0 100 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2KCH7 7.7e-06 48 29 2 122 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9LYP5 8.09e-06 52 26 2 118 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q44006 8.25e-06 50 29 1 123 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6GK93 9.48e-06 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
Q8NYJ9 9.66e-06 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 9.66e-06 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 9.66e-06 50 34 1 82 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2YV56 9.66e-06 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G1E1 9.66e-06 50 34 1 82 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 9.66e-06 50 34 1 82 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
P52934 1.17e-05 50 29 2 127 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q7Y0W5 1.36e-05 50 29 2 103 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
Q7Y0W3 1.42e-05 50 29 2 103 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
Q02540 1.43e-05 49 29 0 101 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q8DN02 1.44e-05 49 33 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 1.44e-05 49 33 3 106 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q869S5 1.57e-05 51 28 2 115 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P0AE90 1.62e-05 49 41 2 102 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 1.62e-05 49 41 2 102 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 1.62e-05 49 41 2 102 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
Q9ZWS7 1.74e-05 49 29 2 115 1 ARR7 Two-component response regulator ARR7 Arabidopsis thaliana
O32192 1.88e-05 49 29 1 103 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P0C0F6 2.04e-05 50 30 6 152 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0DMK7 2.04e-05 49 28 1 103 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 2.04e-05 49 28 1 103 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q57QC3 2.08e-05 49 29 0 100 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q7XQA6 2.14e-05 48 28 4 113 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
A2XYV5 2.14e-05 48 28 4 113 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
Q56312 2.29e-05 47 27 1 112 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q86AT9 2.38e-05 50 28 3 120 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P0C0F7 2.47e-05 50 30 6 152 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P58253 2.88e-05 49 30 3 118 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P0A4I0 3.65e-05 48 26 0 110 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 3.65e-05 48 26 0 110 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P44918 3.68e-05 48 27 2 121 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HV32 3.89e-05 48 35 3 94 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I1 4.04e-05 48 32 0 100 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25918 4.17e-05 48 30 1 107 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q01473 4.18e-05 49 26 0 102 3 rcaC Protein RcaC Microchaete diplosiphon
Q9P896 5.1e-05 49 28 2 114 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8ZPP5 5.2e-05 49 31 1 117 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8H7S7 5.26e-05 49 30 2 108 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 5.49e-05 49 30 2 108 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q67W50 5.8e-05 49 33 2 103 3 RR25 Two-component response regulator ORR25 Oryza sativa subsp. japonica
Q2HWG0 5.81e-05 45 33 4 108 2 RR13 Two-component response regulator ORR13 Oryza sativa subsp. japonica
Q8GVV6 5.87e-05 45 32 4 108 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 5.87e-05 45 32 4 108 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
Q54YH4 6.07e-05 49 27 1 121 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P52931 6.31e-05 47 27 2 134 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
O06978 6.55e-05 47 31 1 100 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P24908 6.77e-05 47 27 1 102 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P76340 6.84e-05 47 28 1 100 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P52076 7.37e-05 47 31 0 100 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8XBS3 8.38e-05 47 31 0 100 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q10WZ6 9.21e-05 48 31 3 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q9WY30 9.85e-05 48 27 1 114 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P96126 0.000102 45 31 3 122 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
A1A698 0.000106 48 27 4 139 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q51455 0.000119 45 28 2 114 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34951 0.000144 46 24 1 110 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q4UU85 0.000151 47 33 1 71 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P08368 0.000156 46 27 0 101 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q9HUI2 0.00016 46 27 2 107 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42421 0.000162 46 26 1 104 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P52940 0.000171 47 31 3 114 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
P13359 0.000193 46 28 2 102 3 virG Regulatory protein VirG Rhizobium rhizogenes
Q7A7X9 0.000201 46 32 1 82 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07255
Feature type CDS
Gene glrR
Product two-component system response regulator GlrR
Location 1509727 - 1511067 (strand: -1)
Length 1341 (nucleotides) / 446 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_611
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00158 Sigma-54 interaction domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2204 Signal transduction mechanisms (T) T DNA-binding transcriptional response regulator, NtrC family, contains REC, AAA-type ATPase, and a Fis-type DNA-binding domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07715 two-component system, NtrC family, response regulator GlrR Two-component system
Quorum sensing
-

Protein Sequence

MTARRSANLLLVDDDPGLLKLLGMRLSSEGFRVTTAESGPEALKVLGKEKIDLVVSDLRMDEMDGMALFAEIQKTHQGMPVIILTAHGSIPDAVAATQQGVFSFLTKPVDRDALYKAIDDALALSTTTVSDESWSDGIVTRSPLMIRLLEQAKMVAQSDVSVLINGQSGTGKEVLAQAIHKASPRAKKPFIAINCGALPEQLLESELFGHAKGAFTGAVSSREGLFQAAGSGTLFLDEIGDMPIALQVKLLRVLQERKVRPLGSNRDIDIDVRIISATHRDLPKAMEKHEFREDLYYRLNVVNLKIPTLHERAEDIPLLANHILREAAKKHKPFVRSFSTDAMKCLMGASWPGNVRQLLNVIEQCVALSTVPVISEALVTQALEGENTALPTFVEARNQFELNYLRKLLQMTKGNVTNAARLAGRNRTEFYKLLSRHELDAADFKE

Flanking regions ( +/- flanking 50bp)

AAAACCGGCAGAAAGCAAACCGGCACAGAATAAAAAGGAGTAACTCAGGCATGACAGCACGCCGCAGCGCAAATTTATTATTAGTTGATGACGATCCCGGATTATTAAAATTACTGGGAATGCGCCTGAGCAGTGAGGGCTTTCGGGTCACAACAGCAGAAAGCGGCCCTGAAGCACTGAAAGTACTCGGAAAAGAAAAAATTGATTTAGTCGTCAGTGATTTACGGATGGATGAAATGGACGGTATGGCACTGTTTGCCGAGATCCAGAAAACCCATCAGGGAATGCCGGTGATTATCCTGACCGCTCACGGCTCTATTCCGGATGCGGTTGCCGCCACGCAGCAGGGAGTATTCAGCTTCCTGACCAAACCTGTCGATCGCGATGCATTATATAAAGCTATTGATGATGCCCTGGCTCTCTCGACCACAACTGTGAGTGATGAGTCCTGGAGTGACGGCATTGTCACCCGCAGCCCGCTGATGATCCGCCTGCTGGAGCAGGCAAAAATGGTCGCTCAATCTGATGTCAGCGTGCTTATCAACGGACAAAGTGGTACCGGGAAAGAGGTTCTGGCGCAGGCAATTCATAAAGCCAGCCCGCGCGCTAAAAAGCCGTTTATTGCAATTAACTGTGGTGCTCTGCCGGAACAACTGCTGGAATCCGAGCTGTTCGGTCACGCCAAAGGCGCATTTACCGGGGCTGTCAGCAGCCGTGAAGGATTGTTCCAGGCAGCGGGAAGCGGGACACTTTTTCTTGATGAAATCGGCGATATGCCAATAGCTTTGCAGGTCAAACTTCTGCGGGTATTGCAGGAGCGGAAAGTCCGCCCGCTGGGCAGTAACCGCGATATTGATATTGATGTCCGCATTATTTCCGCAACCCACCGCGATTTACCCAAAGCGATGGAAAAACACGAATTCCGCGAAGATCTCTATTATCGCCTCAATGTCGTTAATCTGAAAATTCCGACCCTGCATGAGCGCGCGGAAGATATTCCGTTACTGGCAAACCATATTCTGCGTGAAGCGGCAAAAAAACATAAACCCTTTGTCCGCAGTTTTTCCACTGATGCCATGAAGTGTCTGATGGGTGCAAGCTGGCCGGGAAATGTCCGCCAGTTACTCAACGTTATTGAACAGTGCGTGGCACTTTCTACGGTACCGGTGATCAGTGAAGCACTGGTGACTCAGGCGCTGGAAGGGGAAAATACAGCGCTGCCGACCTTTGTGGAAGCAAGAAACCAGTTTGAACTCAATTACTTACGTAAATTATTGCAGATGACCAAAGGCAATGTGACCAATGCTGCCCGTTTAGCGGGGCGCAACCGGACGGAATTTTACAAACTCCTCTCCCGTCATGAGCTGGATGCGGCTGACTTTAAAGAATAAATAAAGAATACGCTGTCGCAGGCACATTTTGCTATCATCTTCATTATTAG