Homologs in group_1927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14340 FBDBKF_14340 83.7 Morganella morganii S1 aroC chorismate synthase
EHELCC_07940 EHELCC_07940 83.7 Morganella morganii S2 aroC chorismate synthase
NLDBIP_08265 NLDBIP_08265 83.7 Morganella morganii S4 aroC chorismate synthase
LHKJJB_06000 LHKJJB_06000 83.7 Morganella morganii S3 aroC chorismate synthase
HKOGLL_04915 HKOGLL_04915 83.7 Morganella morganii S5 aroC chorismate synthase
F4V73_RS02565 F4V73_RS02565 84.8 Morganella psychrotolerans aroC chorismate synthase

Distribution of the homologs in the orthogroup group_1927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZG9 0.0 741 100 0 361 3 aroC Chorismate synthase Proteus mirabilis (strain HI4320)
Q7N299 0.0 620 81 0 361 3 aroC Chorismate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JK48 0.0 615 82 0 361 3 aroC Chorismate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YZN2 0.0 613 84 0 361 3 aroC Chorismate synthase Shigella sonnei (strain Ss046)
Q83QQ5 0.0 613 83 0 361 3 aroC Chorismate synthase Shigella flexneri
Q0T2F6 0.0 613 83 0 361 3 aroC Chorismate synthase Shigella flexneri serotype 5b (strain 8401)
A8GH82 0.0 613 83 0 361 3 aroC Chorismate synthase Serratia proteamaculans (strain 568)
B6I4X6 0.0 613 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain SE11)
B7LBI3 0.0 613 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain 55989 / EAEC)
B7UFY7 0.0 613 84 0 361 3 aroC Chorismate synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C6DA85 0.0 613 83 0 361 3 aroC Chorismate synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1R983 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain UTI89 / UPEC)
A1ADH8 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O1:K1 / APEC
B7MG93 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q32DK8 0.0 612 84 0 361 3 aroC Chorismate synthase Shigella dysenteriae serotype 1 (strain Sd197)
B1LLT5 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain SMS-3-5 / SECEC)
B7N5U1 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IXB6 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P63609 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFB7 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7M6L0 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O8 (strain IAI1)
B7MY06 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O81 (strain ED1a)
B7NP10 0.0 612 83 0 361 3 aroC Chorismate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXX0 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P63610 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O157:H7
A7ZPE5 0.0 612 84 0 361 3 aroC Chorismate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
P12008 0.0 610 83 0 361 1 aroC Chorismate synthase Escherichia coli (strain K12)
A8A2J9 0.0 610 83 0 361 3 aroC Chorismate synthase Escherichia coli O9:H4 (strain HS)
B1X9K2 0.0 610 83 0 361 3 aroC Chorismate synthase Escherichia coli (strain K12 / DH10B)
C4ZVM2 0.0 610 83 0 361 3 aroC Chorismate synthase Escherichia coli (strain K12 / MC4100 / BW2952)
Q31YC9 0.0 610 83 0 361 3 aroC Chorismate synthase Shigella boydii serotype 4 (strain Sb227)
B2TWB1 0.0 610 83 0 361 3 aroC Chorismate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1JGG7 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TM78 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pestis (strain Pestoides F)
Q1CHK6 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7W3 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD41 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pestis
Q1C664 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK6 0.0 608 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D2M6 0.0 608 83 0 361 3 aroC Chorismate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7LLE1 0.0 607 83 0 361 3 aroC Chorismate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q668V5 0.0 606 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K8I9 0.0 606 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A8ADP9 0.0 603 83 0 361 3 aroC Chorismate synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5BBA5 0.0 602 82 0 361 3 aroC Chorismate synthase Salmonella paratyphi A (strain AKU_12601)
Q5PCX2 0.0 602 82 0 361 3 aroC Chorismate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TQB9 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella schwarzengrund (strain CVM19633)
B5RCK9 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3R5 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella enteritidis PT4 (strain P125109)
B5FPM7 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella dublin (strain CT_02021853)
B5EZR6 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella agona (strain SL483)
P58729 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N460 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZQ7 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella newport (strain SL254)
B4TCA5 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella heidelberg (strain SL476)
Q57LX0 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella choleraesuis (strain SC-B67)
A9MJ42 0.0 601 82 0 361 3 aroC Chorismate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P16280 0.0 596 81 0 361 3 aroC Chorismate synthase Salmonella typhi
B5XVW6 0.0 594 81 0 361 3 aroC Chorismate synthase Klebsiella pneumoniae (strain 342)
A4WCW2 0.0 593 81 0 361 3 aroC Chorismate synthase Enterobacter sp. (strain 638)
A6TC15 0.0 593 81 0 361 3 aroC Chorismate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MH70 0.0 588 81 0 361 3 aroC Chorismate synthase Cronobacter sakazakii (strain ATCC BAA-894)
Q07ZQ7 0.0 573 77 0 354 3 aroC Chorismate synthase Shewanella frigidimarina (strain NCIMB 400)
B8EEA7 0.0 573 77 0 354 3 aroC Chorismate synthase Shewanella baltica (strain OS223)
Q7MIT1 0.0 572 76 0 350 3 aroC Chorismate synthase Vibrio vulnificus (strain YJ016)
A1RIA0 0.0 572 77 0 354 3 aroC Chorismate synthase Shewanella sp. (strain W3-18-1)
A9KTV7 0.0 572 77 0 354 3 aroC Chorismate synthase Shewanella baltica (strain OS195)
A6WQ14 0.0 572 77 0 354 3 aroC Chorismate synthase Shewanella baltica (strain OS185)
A3D676 0.0 572 77 0 354 3 aroC Chorismate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8DB42 0.0 571 76 0 350 3 aroC Chorismate synthase Vibrio vulnificus (strain CMCP6)
A7MS71 0.0 570 76 0 350 3 aroC Chorismate synthase Vibrio campbellii (strain ATCC BAA-1116)
A4Y889 0.0 570 77 0 354 3 aroC Chorismate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q87MM9 0.0 568 76 0 350 3 aroC Chorismate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1S7K8 0.0 567 77 0 350 3 aroC Chorismate synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2SJE4 0.0 567 76 0 354 3 aroC Chorismate synthase Hahella chejuensis (strain KCTC 2396)
Q5E3U6 0.0 566 79 0 350 3 aroC Chorismate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q12P04 0.0 565 76 0 355 3 aroC Chorismate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B5FGA8 0.0 563 79 0 350 3 aroC Chorismate synthase Aliivibrio fischeri (strain MJ11)
Q3IJ50 0.0 563 77 0 350 3 aroC Chorismate synthase Pseudoalteromonas translucida (strain TAC 125)
B4RU03 0.0 561 75 0 355 3 aroC Chorismate synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B2VIY1 0.0 561 79 0 354 3 aroC Chorismate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P39198 0.0 559 76 0 350 3 aroC Chorismate synthase Vibrio anguillarum (strain ATCC 68554 / 775)
B1KKS1 0.0 556 77 0 354 3 aroC Chorismate synthase Shewanella woodyi (strain ATCC 51908 / MS32)
A0KV84 0.0 555 77 0 354 3 aroC Chorismate synthase Shewanella sp. (strain ANA-3)
Q0HWM5 0.0 555 77 0 354 3 aroC Chorismate synthase Shewanella sp. (strain MR-7)
Q0HKC3 0.0 555 77 0 354 3 aroC Chorismate synthase Shewanella sp. (strain MR-4)
Q65U87 0.0 554 74 1 357 3 aroC Chorismate synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VMY7 0.0 553 74 1 359 3 aroC Chorismate synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1STP2 0.0 551 75 0 350 3 aroC Chorismate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C5BAF2 0.0 550 75 0 361 3 aroC Chorismate synthase Edwardsiella ictaluri (strain 93-146)
C3LP65 0.0 550 76 0 355 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ85 0.0 550 76 0 355 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6F4 0.0 550 76 0 355 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6LNN4 0.0 549 74 0 355 3 aroC Chorismate synthase Photobacterium profundum (strain SS9)
Q15VM5 0.0 547 71 1 361 3 aroC Chorismate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3QFN4 0.0 547 75 1 361 3 aroC Chorismate synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FTS6 0.0 546 76 0 354 3 aroC Chorismate synthase Shewanella sediminis (strain HAW-EB3)
A4SM83 0.0 546 76 0 355 3 aroC Chorismate synthase Aeromonas salmonicida (strain A449)
B8F415 0.0 544 75 1 359 3 aroC Chorismate synthase Glaesserella parasuis serovar 5 (strain SH0165)
A1U0Y3 0.0 543 73 0 354 3 aroC Chorismate synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0KKS7 0.0 543 76 0 355 3 aroC Chorismate synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3J713 0.0 542 72 0 358 3 aroC Chorismate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B0UWQ4 0.0 542 76 1 359 3 aroC Chorismate synthase Histophilus somni (strain 2336)
Q0I3U1 0.0 542 76 1 359 3 aroC Chorismate synthase Histophilus somni (strain 129Pt)
Q1QUP5 0.0 542 72 1 354 3 aroC Chorismate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q21IX8 0.0 540 73 0 354 3 aroC Chorismate synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2NSH3 0.0 539 79 0 355 3 aroC Chorismate synthase Sodalis glossinidius (strain morsitans)
Q4QNZ4 0.0 538 76 2 356 3 aroC Chorismate synthase Haemophilus influenzae (strain 86-028NP)
B0BP27 0.0 538 74 1 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXI4 0.0 538 74 1 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q31FE3 0.0 536 68 0 359 3 aroC Chorismate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A5UFZ9 0.0 536 75 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain PittGG)
C5BL71 0.0 535 71 0 354 3 aroC Chorismate synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A6VXI7 0.0 535 71 0 355 3 aroC Chorismate synthase Marinomonas sp. (strain MWYL1)
Q47ZC3 0.0 535 70 1 364 3 aroC Chorismate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7VRU6 0.0 534 70 0 353 3 aroC Chorismate synthase Blochmanniella floridana
A3N0B0 0.0 534 74 1 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P57840 0.0 533 75 1 355 3 aroC Chorismate synthase Pasteurella multocida (strain Pm70)
P43875 0.0 533 75 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZHE9 0.0 533 70 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B8D703 0.0 532 69 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57198 0.0 532 69 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8P9 0.0 532 69 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A5UAV8 0.0 532 75 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain PittEE)
Q0A9B2 0.0 532 71 0 356 3 aroC Chorismate synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7VLX2 0.0 531 72 1 360 3 aroC Chorismate synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3PHF4 0.0 530 74 0 354 3 aroC Chorismate synthase Cellvibrio japonicus (strain Ueda107)
C4L8D2 0.0 528 74 0 355 3 aroC Chorismate synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q492G9 0.0 527 72 0 351 3 aroC Chorismate synthase Blochmanniella pennsylvanica (strain BPEN)
Q60AY5 0.0 526 70 0 355 3 aroC Chorismate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0VPH7 0.0 526 69 0 358 3 aroC Chorismate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C4K3S0 0.0 521 71 0 352 3 aroC Chorismate synthase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q1LTA9 0.0 515 72 0 354 3 aroC Chorismate synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q5QW40 0.0 511 70 1 350 3 aroC Chorismate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1AW83 0.0 508 66 1 361 3 aroC Chorismate synthase Ruthia magnifica subsp. Calyptogena magnifica
Q89AX9 1.19e-180 507 69 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9I344 1.01e-177 500 72 1 354 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KH1 1.01e-177 500 72 1 354 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UV40 1.01e-177 500 72 1 354 1 aroC Chorismate synthase Pseudomonas aeruginosa (strain LESB58)
Q5P1K1 1.13e-177 501 66 0 354 3 aroC Chorismate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q4ZVC2 6.11e-177 498 71 1 354 3 aroC Chorismate synthase Pseudomonas syringae pv. syringae (strain B728a)
A6V7B0 7.27e-177 498 72 1 354 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain PA7)
Q4FRQ5 9.06e-177 498 68 1 363 3 aroC Chorismate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q884P5 1.84e-176 497 71 1 354 3 aroC Chorismate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C1DBU8 2.82e-176 497 66 0 354 3 aroC Chorismate synthase Laribacter hongkongensis (strain HLHK9)
Q47HR7 6.41e-176 496 64 0 355 3 aroC Chorismate synthase Dechloromonas aromatica (strain RCB)
A4VM84 8.26e-176 495 71 1 354 3 aroC Chorismate synthase Stutzerimonas stutzeri (strain A1501)
B4E7H2 1.11e-175 495 66 0 357 3 aroC Chorismate synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q4K8J3 1.74e-175 494 71 1 354 3 aroC Chorismate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1J4S1 2.55e-175 494 70 1 354 3 aroC Chorismate synthase Pseudomonas putida (strain W619)
Q48KN0 3e-175 494 71 1 354 3 aroC Chorismate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0AEP5 8.21e-175 494 65 0 355 3 aroC Chorismate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1V3K9 2.22e-174 492 66 0 354 3 aroC Chorismate synthase Burkholderia mallei (strain SAVP1)
Q62KU7 2.22e-174 492 66 0 354 3 aroC Chorismate synthase Burkholderia mallei (strain ATCC 23344)
A3MJ92 2.22e-174 492 66 0 354 3 aroC Chorismate synthase Burkholderia mallei (strain NCTC 10247)
Q1ID65 2.38e-174 492 70 1 354 3 aroC Chorismate synthase Pseudomonas entomophila (strain L48)
A5WDY8 5.96e-174 491 68 1 363 3 aroC Chorismate synthase Psychrobacter sp. (strain PRwf-1)
Q1BWW8 6.49e-174 491 65 0 354 3 aroC Chorismate synthase Burkholderia orbicola (strain AU 1054)
A0K6T5 6.49e-174 491 65 0 354 3 aroC Chorismate synthase Burkholderia cenocepacia (strain HI2424)
Q63TK6 9.7e-174 490 66 0 354 3 aroC Chorismate synthase Burkholderia pseudomallei (strain K96243)
A3N8Q9 9.7e-174 490 66 0 354 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 668)
Q3JT35 9.7e-174 490 66 0 354 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 1710b)
A3NUG3 9.7e-174 490 66 0 354 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 1106a)
B1K077 1.51e-173 490 65 0 354 3 aroC Chorismate synthase Burkholderia orbicola (strain MC0-3)
Q1QA91 1.53e-173 490 66 1 363 3 aroC Chorismate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B0KUL0 1.84e-173 489 70 1 354 3 aroC Chorismate synthase Pseudomonas putida (strain GB-1)
A2S381 1.87e-173 489 66 0 354 3 aroC Chorismate synthase Burkholderia mallei (strain NCTC 10229)
Q88LU7 2.21e-173 489 70 1 354 3 aroC Chorismate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W794 2.21e-173 489 70 1 354 3 aroC Chorismate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1YNZ5 2.6e-173 489 66 0 354 3 aroC Chorismate synthase Burkholderia ambifaria (strain MC40-6)
Q0BG24 2.63e-173 489 65 0 354 3 aroC Chorismate synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1WY16 3.36e-173 489 66 0 354 3 aroC Chorismate synthase Halorhodospira halophila (strain DSM 244 / SL1)
Q3KFJ1 3.47e-173 489 70 1 354 3 aroC Chorismate synthase Pseudomonas fluorescens (strain Pf0-1)
Q2SVC0 3.69e-173 489 65 0 354 3 aroC Chorismate synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q39H65 3.86e-173 489 65 0 357 3 aroC Chorismate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9ABG9 8.87e-173 488 65 0 354 3 aroC Chorismate synthase Burkholderia multivorans (strain ATCC 17616 / 249)
A4XTH9 1.13e-172 488 70 1 354 3 aroC Chorismate synthase Pseudomonas mendocina (strain ymp)
Q13WE6 1.69e-172 487 65 0 354 3 aroC Chorismate synthase Paraburkholderia xenovorans (strain LB400)
Q7NYT5 1.77e-172 487 65 0 354 3 aroC Chorismate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C3K084 2.28e-172 487 70 1 354 3 aroC Chorismate synthase Pseudomonas fluorescens (strain SBW25)
B2JK28 4.73e-172 486 64 0 355 3 aroC Chorismate synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B0VPN2 9.98e-172 485 67 0 359 3 aroC Chorismate synthase Acinetobacter baumannii (strain SDF)
Q2KYK7 1.16e-171 484 65 0 352 3 aroC Chorismate synthase Bordetella avium (strain 197N)
A4JDS6 1.78e-171 484 65 0 354 3 aroC Chorismate synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2SZH3 2.21e-171 484 64 0 354 3 aroC Chorismate synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q7VY92 4.2e-171 483 64 0 352 3 aroC Chorismate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WKJ5 6.51e-171 483 64 0 352 3 aroC Chorismate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B2I0B7 7.47e-171 483 67 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain ACICU)
B0VDX7 1.12e-170 482 67 0 358 1 aroC Chorismate synthase Acinetobacter baumannii (strain AYE)
A3M5C7 1.12e-170 482 67 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I5W6 1.12e-170 482 67 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain AB0057)
B7H3A6 1.12e-170 482 67 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain AB307-0294)
Q83D67 5.66e-170 480 65 0 352 3 aroC Chorismate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q7W950 8.7e-170 480 63 0 352 3 aroC Chorismate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q82TK9 1.14e-169 481 66 0 355 3 aroC Chorismate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6FAR2 1.78e-169 479 67 0 358 3 aroC Chorismate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A5CX05 1.96e-169 479 66 0 350 3 aroC Chorismate synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3BRK5 1.99e-169 479 66 0 354 3 aroC Chorismate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B5EJT1 4.47e-169 478 62 0 358 3 aroC Chorismate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JC67 4.47e-169 478 62 0 358 3 aroC Chorismate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q8PJ20 1.14e-168 478 65 0 354 3 aroC Chorismate synthase Xanthomonas axonopodis pv. citri (strain 306)
Q3SL02 1.32e-168 477 63 0 354 3 aroC Chorismate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q5GXQ6 1.47e-168 477 65 0 354 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SVP7 1.47e-168 477 65 0 354 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0T3 1.47e-168 477 65 0 354 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q058B0 6.07e-168 475 63 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
B0RR76 3.59e-167 474 64 1 361 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain B100)
Q8P7R0 4.09e-167 473 63 1 361 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWE0 4.09e-167 473 63 1 361 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain 8004)
B2FP01 1.18e-166 472 63 0 354 3 aroC Chorismate synthase Stenotrophomonas maltophilia (strain K279a)
B4SQW1 1.25e-166 472 63 0 354 3 aroC Chorismate synthase Stenotrophomonas maltophilia (strain R551-3)
A1K498 4.99e-166 471 64 0 354 3 aroC Chorismate synthase Azoarcus sp. (strain BH72)
A9IT47 1.21e-165 469 62 0 352 3 aroC Chorismate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q5WUE6 3.02e-165 468 64 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Lens)
Q5ZT62 4.06e-165 468 64 0 351 3 aroC Chorismate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IEA1 4.06e-165 468 64 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Corby)
B2UGK8 8.78e-165 468 62 0 354 3 aroC Chorismate synthase Ralstonia pickettii (strain 12J)
Q5X2Y6 1.56e-164 466 64 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Paris)
Q0KC14 2.95e-164 466 64 0 354 3 aroC Chorismate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2SF54 3.54e-164 466 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IYS7 1.97e-163 464 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGG6 1.97e-163 464 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q4Z0 1.97e-163 464 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. novicida (strain U112)
Q14HW8 1.97e-163 464 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q07HS5 1.08e-162 462 62 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisA53)
Q0BNG4 4.04e-162 460 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A549 4.04e-162 460 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NA74 4.04e-162 460 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q2Y7L8 4.61e-162 462 63 0 354 3 aroC Chorismate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q1GZD3 5.68e-162 460 64 0 354 3 aroC Chorismate synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1LPA2 8.68e-162 460 63 0 354 3 aroC Chorismate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A6T017 1.47e-161 459 62 1 361 3 aroC Chorismate synthase Janthinobacterium sp. (strain Marseille)
Q89RY1 1.52e-161 459 63 4 364 3 aroC Chorismate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3SUZ5 1.65e-161 459 62 4 369 3 aroC Chorismate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q472Q5 1.66e-161 459 63 0 354 3 aroC Chorismate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2W6Y1 2.09e-161 459 62 3 358 3 aroC Chorismate synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2J0T8 6.51e-161 457 62 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain HaA2)
A4G4F3 8.29e-161 457 62 0 354 3 aroC Chorismate synthase Herminiimonas arsenicoxydans
B1XWC5 1.5e-160 457 61 1 361 3 aroC Chorismate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A5EEP1 1.84e-160 456 62 4 364 3 aroC Chorismate synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A4YQ28 2.76e-160 456 62 4 364 3 aroC Chorismate synthase Bradyrhizobium sp. (strain ORS 278)
Q13BI7 6.33e-160 455 61 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisB5)
A1VQW9 4.47e-159 453 61 1 354 3 aroC Chorismate synthase Polaromonas naphthalenivorans (strain CJ2)
Q1QQ46 4.48e-159 453 62 4 367 3 aroC Chorismate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A1KV89 6.02e-159 453 63 0 354 3 aroC Chorismate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M1Q2 6.02e-159 453 63 0 354 3 aroC Chorismate synthase Neisseria meningitidis serogroup C (strain 053442)
Q9JT81 7.17e-159 452 63 0 354 3 aroC Chorismate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RN46 9.96e-159 452 62 0 354 3 aroC Chorismate synthase Neisseria gonorrhoeae (strain NCCP11945)
Q5F756 1.24e-158 452 62 0 354 3 aroC Chorismate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6NAI4 1.31e-158 452 62 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9JY99 2.78e-158 451 62 0 354 3 aroC Chorismate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8XZ40 2.94e-158 451 62 0 354 3 aroC Chorismate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B3QIL0 3.36e-158 451 62 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain TIE-1)
A1TRH4 3.46e-158 451 60 2 357 3 aroC Chorismate synthase Paracidovorax citrulli (strain AAC00-1)
A9H0U2 1.08e-157 449 61 3 358 3 aroC Chorismate synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q21A81 1.41e-157 449 61 4 364 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisB18)
A2SFP8 1.64e-157 449 60 0 358 3 aroC Chorismate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B0U6K0 3.89e-157 448 63 0 354 3 aroC Chorismate synthase Xylella fastidiosa (strain M12)
Q9PDL0 9.74e-157 447 64 0 354 3 aroC Chorismate synthase Xylella fastidiosa (strain 9a5c)
Q87DS4 2.12e-156 446 62 0 354 3 aroC Chorismate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9I6 2.12e-156 446 62 0 354 3 aroC Chorismate synthase Xylella fastidiosa (strain M23)
B9MAD0 4.39e-156 446 59 1 355 3 aroC Chorismate synthase Acidovorax ebreus (strain TPSY)
A1W6H4 5.23e-156 445 59 1 355 3 aroC Chorismate synthase Acidovorax sp. (strain JS42)
B1M325 9.65e-156 444 62 4 364 3 aroC Chorismate synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q5FPG9 1.47e-155 444 61 3 357 3 aroC Chorismate synthase Gluconobacter oxydans (strain 621H)
Q21TN3 2.23e-155 444 60 1 354 3 aroC Chorismate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A7IMW7 1.75e-153 439 60 5 367 3 aroC Chorismate synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1XUP3 5.35e-153 438 61 0 354 3 aroC Chorismate synthase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q16CN2 5.71e-153 437 60 4 359 3 aroC Chorismate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A0LDR1 9.04e-153 437 62 2 356 3 aroC Chorismate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B8ESC6 2.01e-152 436 59 5 365 3 aroC Chorismate synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A1WL18 2.26e-152 436 58 1 355 3 aroC Chorismate synthase Verminephrobacter eiseniae (strain EF01-2)
Q2RR25 3.47e-152 436 63 3 361 3 aroC Chorismate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0BVN0 6e-152 435 62 3 362 3 aroC Chorismate synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q5LX60 8.13e-152 435 60 3 359 3 aroC Chorismate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A4SXH9 5.38e-151 433 60 1 361 3 aroC Chorismate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B6IRC6 9.43e-151 432 60 3 360 3 aroC Chorismate synthase Rhodospirillum centenum (strain ATCC 51521 / SW)
B6JFJ0 9.89e-151 432 61 4 362 3 aroC Chorismate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B2IDQ8 1.46e-150 432 58 4 366 3 aroC Chorismate synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B1ZHL0 9.05e-149 427 62 4 369 3 aroC Chorismate synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B0UJB1 1.51e-148 427 60 4 366 3 aroC Chorismate synthase Methylobacterium sp. (strain 4-46)
C3MHI8 1.92e-148 426 58 4 365 3 aroC Chorismate synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A5FY49 3.23e-148 426 62 4 360 3 aroC Chorismate synthase Acidiphilium cryptum (strain JF-5)
Q12CG7 1.88e-147 424 60 1 354 3 aroC Chorismate synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q11KE5 2.12e-147 423 58 5 365 3 aroC Chorismate synthase Chelativorans sp. (strain BNC1)
B7KT24 3.26e-147 423 61 4 367 3 aroC Chorismate synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A8I4M5 1.83e-146 421 60 4 364 3 aroC Chorismate synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A6WWB6 1.17e-145 419 59 4 367 3 aroC Chorismate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A9W6U7 1.59e-145 419 61 4 367 3 aroC Chorismate synthase Methylorubrum extorquens (strain PA1)
C5CS25 4.05e-145 418 59 2 356 3 aroC Chorismate synthase Variovorax paradoxus (strain S110)
A4WWC0 1.02e-144 417 57 3 365 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
C0RHD5 1.22e-144 416 58 4 367 3 aroC Chorismate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
B8IS51 3.73e-144 416 62 4 370 3 aroC Chorismate synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
P63608 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella suis biovar 1 (strain 1330)
B0CKB2 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VP02 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P63607 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M8V2 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57ET8 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YMF8 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella abortus (strain 2308)
B2S9R7 7.74e-144 414 58 4 367 3 aroC Chorismate synthase Brucella abortus (strain S19)
Q1MKK1 8.37e-144 414 58 5 365 3 aroC Chorismate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q4FN06 7.53e-143 412 57 3 359 3 aroC Chorismate synthase Pelagibacter ubique (strain HTCC1062)
B5ZST4 8.11e-143 412 58 5 365 3 aroC Chorismate synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q2KBP0 4.98e-141 407 57 5 365 3 aroC Chorismate synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1GCR5 5.72e-141 407 58 4 361 3 aroC Chorismate synthase Ruegeria sp. (strain TM1040)
A1URW3 2.12e-140 405 55 4 365 3 aroC Chorismate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A7HR75 2.32e-140 405 59 5 362 3 aroC Chorismate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A5EXT0 5.13e-139 402 56 1 353 3 aroC Chorismate synthase Dichelobacter nodosus (strain VCS1703A)
A6U6U1 5.45e-139 402 58 4 365 3 aroC Chorismate synthase Sinorhizobium medicae (strain WSM419)
A1BA52 5.76e-139 402 58 4 359 3 aroC Chorismate synthase Paracoccus denitrificans (strain Pd 1222)
B4RHV8 1.14e-138 402 58 5 368 3 aroC Chorismate synthase Phenylobacterium zucineum (strain HLK1)
B9JSM6 8.99e-138 399 59 5 364 3 aroC Chorismate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A8LMT3 3.82e-137 397 57 3 360 3 aroC Chorismate synthase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1GVE2 1.03e-135 394 54 3 361 3 aroC Chorismate synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q985Z4 1.79e-135 393 54 4 370 3 aroC Chorismate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0C3Z3 3.02e-135 392 57 4 364 3 aroC Chorismate synthase Hyphomonas neptunium (strain ATCC 15444)
Q28VL4 5.87e-135 392 58 3 359 3 aroC Chorismate synthase Jannaschia sp. (strain CCS1)
B9KQP8 2.28e-134 390 58 4 359 3 aroC Chorismate synthase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3IY15 2.28e-134 390 58 4 359 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B3PS94 9.02e-134 389 58 5 365 3 aroC Chorismate synthase Rhizobium etli (strain CIAT 652)
Q92RH3 4.2e-133 387 58 5 365 3 aroC Chorismate synthase Rhizobium meliloti (strain 1021)
Q2GCF2 5.95e-133 386 56 3 358 3 aroC Chorismate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5NLU3 6.8e-133 386 56 3 360 3 aroC Chorismate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A3PFR1 1.17e-132 386 57 4 359 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q0ARD9 2.54e-132 385 57 5 363 3 aroC Chorismate synthase Maricaulis maris (strain MCS10)
A5VFP1 5.22e-132 384 56 3 359 3 aroC Chorismate synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A9IQN4 6.54e-132 384 58 4 365 3 aroC Chorismate synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q7D0R6 6.64e-132 384 58 4 365 3 aroC Chorismate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2N810 1.21e-131 384 53 5 367 3 aroC Chorismate synthase Erythrobacter litoralis (strain HTCC2594)
Q6G0D7 1.17e-130 381 58 4 365 3 aroC Chorismate synthase Bartonella quintana (strain Toulouse)
B8H3W7 1.33e-130 381 58 5 371 3 aroC Chorismate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3P8 1.33e-130 381 58 5 371 3 aroC Chorismate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6G4D4 1.73e-130 380 58 4 365 3 aroC Chorismate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A0B5I7 7.44e-129 377 52 4 368 3 aroC Chorismate synthase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q72DN5 6.24e-127 371 52 1 348 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VF90 6.67e-127 371 52 1 348 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain DP4)
B9LK59 1.19e-126 371 53 2 353 3 aroC Chorismate synthase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WI34 1.19e-126 371 53 2 353 3 aroC Chorismate synthase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A0M1V5 1.68e-126 370 49 3 353 3 aroC Chorismate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A5FB38 1.96e-126 370 53 3 350 3 aroC Chorismate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B8GB37 2.93e-125 367 53 2 353 3 aroC Chorismate synthase Chloroflexus aggregans (strain MD-66 / DSM 9485)
B1ZUM3 8.57e-123 361 49 3 357 3 aroC Chorismate synthase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B1XIM6 1.39e-122 360 51 3 361 3 aroC Chorismate synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A0LE92 2.61e-122 359 55 2 345 3 aroC Chorismate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q46CJ6 1.54e-121 358 53 6 357 3 aroC Chorismate synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
A6GXP5 3.78e-121 356 49 3 353 3 aroC Chorismate synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q11Y57 1.09e-120 355 50 3 354 3 aroC Chorismate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
C6C0I6 1.3e-120 355 50 1 348 3 aroC Chorismate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A5UUN7 2.1e-120 355 51 2 353 3 aroC Chorismate synthase Roseiflexus sp. (strain RS-1)
B8HNK4 2.1e-120 355 51 2 357 3 aroC Chorismate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B7JVZ9 2.37e-120 355 50 2 359 3 aroC Chorismate synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
B8DRR9 9.1e-120 353 50 2 351 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A7NQM2 2.49e-119 352 50 2 353 3 aroC Chorismate synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B0JWQ2 2.76e-119 352 51 3 358 3 aroC Chorismate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A6LDP9 3.92e-118 349 49 3 353 3 aroC Chorismate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8DLM1 1.36e-117 348 50 2 358 3 aroC Chorismate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A9AWF4 1.6e-117 347 51 2 353 3 aroC Chorismate synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A8Z5Z2 4.9e-117 346 48 3 353 3 aroC Chorismate synthase Karelsulcia muelleri (strain GWSS)
Q8TT87 5.37e-117 346 50 6 359 3 aroC Chorismate synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B0C2W2 6.25e-117 346 49 2 358 3 aroC Chorismate synthase Acaryochloris marina (strain MBIC 11017)
B8FFQ6 7.11e-117 345 50 1 347 3 aroC Chorismate synthase Desulfatibacillum aliphaticivorans
A6L3D0 1.46e-116 345 49 3 353 3 aroC Chorismate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B1WRV7 2.07e-116 345 51 3 358 3 aroC Chorismate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A6QCJ1 2.3e-116 344 51 1 347 3 aroC Chorismate synthase Sulfurovum sp. (strain NBC37-1)
Q0W6Q8 2.53e-116 345 50 5 355 3 aroC Chorismate synthase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q3MFM3 2.63e-116 344 50 3 358 3 aroC Chorismate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YYP9 2.63e-116 344 50 3 358 3 aroC Chorismate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C4Z562 3.61e-116 344 50 3 348 3 aroC Chorismate synthase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
P57720 4.08e-116 347 50 4 361 2 EMB1144 Chorismate synthase, chloroplastic Arabidopsis thaliana
Q30NY4 8.99e-116 343 51 1 346 3 aroC Chorismate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B7KIU0 9.1e-116 343 49 3 361 3 aroC Chorismate synthase Gloeothece citriformis (strain PCC 7424)
Q2JXD0 1.41e-115 343 50 3 363 3 aroC Chorismate synthase Synechococcus sp. (strain JA-3-3Ab)
A6Q1H1 2.24e-115 342 52 1 342 3 aroC Chorismate synthase Nitratiruptor sp. (strain SB155-2)
Q31RS5 4.05e-115 341 49 2 358 3 aroC Chorismate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B2J1W7 4.76e-115 341 49 2 358 3 aroC Chorismate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q42885 5.39e-115 343 48 3 362 2 CS2 Chorismate synthase 2, chloroplastic Solanum lycopersicum
P27793 5.97e-115 344 49 3 361 1 None Chorismate synthase, chloroplastic Capnoides sempervirens
Q42884 2.75e-114 342 48 3 362 2 CS1 Chorismate synthase 1, chloroplastic Solanum lycopersicum
Q2JLD4 3.78e-114 339 50 3 361 3 aroC Chorismate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q5N2I0 4.25e-114 338 49 2 358 3 aroC Chorismate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q12X75 6.3e-114 338 49 4 355 3 aroC Chorismate synthase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A8ZT68 9.39e-114 337 52 4 353 3 aroC Chorismate synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A8EV89 1.81e-113 337 51 1 342 3 aroC Chorismate synthase Aliarcobacter butzleri (strain RM4018)
P23353 2.98e-113 337 51 3 358 3 aroC Chorismate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8PW84 4.61e-113 336 52 4 356 3 aroC Chorismate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A5GIL9 1.22e-112 335 47 3 358 3 aroC Chorismate synthase Synechococcus sp. (strain WH7803)
P46894 2.93e-112 334 46 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q64PP7 9.29e-112 333 46 3 353 3 aroC Chorismate synthase Bacteroides fragilis (strain YCH46)
E0TIQ1 1.06e-111 332 43 1 346 3 aroC Chorismate synthase Zinderia insecticola (strain CARI)
Q5L9G0 1.55e-111 332 46 3 353 3 aroC Chorismate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A0RRM6 1.67e-111 332 47 2 342 3 aroC Chorismate synthase Campylobacter fetus subsp. fetus (strain 82-40)
Q6MCU1 2.4e-111 332 48 6 364 3 aroC Chorismate synthase Protochlamydia amoebophila (strain UWE25)
Q110N5 2.53e-111 332 48 2 358 3 aroC Chorismate synthase Trichodesmium erythraeum (strain IMS101)
Q7M841 4.6e-111 331 49 1 347 3 aroC Chorismate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q0ID82 3.97e-110 328 49 3 358 3 aroC Chorismate synthase Synechococcus sp. (strain CC9311)
A8G2N2 4.29e-110 328 47 2 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9215)
C4ZAX1 5.63e-110 328 48 4 369 3 aroC Chorismate synthase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A2BUK4 7.39e-110 328 47 2 356 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9515)
O29587 7.71e-110 328 50 6 353 3 aroC Chorismate synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5GW34 2.29e-109 327 48 4 360 3 aroC Chorismate synthase Synechococcus sp. (strain RCC307)
A3PAU4 2.64e-109 327 47 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9301)
Q7VIA8 2.97e-109 326 48 1 342 3 aroC Chorismate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7V364 3.74e-109 326 47 2 359 3 aroC Chorismate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q2LUC8 5.06e-109 325 49 2 351 3 aroC Chorismate synthase Syntrophus aciditrophicus (strain SB)
A9BDJ2 5.47e-109 326 46 2 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9211)
A2BP22 7.17e-109 325 47 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain AS9601)
Q8A602 8.63e-109 325 46 3 350 3 aroC Chorismate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q31CV7 8.92e-109 325 47 2 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9312)
Q6AIP3 1.01e-107 322 46 2 353 3 aroC Chorismate synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q3AMV2 2.55e-106 319 48 3 360 3 aroC Chorismate synthase Synechococcus sp. (strain CC9605)
Q58575 4.56e-106 319 46 4 365 3 aroC Chorismate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8F9N4 4.6e-106 319 45 3 356 3 aroC Chorismate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72W01 4.6e-106 319 45 3 356 3 aroC Chorismate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B2UNJ5 6.29e-106 318 47 4 357 3 aroC Chorismate synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q04XD2 8.37e-106 318 45 2 356 3 aroC Chorismate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04W40 8.37e-106 318 45 2 356 3 aroC Chorismate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B3DXL0 1.51e-105 317 47 6 356 3 aroC Chorismate synthase Methylacidiphilum infernorum (isolate V4)
A7H187 3.29e-105 316 45 2 346 3 aroC Chorismate synthase Campylobacter curvus (strain 525.92)
Q3AUR6 4.03e-105 316 47 3 360 3 aroC Chorismate synthase Synechococcus sp. (strain CC9902)
A2C058 4.8e-105 315 46 2 360 3 aroC Chorismate synthase Prochlorococcus marinus (strain NATL1A)
B9KE09 8.73e-105 315 46 3 346 3 aroC Chorismate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q46HE7 1.21e-104 315 46 2 360 3 aroC Chorismate synthase Prochlorococcus marinus (strain NATL2A)
B8J4Q3 7.34e-104 313 52 4 344 3 aroC Chorismate synthase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q7U9F0 7.59e-104 313 47 4 359 3 aroC Chorismate synthase Parasynechococcus marenigrum (strain WH8102)
Q7V4Y9 1.44e-103 312 47 4 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9313)
A2CCA2 1.44e-103 312 47 4 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9303)
A8Z6F5 2.87e-102 308 48 2 342 3 aroC Chorismate synthase Campylobacter concisus (strain 13826)
A6UUV1 1.8e-101 307 43 4 364 3 aroC Chorismate synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
B0SRH8 7.77e-101 305 45 3 357 3 aroC Chorismate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SHV8 7.77e-101 305 45 3 357 3 aroC Chorismate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
P28777 2.46e-100 304 44 2 367 1 ARO2 Chorismate synthase ARO2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7HZN6 2.79e-100 303 43 4 357 3 aroC Chorismate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q4JC74 2.94e-100 304 48 9 374 3 aroC Chorismate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q05FR1 9.04e-100 301 40 4 346 3 aroC Chorismate synthase Carsonella ruddii (strain PV)
A5UNA1 1.44e-99 301 50 4 352 3 aroC Chorismate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q96Y94 2.19e-99 302 47 7 359 3 aroC Chorismate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9ZLH1 5.36e-99 300 43 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain J99 / ATCC 700824)
A9KQX0 8e-99 300 48 5 339 3 aroC Chorismate synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q980I7 1.04e-98 300 47 7 357 3 aroC Chorismate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
C3NG02 1.96e-98 300 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q17XJ5 2.15e-98 299 43 2 348 3 aroC Chorismate synthase Helicobacter acinonychis (strain Sheeba)
B6YRU6 2.67e-98 298 46 4 351 3 aroC Chorismate synthase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q8TXN1 3.11e-98 299 46 4 358 3 aroC Chorismate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
C3MZF2 3.63e-98 299 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.16.27)
Q30XS4 4.84e-98 298 51 2 349 3 aroC Chorismate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
C3N7H4 5.42e-98 298 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MXK6 5.42e-98 298 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MRB7 5.42e-98 298 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KIN2 5.42e-98 298 48 8 358 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
A8A9W1 6.48e-98 298 49 11 374 3 aroC Chorismate synthase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
O74413 7.15e-98 298 42 3 383 3 SPCC1223.14 Chorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7MV04 7.98e-98 297 47 4 359 3 aroC Chorismate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B5Z736 8.45e-98 297 43 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain G27)
P56122 4.5e-97 295 43 2 348 1 aroC Chorismate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
A6UPX8 1.56e-96 295 43 6 360 3 aroC Chorismate synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
B6JLQ1 1.88e-96 294 43 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain P12)
Q1CTK7 2.84e-95 291 43 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain HPAG1)
A1W1N6 3.57e-95 290 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B2UTG3 9.05e-95 290 42 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain Shi470)
C5A782 9.65e-95 289 43 6 355 3 aroC Chorismate synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
A7H5Y1 1.48e-94 289 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q5HSF9 1.61e-94 289 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni (strain RM1221)
Q9PM41 2.49e-94 288 44 5 347 1 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FNU6 4.43e-94 288 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q12640 5.34e-94 290 42 8 407 1 aro-2 Chorismate synthase aro-2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A4YHW1 5.07e-93 286 47 7 368 3 aroC Chorismate synthase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q3ZZI6 1.07e-92 284 44 5 353 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain CBDB1)
A5FS06 1.56e-92 284 44 5 353 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q18F10 8.47e-90 277 45 6 355 3 aroC Chorismate synthase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q2NGS6 9.34e-90 276 43 5 357 3 aroC Chorismate synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q9V1H0 9.42e-89 274 44 7 349 3 aroC Chorismate synthase Pyrococcus abyssi (strain GE5 / Orsay)
Q9HJY7 1.13e-88 274 44 6 346 3 aroC Chorismate synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q3Z993 3.3e-88 273 43 6 358 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q5JFT4 1.12e-87 271 42 6 354 3 aroC Chorismate synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q97AR9 5.2e-87 270 42 7 345 3 aroC Chorismate synthase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q255H5 8.3e-87 269 46 8 357 3 aroC Chorismate synthase Chlamydia felis (strain Fe/C-56)
B0BC02 3.44e-86 267 45 8 344 3 aroC Chorismate synthase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7T7 3.44e-86 267 45 8 344 3 aroC Chorismate synthase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q3KLY8 4.66e-86 267 45 8 344 3 aroC Chorismate synthase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q5L5F2 4.9e-86 267 44 7 357 3 aroC Chorismate synthase Chlamydia abortus (strain DSM 27085 / S26/3)
B9LMX0 5.14e-86 268 41 5 366 3 aroC Chorismate synthase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
O84373 8.92e-86 266 45 8 344 3 aroC Chorismate synthase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q73NM0 1.57e-85 266 42 7 370 3 aroC Chorismate synthase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
C7PC56 6.51e-85 263 43 7 349 3 aroC Chorismate synthase Chitinophaga pinensis (strain ATCC 43595 / DSM 2588 / LMG 13176 / NBRC 15968 / NCIMB 11800 / UQM 2034)
Q9Z6M2 2.54e-84 263 45 7 359 3 aroC Chorismate synthase Chlamydia pneumoniae
Q9PK26 2.78e-84 262 46 8 344 3 aroC Chorismate synthase Chlamydia muridarum (strain MoPn / Nigg)
Q822F8 2.96e-84 262 45 7 357 3 aroC Chorismate synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q6LXL7 1.21e-83 261 42 5 360 3 aroC Chorismate synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VGS0 1.96e-83 261 42 7 362 3 aroC Chorismate synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q5V5K5 1.76e-82 259 43 5 356 3 aroC Chorismate synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q6MHP7 2.4e-81 254 40 6 353 3 aroC Chorismate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C7NZH8 1.12e-80 255 41 5 372 3 aroC Chorismate synthase Halomicrobium mukohataei (strain ATCC 700874 / DSM 12286 / JCM 9738 / NCIMB 13541)
B1L5G9 1.89e-80 253 43 6 359 3 aroC Chorismate synthase Korarchaeum cryptofilum (strain OPF8)
A8MC69 1.17e-79 251 40 4 354 3 aroC Chorismate synthase Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A4FWK1 2.63e-79 250 39 5 363 3 aroC Chorismate synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A3DDD8 2.93e-79 251 42 9 380 3 aroC Chorismate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9YEL4 1.19e-78 249 42 6 348 3 aroC Chorismate synthase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
E3PV41 1.2e-78 248 39 6 357 3 aroC Chorismate synthase Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
O26843 4.39e-78 247 47 4 356 3 aroC Chorismate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08835
Feature type CDS
Gene aroC
Product chorismate synthase
Location 1931931 - 1933016 (strand: -1)
Length 1086 (nucleotides) / 361 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01264 Chorismate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0082 Amino acid transport and metabolism (E) E Chorismate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MAGNSIGQLFRVTTFGESHGTALGCIVDGVPPGLPLTQADLQVDLDRRKPGTSRYTTQRREPDQVRILSGVFNGVTTGTSIGLLIENTDQRSQDYSEIKDVFRPGHADYTYEQKYGLRDYRGGGRSSARETAMRVAAGAIAKKYLKQKFGIEVKGYLSQLGPISCELVDWSIVETNPFFCPDPSRLDALDEYMRALKKEGNSIGAKVTVVAEGVPAGLGEPVFDRLDADLAHALMSINAVKGVEIGDGFDVVTLKGTENRDEITKEGFSSNHAGGVLGGISSGQPIIAHIALKPTSSITIAGKTLNRQGEEVDMITKGRHDPCVGIRAVPIAEAMMAIVLLDHALRQRGQCGDVIPPLMQW

Flanking regions ( +/- flanking 50bp)

ATAACATATTAATAACATCACACAGTCAGTCATAAGATAGGAATTGAGGGATGGCGGGAAACAGTATCGGGCAATTATTTAGAGTAACCACTTTTGGTGAGTCTCATGGCACAGCGTTAGGTTGCATTGTGGATGGTGTTCCTCCCGGATTACCTTTAACGCAAGCGGATCTACAAGTTGATTTAGATAGACGTAAACCGGGAACTTCACGTTATACCACACAACGTAGAGAGCCTGATCAAGTGCGTATTTTATCGGGTGTTTTTAATGGTGTAACAACGGGAACCAGTATTGGATTATTAATAGAAAATACGGATCAGCGCTCTCAAGATTATAGCGAAATTAAAGATGTATTCCGCCCAGGGCATGCAGACTACACCTATGAACAGAAATATGGTTTACGTGATTATCGTGGCGGGGGACGCTCTTCTGCTCGAGAAACCGCCATGCGTGTCGCAGCGGGTGCTATTGCCAAAAAATACCTTAAACAAAAATTTGGTATTGAAGTAAAAGGTTACTTATCTCAATTAGGGCCGATTAGTTGTGAGTTAGTTGATTGGTCAATTGTAGAAACCAACCCATTCTTTTGCCCAGATCCTTCTCGCCTAGATGCCCTTGATGAATATATGCGAGCGCTAAAAAAAGAGGGTAATTCTATAGGTGCCAAAGTTACCGTGGTTGCAGAAGGTGTACCTGCAGGATTAGGCGAACCCGTTTTTGATAGACTTGATGCCGATTTGGCTCATGCGTTAATGAGCATCAACGCAGTAAAAGGCGTTGAAATCGGAGATGGTTTTGATGTGGTGACCTTAAAAGGGACTGAAAACCGCGATGAAATTACCAAAGAAGGTTTTAGCAGTAATCACGCGGGGGGCGTATTAGGTGGCATTAGTAGTGGTCAACCTATTATTGCACACATTGCTTTAAAGCCAACTTCAAGTATTACTATTGCTGGTAAGACACTTAATCGACAAGGTGAAGAAGTCGATATGATCACCAAAGGGCGACATGATCCGTGTGTCGGTATCCGAGCTGTTCCTATTGCAGAAGCTATGATGGCTATTGTGTTACTTGATCATGCGTTACGTCAACGGGGTCAATGTGGTGATGTTATTCCTCCATTAATGCAATGGTGATCTTAGCTTACATCAATAATACAGCGCATAATCTGTAGTAAGTTTGCTAT