Homologs in group_1965

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14340 FBDBKF_14340 100.0 Morganella morganii S1 aroC chorismate synthase
EHELCC_07940 EHELCC_07940 100.0 Morganella morganii S2 aroC chorismate synthase
NLDBIP_08265 NLDBIP_08265 100.0 Morganella morganii S4 aroC chorismate synthase
LHKJJB_06000 LHKJJB_06000 100.0 Morganella morganii S3 aroC chorismate synthase
F4V73_RS02565 F4V73_RS02565 96.4 Morganella psychrotolerans aroC chorismate synthase
PMI_RS08835 PMI_RS08835 83.7 Proteus mirabilis HI4320 aroC chorismate synthase

Distribution of the homologs in the orthogroup group_1965

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1965

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N299 0.0 642 84 0 361 3 aroC Chorismate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EZG9 0.0 629 83 0 361 3 aroC Chorismate synthase Proteus mirabilis (strain HI4320)
A7MH70 0.0 609 84 0 361 3 aroC Chorismate synthase Cronobacter sakazakii (strain ATCC BAA-894)
A4WCW2 0.0 606 83 0 361 3 aroC Chorismate synthase Enterobacter sp. (strain 638)
Q0T2F6 0.0 606 83 0 361 3 aroC Chorismate synthase Shigella flexneri serotype 5b (strain 8401)
Q31YC9 0.0 606 84 0 361 3 aroC Chorismate synthase Shigella boydii serotype 4 (strain Sb227)
B2TWB1 0.0 606 84 0 361 3 aroC Chorismate synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3YZN2 0.0 605 84 0 361 3 aroC Chorismate synthase Shigella sonnei (strain Ss046)
Q83QQ5 0.0 605 83 0 361 3 aroC Chorismate synthase Shigella flexneri
B6I4X6 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain SE11)
B7LBI3 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain 55989 / EAEC)
B7UFY7 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P12008 0.0 605 84 0 361 1 aroC Chorismate synthase Escherichia coli (strain K12)
A8A2J9 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli O9:H4 (strain HS)
B1X9K2 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain K12 / DH10B)
C4ZVM2 0.0 605 84 0 361 3 aroC Chorismate synthase Escherichia coli (strain K12 / MC4100 / BW2952)
Q32DK8 0.0 603 83 0 361 3 aroC Chorismate synthase Shigella dysenteriae serotype 1 (strain Sd197)
B7LLE1 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R983 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli (strain UTI89 / UPEC)
B1LLT5 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli (strain SMS-3-5 / SECEC)
B7N5U1 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IXB6 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P63609 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFB7 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADH8 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O1:K1 / APEC
B7M6L0 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O8 (strain IAI1)
B7MY06 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O81 (strain ED1a)
B5YXX0 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P63610 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O157:H7
B7MG93 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPE5 0.0 603 83 0 361 3 aroC Chorismate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NP10 0.0 602 83 0 361 3 aroC Chorismate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A9MJ42 0.0 601 83 0 361 3 aroC Chorismate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5BBA5 0.0 601 83 0 361 3 aroC Chorismate synthase Salmonella paratyphi A (strain AKU_12601)
Q5PCX2 0.0 601 83 0 361 3 aroC Chorismate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A6TC15 0.0 600 83 0 361 3 aroC Chorismate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TQB9 0.0 600 83 0 361 3 aroC Chorismate synthase Salmonella schwarzengrund (strain CVM19633)
B5RCK9 0.0 600 83 0 361 3 aroC Chorismate synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3R5 0.0 600 83 0 361 3 aroC Chorismate synthase Salmonella enteritidis PT4 (strain P125109)
B5FPM7 0.0 600 83 0 361 3 aroC Chorismate synthase Salmonella dublin (strain CT_02021853)
B5EZR6 0.0 600 83 0 361 3 aroC Chorismate synthase Salmonella agona (strain SL483)
B5XVW6 0.0 600 83 0 361 3 aroC Chorismate synthase Klebsiella pneumoniae (strain 342)
P58729 0.0 599 83 0 361 3 aroC Chorismate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N460 0.0 599 83 0 361 3 aroC Chorismate synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZQ7 0.0 599 83 0 361 3 aroC Chorismate synthase Salmonella newport (strain SL254)
B4TCA5 0.0 599 83 0 361 3 aroC Chorismate synthase Salmonella heidelberg (strain SL476)
Q57LX0 0.0 599 83 0 361 3 aroC Chorismate synthase Salmonella choleraesuis (strain SC-B67)
A8GH82 0.0 597 82 0 361 3 aroC Chorismate synthase Serratia proteamaculans (strain 568)
A8ADP9 0.0 596 82 0 361 3 aroC Chorismate synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1JK48 0.0 596 81 0 361 3 aroC Chorismate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P16280 0.0 595 82 0 361 3 aroC Chorismate synthase Salmonella typhi
B1JGG7 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TM78 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pestis (strain Pestoides F)
Q1CHK6 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7W3 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD41 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pestis
Q1C664 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK6 0.0 594 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6DA85 0.0 594 81 0 361 3 aroC Chorismate synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D2M6 0.0 593 81 0 361 3 aroC Chorismate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q668V5 0.0 592 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K8I9 0.0 592 81 0 361 3 aroC Chorismate synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2VIY1 0.0 575 80 0 359 3 aroC Chorismate synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7MIT1 0.0 574 77 0 359 3 aroC Chorismate synthase Vibrio vulnificus (strain YJ016)
Q87MM9 0.0 574 77 0 359 3 aroC Chorismate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DB42 0.0 573 77 0 359 3 aroC Chorismate synthase Vibrio vulnificus (strain CMCP6)
A7MS71 0.0 571 76 0 359 3 aroC Chorismate synthase Vibrio campbellii (strain ATCC BAA-1116)
C5BAF2 0.0 568 78 0 361 3 aroC Chorismate synthase Edwardsiella ictaluri (strain 93-146)
Q65U87 0.0 563 77 1 356 3 aroC Chorismate synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P39198 0.0 558 76 0 359 3 aroC Chorismate synthase Vibrio anguillarum (strain ATCC 68554 / 775)
Q6LNN4 0.0 556 77 0 359 3 aroC Chorismate synthase Photobacterium profundum (strain SS9)
Q07ZQ7 0.0 554 75 0 359 3 aroC Chorismate synthase Shewanella frigidimarina (strain NCIMB 400)
B8EEA7 0.0 554 75 0 361 3 aroC Chorismate synthase Shewanella baltica (strain OS223)
Q3IJ50 0.0 554 74 0 354 3 aroC Chorismate synthase Pseudoalteromonas translucida (strain TAC 125)
A1RIA0 0.0 553 75 0 361 3 aroC Chorismate synthase Shewanella sp. (strain W3-18-1)
A9KTV7 0.0 553 75 0 361 3 aroC Chorismate synthase Shewanella baltica (strain OS195)
A6WQ14 0.0 553 75 0 361 3 aroC Chorismate synthase Shewanella baltica (strain OS185)
A3D676 0.0 553 75 0 361 3 aroC Chorismate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q5E3U6 0.0 551 77 0 359 3 aroC Chorismate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4Y889 0.0 550 74 0 361 3 aroC Chorismate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S7K8 0.0 550 73 0 361 3 aroC Chorismate synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6VMY7 0.0 550 73 1 359 3 aroC Chorismate synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B5FGA8 0.0 549 76 0 359 3 aroC Chorismate synthase Aliivibrio fischeri (strain MJ11)
A1STP2 0.0 546 72 0 359 3 aroC Chorismate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q47ZC3 0.0 543 72 2 373 3 aroC Chorismate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q12P04 0.0 543 73 0 359 3 aroC Chorismate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9ZHE9 0.0 542 71 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
C3LP65 0.0 539 76 0 359 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ85 0.0 539 76 0 359 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6F4 0.0 539 76 0 359 3 aroC Chorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0KV84 0.0 538 75 0 359 3 aroC Chorismate synthase Shewanella sp. (strain ANA-3)
B4RU03 0.0 538 72 0 354 3 aroC Chorismate synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B0BP27 0.0 538 76 2 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXI4 0.0 538 76 2 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q0HWM5 0.0 538 75 0 359 3 aroC Chorismate synthase Shewanella sp. (strain MR-7)
Q0HKC3 0.0 538 75 0 359 3 aroC Chorismate synthase Shewanella sp. (strain MR-4)
Q0A9B2 0.0 536 71 1 363 3 aroC Chorismate synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A8FTS6 0.0 536 74 0 359 3 aroC Chorismate synthase Shewanella sediminis (strain HAW-EB3)
P43875 0.0 536 76 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A3N0B0 0.0 535 76 2 359 3 aroC Chorismate synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UFZ9 0.0 534 76 2 357 3 aroC Chorismate synthase Haemophilus influenzae (strain PittGG)
A5UAV8 0.0 534 76 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain PittEE)
B8D703 0.0 534 70 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57198 0.0 534 70 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8P9 0.0 534 70 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8F415 0.0 533 75 1 359 3 aroC Chorismate synthase Glaesserella parasuis serovar 5 (strain SH0165)
Q2SJE4 0.0 532 71 0 359 3 aroC Chorismate synthase Hahella chejuensis (strain KCTC 2396)
P57840 0.0 532 76 1 355 3 aroC Chorismate synthase Pasteurella multocida (strain Pm70)
Q4QNZ4 0.0 532 75 1 356 3 aroC Chorismate synthase Haemophilus influenzae (strain 86-028NP)
Q2NSH3 0.0 531 78 0 359 3 aroC Chorismate synthase Sodalis glossinidius (strain morsitans)
A3QFN4 0.0 531 74 0 359 3 aroC Chorismate synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KKS1 0.0 530 74 0 359 3 aroC Chorismate synthase Shewanella woodyi (strain ATCC 51908 / MS32)
Q7VLX2 0.0 530 74 1 359 3 aroC Chorismate synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VRU6 0.0 530 69 0 353 3 aroC Chorismate synthase Blochmanniella floridana
Q15VM5 0.0 529 68 1 365 3 aroC Chorismate synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0UWQ4 0.0 528 75 1 359 3 aroC Chorismate synthase Histophilus somni (strain 2336)
Q0I3U1 0.0 528 75 1 359 3 aroC Chorismate synthase Histophilus somni (strain 129Pt)
Q492G9 0.0 528 72 0 354 3 aroC Chorismate synthase Blochmanniella pennsylvanica (strain BPEN)
Q3J713 0.0 527 70 0 360 3 aroC Chorismate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A0KKS7 0.0 526 74 0 359 3 aroC Chorismate synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q0VPH7 0.0 523 68 0 359 3 aroC Chorismate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4SM83 0.0 521 73 0 359 3 aroC Chorismate synthase Aeromonas salmonicida (strain A449)
Q89AX9 0.0 519 70 0 352 3 aroC Chorismate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A6VXI7 0.0 518 68 0 359 3 aroC Chorismate synthase Marinomonas sp. (strain MWYL1)
Q1QUP5 0.0 517 69 1 359 3 aroC Chorismate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A1U0Y3 0.0 516 69 0 359 3 aroC Chorismate synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q60AY5 0.0 514 71 0 355 3 aroC Chorismate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
C4K3S0 0.0 514 71 0 351 3 aroC Chorismate synthase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q1LTA9 0.0 512 72 0 354 3 aroC Chorismate synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q21IX8 0.0 511 67 0 359 3 aroC Chorismate synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q31FE3 3.71e-180 506 65 0 358 3 aroC Chorismate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B3PHF4 7.48e-180 506 71 0 359 3 aroC Chorismate synthase Cellvibrio japonicus (strain Ueda107)
C4L8D2 9.93e-180 505 71 0 359 3 aroC Chorismate synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5QW40 1.04e-178 503 70 1 348 3 aroC Chorismate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C5BL71 9.08e-177 498 66 0 354 3 aroC Chorismate synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
C1DBU8 2.67e-175 494 67 0 359 3 aroC Chorismate synthase Laribacter hongkongensis (strain HLHK9)
A1AW83 5.03e-175 493 63 1 363 3 aroC Chorismate synthase Ruthia magnifica subsp. Calyptogena magnifica
A1WY16 1.53e-174 492 65 1 363 3 aroC Chorismate synthase Halorhodospira halophila (strain DSM 244 / SL1)
Q4FRQ5 8.89e-174 490 68 1 365 3 aroC Chorismate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B0VPN2 1.4e-172 487 69 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain SDF)
B2I0B7 1.63e-172 487 69 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain ACICU)
Q7NYT5 1.84e-172 487 65 0 359 3 aroC Chorismate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B0VDX7 2.47e-172 486 69 0 358 1 aroC Chorismate synthase Acinetobacter baumannii (strain AYE)
A3M5C7 2.47e-172 486 69 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I5W6 2.47e-172 486 69 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain AB0057)
B7H3A6 2.47e-172 486 69 0 358 3 aroC Chorismate synthase Acinetobacter baumannii (strain AB307-0294)
B5EJT1 2.76e-172 486 65 0 359 3 aroC Chorismate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JC67 2.76e-172 486 65 0 359 3 aroC Chorismate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q1QA91 7.55e-172 486 67 1 367 3 aroC Chorismate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9I344 4.54e-171 483 69 2 362 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KH1 4.54e-171 483 69 2 362 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UV40 4.54e-171 483 69 2 362 1 aroC Chorismate synthase Pseudomonas aeruginosa (strain LESB58)
Q47HR7 1.2e-170 483 64 1 362 3 aroC Chorismate synthase Dechloromonas aromatica (strain RCB)
Q13WE6 2.61e-170 481 63 0 359 3 aroC Chorismate synthase Paraburkholderia xenovorans (strain LB400)
A4JDS6 4.97e-170 481 63 0 359 3 aroC Chorismate synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q6FAR2 7.07e-170 480 68 0 358 3 aroC Chorismate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1V3K9 1.53e-169 480 64 0 359 3 aroC Chorismate synthase Burkholderia mallei (strain SAVP1)
Q62KU7 1.53e-169 480 64 0 359 3 aroC Chorismate synthase Burkholderia mallei (strain ATCC 23344)
A3MJ92 1.53e-169 480 64 0 359 3 aroC Chorismate synthase Burkholderia mallei (strain NCTC 10247)
B4E7H2 2.04e-169 479 64 0 359 3 aroC Chorismate synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A2S381 3.36e-169 479 64 0 359 3 aroC Chorismate synthase Burkholderia mallei (strain NCTC 10229)
Q4ZVC2 3.94e-169 478 68 1 359 3 aroC Chorismate synthase Pseudomonas syringae pv. syringae (strain B728a)
A4VM84 4.91e-169 478 68 1 359 3 aroC Chorismate synthase Stutzerimonas stutzeri (strain A1501)
Q63TK6 6.27e-169 478 64 0 359 3 aroC Chorismate synthase Burkholderia pseudomallei (strain K96243)
A3N8Q9 6.27e-169 478 64 0 359 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 668)
Q3JT35 6.27e-169 478 64 0 359 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 1710b)
A3NUG3 6.27e-169 478 64 0 359 3 aroC Chorismate synthase Burkholderia pseudomallei (strain 1106a)
A6V7B0 7.04e-169 478 68 2 362 3 aroC Chorismate synthase Pseudomonas aeruginosa (strain PA7)
Q884P5 9.15e-169 478 68 1 362 3 aroC Chorismate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XTH9 1.4e-168 477 68 2 362 3 aroC Chorismate synthase Pseudomonas mendocina (strain ymp)
Q4K8J3 1.48e-168 477 68 1 359 3 aroC Chorismate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q83D67 1.62e-168 476 65 0 350 3 aroC Chorismate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q2SVC0 2.57e-168 477 63 0 359 3 aroC Chorismate synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B0KUL0 3.51e-168 476 68 1 359 3 aroC Chorismate synthase Pseudomonas putida (strain GB-1)
Q48KN0 4.28e-168 476 68 1 359 3 aroC Chorismate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B2SZH3 6.68e-168 476 62 0 359 3 aroC Chorismate synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JK28 8.22e-168 475 62 1 363 3 aroC Chorismate synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1ID65 1.18e-167 475 68 1 354 3 aroC Chorismate synthase Pseudomonas entomophila (strain L48)
Q88LU7 2.46e-167 474 67 1 359 3 aroC Chorismate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W794 2.46e-167 474 67 1 359 3 aroC Chorismate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q39H65 2.54e-167 474 63 0 359 3 aroC Chorismate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1J4S1 2.57e-167 474 67 1 359 3 aroC Chorismate synthase Pseudomonas putida (strain W619)
A9ABG9 3.26e-167 474 63 0 359 3 aroC Chorismate synthase Burkholderia multivorans (strain ATCC 17616 / 249)
B1YNZ5 4.06e-167 473 63 0 362 3 aroC Chorismate synthase Burkholderia ambifaria (strain MC40-6)
Q3KFJ1 4.75e-167 473 67 1 359 3 aroC Chorismate synthase Pseudomonas fluorescens (strain Pf0-1)
A5CX05 4.93e-167 473 63 1 363 3 aroC Chorismate synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q1BWW8 6.64e-167 473 63 0 359 3 aroC Chorismate synthase Burkholderia orbicola (strain AU 1054)
A0K6T5 6.64e-167 473 63 0 359 3 aroC Chorismate synthase Burkholderia cenocepacia (strain HI2424)
Q0BG24 1.74e-166 472 63 0 359 3 aroC Chorismate synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1K077 2.58e-166 471 62 0 359 3 aroC Chorismate synthase Burkholderia orbicola (strain MC0-3)
Q0AEP5 4.63e-166 472 62 1 362 3 aroC Chorismate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A5WDY8 7.15e-166 470 67 1 363 3 aroC Chorismate synthase Psychrobacter sp. (strain PRwf-1)
Q3SL02 7.37e-166 470 61 0 359 3 aroC Chorismate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q5WUE6 1.56e-165 469 65 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Lens)
Q5ZT62 2.42e-165 468 65 0 351 3 aroC Chorismate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IEA1 2.42e-165 468 65 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Corby)
Q5X2Y6 1.18e-164 467 65 0 351 3 aroC Chorismate synthase Legionella pneumophila (strain Paris)
Q5P1K1 1.57e-164 467 61 0 359 3 aroC Chorismate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C3K084 4.57e-164 466 66 1 359 3 aroC Chorismate synthase Pseudomonas fluorescens (strain SBW25)
B2FP01 2.02e-163 464 62 1 362 3 aroC Chorismate synthase Stenotrophomonas maltophilia (strain K279a)
Q058B0 5.81e-163 462 62 0 351 3 aroC Chorismate synthase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A6T017 8.89e-163 462 61 1 362 3 aroC Chorismate synthase Janthinobacterium sp. (strain Marseille)
B4SQW1 9.13e-163 462 62 1 362 3 aroC Chorismate synthase Stenotrophomonas maltophilia (strain R551-3)
Q1GZD3 1.05e-162 462 65 0 355 3 aroC Chorismate synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0KC14 3.33e-162 461 63 1 363 3 aroC Chorismate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q472Q5 4.3e-162 461 63 1 363 3 aroC Chorismate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4G4F3 1.23e-161 459 61 1 365 3 aroC Chorismate synthase Herminiimonas arsenicoxydans
B2UGK8 5.56e-161 458 60 1 363 3 aroC Chorismate synthase Ralstonia pickettii (strain 12J)
Q3BRK5 1.16e-160 457 62 1 362 3 aroC Chorismate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B9MAD0 2.16e-160 456 60 2 363 3 aroC Chorismate synthase Acidovorax ebreus (strain TPSY)
Q07HS5 3.09e-160 456 63 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisA53)
Q8PJ20 3.74e-160 456 61 1 362 3 aroC Chorismate synthase Xanthomonas axonopodis pv. citri (strain 306)
Q82TK9 6.03e-160 456 62 1 362 3 aroC Chorismate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5GXQ6 9.06e-160 455 61 1 362 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SVP7 9.06e-160 455 61 1 362 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0T3 9.06e-160 455 61 1 362 3 aroC Chorismate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2KYK7 9.52e-160 454 62 0 351 3 aroC Chorismate synthase Bordetella avium (strain 197N)
Q2W6Y1 1.48e-159 454 63 3 358 3 aroC Chorismate synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A1W6H4 3.07e-159 454 60 2 363 3 aroC Chorismate synthase Acidovorax sp. (strain JS42)
Q21TN3 3.2e-159 453 61 1 355 3 aroC Chorismate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A9IT47 5.66e-159 452 62 0 351 3 aroC Chorismate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q5FPG9 8.85e-159 452 63 3 356 3 aroC Chorismate synthase Gluconobacter oxydans (strain 621H)
A1VQW9 1.11e-158 452 60 1 359 3 aroC Chorismate synthase Polaromonas naphthalenivorans (strain CJ2)
B4RN46 1.18e-158 452 63 0 362 3 aroC Chorismate synthase Neisseria gonorrhoeae (strain NCCP11945)
Q5F756 1.27e-158 452 63 0 362 3 aroC Chorismate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8P7R0 2.23e-158 451 61 1 362 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWE0 2.23e-158 451 61 1 362 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain 8004)
A1TRH4 2.47e-158 451 60 1 355 3 aroC Chorismate synthase Paracidovorax citrulli (strain AAC00-1)
Q2Y7L8 2.66e-158 452 62 1 362 3 aroC Chorismate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B0RR76 2.74e-158 451 61 1 362 3 aroC Chorismate synthase Xanthomonas campestris pv. campestris (strain B100)
B2SF54 4.72e-158 450 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IYS7 1.06e-157 449 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGG6 1.06e-157 449 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q4Z0 1.06e-157 449 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. novicida (strain U112)
Q14HW8 1.06e-157 449 63 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q3SUZ5 4.87e-157 448 62 4 367 3 aroC Chorismate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q1QQ46 7.6e-157 447 62 4 365 3 aroC Chorismate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8XZ40 1.07e-156 447 61 0 360 3 aroC Chorismate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JT81 1.07e-156 447 63 0 359 3 aroC Chorismate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2J0T8 1.56e-156 446 62 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain HaA2)
B1XUP3 1.6e-156 447 61 1 363 3 aroC Chorismate synthase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A1KV89 1.69e-156 447 63 0 359 3 aroC Chorismate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M1Q2 1.69e-156 447 63 0 359 3 aroC Chorismate synthase Neisseria meningitidis serogroup C (strain 053442)
Q0BNG4 1.71e-156 446 62 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A549 1.71e-156 446 62 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NA74 1.71e-156 446 62 2 349 3 aroC Chorismate synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q89RY1 2.27e-156 446 62 4 362 3 aroC Chorismate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1XWC5 2.78e-156 447 59 0 359 3 aroC Chorismate synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q9JY99 3.04e-156 446 63 0 359 3 aroC Chorismate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A2SFP8 3.68e-156 446 59 0 358 3 aroC Chorismate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q21A81 4.37e-156 445 62 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisB18)
A4YQ28 5.03e-156 445 62 4 362 3 aroC Chorismate synthase Bradyrhizobium sp. (strain ORS 278)
Q7VY92 5.1e-156 445 61 0 351 3 aroC Chorismate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A1K498 6.36e-156 446 61 0 359 3 aroC Chorismate synthase Azoarcus sp. (strain BH72)
A9H0U2 6.77e-156 445 62 3 356 3 aroC Chorismate synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q1LPA2 1.5e-155 444 60 1 363 3 aroC Chorismate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6NAI4 1.72e-155 444 62 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7WKJ5 1.89e-155 443 61 0 351 3 aroC Chorismate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q13BI7 2.02e-155 444 61 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain BisB5)
A5EEP1 2.54e-155 443 62 4 362 3 aroC Chorismate synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B3QIL0 4.11e-155 443 62 4 362 3 aroC Chorismate synthase Rhodopseudomonas palustris (strain TIE-1)
Q7W950 1.84e-154 441 61 0 351 3 aroC Chorismate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A4SXH9 1.4e-153 439 61 1 363 3 aroC Chorismate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B8ESC6 2.42e-153 439 59 5 374 3 aroC Chorismate synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B2IDQ8 1.52e-152 437 60 5 366 3 aroC Chorismate synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B6IRC6 6.38e-152 436 63 3 356 3 aroC Chorismate synthase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2RR25 8.35e-152 435 63 3 360 3 aroC Chorismate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A0LDR1 8.53e-152 434 62 2 356 3 aroC Chorismate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q87DS4 2e-151 434 61 1 362 3 aroC Chorismate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9I6 2e-151 434 61 1 362 3 aroC Chorismate synthase Xylella fastidiosa (strain M23)
B0U6K0 3.65e-151 433 61 1 362 3 aroC Chorismate synthase Xylella fastidiosa (strain M12)
Q9PDL0 1.43e-150 432 61 0 354 3 aroC Chorismate synthase Xylella fastidiosa (strain 9a5c)
A1WL18 1.98e-150 431 57 1 354 3 aroC Chorismate synthase Verminephrobacter eiseniae (strain EF01-2)
B1M325 4.13e-150 430 62 4 366 3 aroC Chorismate synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A7IMW7 1.11e-149 429 60 4 365 3 aroC Chorismate synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q5LX60 1.12e-149 429 61 4 357 3 aroC Chorismate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q12CG7 5.25e-149 427 60 1 359 3 aroC Chorismate synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B6JFJ0 5.73e-149 427 62 4 360 3 aroC Chorismate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
C5CS25 1.2e-148 427 61 2 356 3 aroC Chorismate synthase Variovorax paradoxus (strain S110)
Q11KE5 1.43e-148 426 58 4 363 3 aroC Chorismate synthase Chelativorans sp. (strain BNC1)
B1ZHL0 1.1e-147 424 63 4 367 3 aroC Chorismate synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A8I4M5 2.96e-147 423 62 6 372 3 aroC Chorismate synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B0UJB1 8.83e-147 423 62 4 364 3 aroC Chorismate synthase Methylobacterium sp. (strain 4-46)
Q0BVN0 3.36e-146 420 63 3 360 3 aroC Chorismate synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A5FY49 1.52e-144 416 62 3 360 3 aroC Chorismate synthase Acidiphilium cryptum (strain JF-5)
Q16CN2 3.05e-144 416 58 3 358 3 aroC Chorismate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1MKK1 4.99e-143 412 58 5 363 3 aroC Chorismate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C3MHI8 9.92e-143 412 58 5 363 3 aroC Chorismate synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B7KT24 1.05e-142 412 62 4 364 3 aroC Chorismate synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q4FN06 3.57e-142 410 57 3 360 3 aroC Chorismate synthase Pelagibacter ubique (strain HTCC1062)
A9W6U7 1.38e-141 409 62 4 364 3 aroC Chorismate synthase Methylorubrum extorquens (strain PA1)
B5ZST4 1.41e-141 409 58 5 363 3 aroC Chorismate synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
C0RHD5 1.97e-141 408 58 4 367 3 aroC Chorismate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
A6WWB6 2.33e-141 408 58 4 367 3 aroC Chorismate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A1URW3 5.05e-141 407 57 5 363 3 aroC Chorismate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q1GCR5 5.56e-141 407 58 3 361 3 aroC Chorismate synthase Ruegeria sp. (strain TM1040)
A4WWC0 7.21e-141 407 57 3 365 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
P63608 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella suis biovar 1 (strain 1330)
B0CKB2 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VP02 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P63607 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M8V2 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57ET8 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YMF8 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella abortus (strain 2308)
B2S9R7 1.24e-140 406 57 4 367 3 aroC Chorismate synthase Brucella abortus (strain S19)
Q2KBP0 1.38e-140 406 58 5 363 3 aroC Chorismate synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A1BA52 3.04e-140 405 60 3 357 3 aroC Chorismate synthase Paracoccus denitrificans (strain Pd 1222)
Q2GCF2 3.44e-140 405 59 3 357 3 aroC Chorismate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B8IS51 1.01e-139 404 62 4 370 3 aroC Chorismate synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A7HR75 9.86e-139 401 60 6 361 3 aroC Chorismate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A5EXT0 3.89e-137 397 56 1 351 3 aroC Chorismate synthase Dichelobacter nodosus (strain VCS1703A)
Q1GVE2 1.65e-136 395 57 3 360 3 aroC Chorismate synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q0ARD9 4.3e-136 395 57 4 364 3 aroC Chorismate synthase Maricaulis maris (strain MCS10)
B9JSM6 9.87e-135 391 58 4 363 3 aroC Chorismate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A5VFP1 3.86e-134 389 57 3 357 3 aroC Chorismate synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B3PS94 3.87e-134 390 58 5 363 3 aroC Chorismate synthase Rhizobium etli (strain CIAT 652)
A6U6U1 5.54e-134 389 58 5 363 3 aroC Chorismate synthase Sinorhizobium medicae (strain WSM419)
Q985Z4 2.26e-133 388 55 5 365 3 aroC Chorismate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8H3W7 3.81e-133 387 60 4 373 3 aroC Chorismate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3P8 3.81e-133 387 60 4 373 3 aroC Chorismate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8LMT3 4.51e-133 387 57 3 360 3 aroC Chorismate synthase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B4RHV8 5.38e-133 387 58 4 366 3 aroC Chorismate synthase Phenylobacterium zucineum (strain HLK1)
Q28VL4 1.75e-132 386 58 3 357 3 aroC Chorismate synthase Jannaschia sp. (strain CCS1)
Q0C3Z3 1.83e-131 383 57 4 362 3 aroC Chorismate synthase Hyphomonas neptunium (strain ATCC 15444)
Q5NLU3 4.22e-131 382 55 3 358 3 aroC Chorismate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2N810 4.12e-130 380 54 4 366 3 aroC Chorismate synthase Erythrobacter litoralis (strain HTCC2594)
A9IQN4 7.24e-130 379 58 4 364 3 aroC Chorismate synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
B9LK59 9.22e-130 379 55 2 353 3 aroC Chorismate synthase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WI34 9.22e-130 379 55 2 353 3 aroC Chorismate synthase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B8GB37 1.13e-129 379 55 2 353 3 aroC Chorismate synthase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q72DN5 1.33e-129 378 54 1 348 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B9KQP8 2.36e-129 378 57 3 357 3 aroC Chorismate synthase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3IY15 2.36e-129 378 57 3 357 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PFR1 3.73e-129 377 57 3 357 3 aroC Chorismate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q7D0R6 3.81e-129 377 58 5 363 3 aroC Chorismate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92RH3 8.63e-129 376 58 5 363 3 aroC Chorismate synthase Rhizobium meliloti (strain 1021)
A1VF90 1.71e-128 375 54 1 348 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q6G0D7 1.12e-127 374 58 4 363 3 aroC Chorismate synthase Bartonella quintana (strain Toulouse)
Q6G4D4 4.53e-127 372 57 4 363 3 aroC Chorismate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A5UUN7 8.45e-127 371 53 2 353 3 aroC Chorismate synthase Roseiflexus sp. (strain RS-1)
A5FB38 2.26e-126 370 53 3 353 3 aroC Chorismate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A0M1V5 1.08e-123 363 50 3 353 3 aroC Chorismate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0B5I7 4.04e-123 362 52 4 368 3 aroC Chorismate synthase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A7NQM2 3.77e-122 359 52 2 353 3 aroC Chorismate synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B1XIM6 2.47e-121 357 52 3 361 3 aroC Chorismate synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q11Y57 3.03e-121 357 51 3 354 3 aroC Chorismate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6GXP5 5.87e-121 356 50 3 353 3 aroC Chorismate synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B1ZUM3 4.73e-120 354 50 3 357 3 aroC Chorismate synthase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B7KIU0 1.52e-119 353 51 2 361 3 aroC Chorismate synthase Gloeothece citriformis (strain PCC 7424)
C6C0I6 1.89e-119 352 49 1 348 3 aroC Chorismate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8DRR9 7.24e-119 350 52 2 351 3 aroC Chorismate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B7JVZ9 3.07e-118 349 51 3 358 3 aroC Chorismate synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
A0LE92 1.93e-116 344 54 2 345 3 aroC Chorismate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2J1W7 3.25e-116 344 51 3 358 3 aroC Chorismate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8DLM1 3.28e-116 344 51 2 358 3 aroC Chorismate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3MFM3 3.58e-116 344 51 3 358 3 aroC Chorismate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YYP9 3.58e-116 344 51 3 358 3 aroC Chorismate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6LDP9 4.21e-116 343 49 3 350 3 aroC Chorismate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B0JWQ2 5.25e-116 344 51 2 358 3 aroC Chorismate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A6L3D0 6.3e-116 343 50 4 354 3 aroC Chorismate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B8HNK4 8.1e-116 343 50 2 361 3 aroC Chorismate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A9AWF4 1.55e-115 342 52 2 353 3 aroC Chorismate synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q30NY4 1.68e-115 342 52 1 347 3 aroC Chorismate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P23353 2.63e-115 342 51 2 358 3 aroC Chorismate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0C2W2 3.09e-115 342 49 3 362 3 aroC Chorismate synthase Acaryochloris marina (strain MBIC 11017)
Q2JXD0 3.9e-115 342 51 3 363 3 aroC Chorismate synthase Synechococcus sp. (strain JA-3-3Ab)
B1WRV7 5.75e-115 341 51 2 362 3 aroC Chorismate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q0W6Q8 6.36e-115 341 51 5 354 3 aroC Chorismate synthase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q2JLD4 1.05e-114 341 51 4 368 3 aroC Chorismate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
C4Z562 2.53e-114 339 49 3 351 3 aroC Chorismate synthase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q46CJ6 2.64e-114 339 50 4 355 3 aroC Chorismate synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
A6QCJ1 9.12e-114 338 51 1 350 3 aroC Chorismate synthase Sulfurovum sp. (strain NBC37-1)
Q31RS5 1.14e-113 338 49 2 359 3 aroC Chorismate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0RRM6 1.28e-113 337 49 2 342 3 aroC Chorismate synthase Campylobacter fetus subsp. fetus (strain 82-40)
B8FFQ6 1.73e-113 337 50 1 347 3 aroC Chorismate synthase Desulfatibacillum aliphaticivorans
A8ZT68 3.96e-113 336 53 2 349 3 aroC Chorismate synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q5N2I0 9.8e-113 335 49 2 359 3 aroC Chorismate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q7M841 1.18e-112 335 50 2 352 3 aroC Chorismate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7VIA8 1.31e-112 335 50 1 344 3 aroC Chorismate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8TT87 1.8e-112 335 50 5 357 3 aroC Chorismate synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q110N5 2.22e-112 335 50 2 358 3 aroC Chorismate synthase Trichodesmium erythraeum (strain IMS101)
A8Z5Z2 3.17e-112 334 47 4 354 3 aroC Chorismate synthase Karelsulcia muelleri (strain GWSS)
A6Q1H1 1.54e-111 332 52 1 342 3 aroC Chorismate synthase Nitratiruptor sp. (strain SB155-2)
A3PAU4 2.62e-111 332 48 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9301)
Q04XD2 2.68e-111 332 48 2 356 3 aroC Chorismate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04W40 2.68e-111 332 48 2 356 3 aroC Chorismate synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A2BUK4 3.26e-111 332 48 2 357 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9515)
A8G2N2 3.56e-111 331 48 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9215)
P46894 4.77e-111 331 47 2 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A2BP22 5.1e-111 331 49 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain AS9601)
A5GIL9 6.4e-111 331 47 2 359 3 aroC Chorismate synthase Synechococcus sp. (strain WH7803)
P27793 8.53e-111 333 48 4 371 1 None Chorismate synthase, chloroplastic Capnoides sempervirens
Q8F9N4 2.28e-110 330 47 2 356 3 aroC Chorismate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72W01 2.28e-110 330 47 2 356 3 aroC Chorismate synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q12X75 2.5e-110 329 50 5 355 3 aroC Chorismate synthase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A8EV89 3.85e-110 328 50 1 342 3 aroC Chorismate synthase Aliarcobacter butzleri (strain RM4018)
Q6MCU1 6.22e-110 328 48 7 364 3 aroC Chorismate synthase Protochlamydia amoebophila (strain UWE25)
Q31CV7 7.33e-110 328 48 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9312)
O29587 1.22e-109 327 51 5 351 3 aroC Chorismate synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7V364 1.89e-109 327 48 2 360 3 aroC Chorismate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
E0TIQ1 3.32e-109 326 42 1 346 3 aroC Chorismate synthase Zinderia insecticola (strain CARI)
Q64PP7 5.42e-109 325 47 3 353 3 aroC Chorismate synthase Bacteroides fragilis (strain YCH46)
Q42885 5.7e-109 328 48 3 362 2 CS2 Chorismate synthase 2, chloroplastic Solanum lycopersicum
A9BDJ2 5.85e-109 326 48 2 358 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9211)
Q5L9G0 1.06e-108 325 47 3 353 3 aroC Chorismate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q2LUC8 3.72e-108 323 49 2 351 3 aroC Chorismate synthase Syntrophus aciditrophicus (strain SB)
P57720 3.78e-108 326 48 3 361 2 EMB1144 Chorismate synthase, chloroplastic Arabidopsis thaliana
Q8PW84 4.33e-108 323 51 5 357 3 aroC Chorismate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q42884 8.66e-108 325 48 3 362 2 CS1 Chorismate synthase 1, chloroplastic Solanum lycopersicum
Q8A602 5.17e-107 320 46 3 350 3 aroC Chorismate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6AIP3 1.26e-106 320 47 2 353 3 aroC Chorismate synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q30XS4 2.06e-106 319 54 2 353 3 aroC Chorismate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0ID82 2.29e-106 319 49 2 359 3 aroC Chorismate synthase Synechococcus sp. (strain CC9311)
Q58575 2.35e-106 320 46 4 365 3 aroC Chorismate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B9KE09 3.58e-106 318 47 5 347 3 aroC Chorismate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A7H187 5.78e-106 318 46 2 346 3 aroC Chorismate synthase Campylobacter curvus (strain 525.92)
A2C058 4.23e-105 316 47 2 360 3 aroC Chorismate synthase Prochlorococcus marinus (strain NATL1A)
Q46HE7 4.37e-105 316 46 2 360 3 aroC Chorismate synthase Prochlorococcus marinus (strain NATL2A)
Q05FR1 1.07e-103 311 41 4 346 3 aroC Chorismate synthase Carsonella ruddii (strain PV)
P28777 1.3e-103 312 46 2 367 1 ARO2 Chorismate synthase ARO2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4JC74 6.06e-103 311 48 6 358 3 aroC Chorismate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q7U9F0 7.21e-103 310 48 3 360 3 aroC Chorismate synthase Parasynechococcus marenigrum (strain WH8102)
A7HZN6 8.76e-103 310 45 4 358 3 aroC Chorismate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A5GW34 9.08e-103 310 47 3 359 3 aroC Chorismate synthase Synechococcus sp. (strain RCC307)
C4ZAX1 1.77e-102 309 47 6 363 3 aroC Chorismate synthase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q8TXN1 2.37e-102 310 48 6 361 3 aroC Chorismate synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B8J4Q3 6.54e-102 308 52 5 346 3 aroC Chorismate synthase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q7V4Y9 2.84e-101 306 46 3 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9313)
A2CCA2 2.84e-101 306 46 3 359 3 aroC Chorismate synthase Prochlorococcus marinus (strain MIT 9303)
Q3AMV2 1.03e-100 305 47 3 361 3 aroC Chorismate synthase Synechococcus sp. (strain CC9605)
Q9ZLH1 1.35e-100 304 45 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain J99 / ATCC 700824)
P56122 1.8e-100 304 45 2 348 1 aroC Chorismate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
B0SRH8 1.96e-100 305 46 3 359 3 aroC Chorismate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SHV8 1.96e-100 305 46 3 359 3 aroC Chorismate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B5Z736 1.98e-100 304 45 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain G27)
A6UUV1 2.88e-100 304 43 4 364 3 aroC Chorismate synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q3AUR6 4.72e-100 303 47 3 361 3 aroC Chorismate synthase Synechococcus sp. (strain CC9902)
Q96Y94 1.2e-99 303 47 6 357 3 aroC Chorismate synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A8Z6F5 1.44e-99 301 49 2 342 3 aroC Chorismate synthase Campylobacter concisus (strain 13826)
B3DXL0 1.68e-99 301 46 7 363 3 aroC Chorismate synthase Methylacidiphilum infernorum (isolate V4)
Q17XJ5 5.49e-99 300 44 2 348 3 aroC Chorismate synthase Helicobacter acinonychis (strain Sheeba)
B6JLQ1 6.53e-99 300 44 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain P12)
B6YRU6 9.53e-99 299 46 4 351 3 aroC Chorismate synthase Azobacteroides pseudotrichonymphae genomovar. CFP2
B2UTG3 1.25e-98 299 44 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain Shi470)
A8A9W1 1.78e-98 300 50 8 359 3 aroC Chorismate synthase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q1CTK7 1.02e-97 297 44 2 348 3 aroC Chorismate synthase Helicobacter pylori (strain HPAG1)
O74413 1.22e-97 298 43 3 385 3 SPCC1223.14 Chorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5UNA1 1.95e-97 296 49 4 352 3 aroC Chorismate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A6UPX8 3.94e-97 296 43 6 367 3 aroC Chorismate synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A1W1N6 1.75e-96 294 45 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B2UNJ5 2.38e-96 293 45 4 357 3 aroC Chorismate synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
C3MZF2 2.47e-96 295 46 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.16.27)
C3N7H4 2.5e-96 295 46 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MXK6 2.5e-96 295 46 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MRB7 2.5e-96 295 46 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KIN2 2.5e-96 295 46 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q980I7 7.14e-96 293 45 5 356 3 aroC Chorismate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9PM41 7.75e-96 292 45 5 347 1 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
C3NG02 8.05e-96 293 45 5 356 3 aroC Chorismate synthase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q5HSF9 9.74e-96 292 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni (strain RM1221)
A7H5Y1 1.05e-95 292 45 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q7MV04 1.33e-95 292 47 5 360 3 aroC Chorismate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A9KQX0 2.6e-95 291 48 7 343 3 aroC Chorismate synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A8FNU6 4.8e-95 290 44 5 347 3 aroC Chorismate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q12640 1.01e-93 289 42 7 405 1 aro-2 Chorismate synthase aro-2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
C5A782 4.35e-93 285 45 7 350 3 aroC Chorismate synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q2NGS6 1.84e-92 284 44 5 357 3 aroC Chorismate synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q9HJY7 2.92e-92 283 45 5 348 3 aroC Chorismate synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A4YHW1 2.27e-91 281 46 6 367 3 aroC Chorismate synthase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
B0BC02 2.29e-90 278 46 9 359 3 aroC Chorismate synthase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7T7 2.29e-90 278 46 9 359 3 aroC Chorismate synthase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q3ZZI6 3.9e-90 278 44 6 355 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain CBDB1)
Q5JFT4 5.35e-90 277 44 9 350 3 aroC Chorismate synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q3KLY8 6.01e-90 277 46 9 359 3 aroC Chorismate synthase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A5FS06 7.07e-90 277 44 6 355 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q9V1H0 8.89e-90 276 46 9 351 3 aroC Chorismate synthase Pyrococcus abyssi (strain GE5 / Orsay)
O84373 1.01e-89 276 46 9 359 3 aroC Chorismate synthase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q5L5F2 1.17e-88 274 44 8 361 3 aroC Chorismate synthase Chlamydia abortus (strain DSM 27085 / S26/3)
Q255H5 4.42e-88 272 45 8 359 3 aroC Chorismate synthase Chlamydia felis (strain Fe/C-56)
Q18F10 1.14e-87 272 45 5 356 3 aroC Chorismate synthase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q822F8 2.1e-87 270 45 8 361 3 aroC Chorismate synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q73NM0 1.22e-86 268 42 7 373 3 aroC Chorismate synthase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
O26843 1.51e-85 266 50 4 356 3 aroC Chorismate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q97AR9 2.06e-85 266 42 7 349 3 aroC Chorismate synthase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q9PK26 2.42e-85 265 46 9 363 3 aroC Chorismate synthase Chlamydia muridarum (strain MoPn / Nigg)
Q6LXL7 3.76e-85 265 42 4 363 3 aroC Chorismate synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VGS0 5.67e-85 265 42 6 365 3 aroC Chorismate synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A3DDD8 1.74e-84 264 44 9 392 3 aroC Chorismate synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9YEL4 2.88e-84 263 46 7 348 3 aroC Chorismate synthase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
B9LMX0 1.02e-83 262 42 5 366 3 aroC Chorismate synthase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q3Z993 1.52e-82 258 42 6 355 3 aroC Chorismate synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q9Z6M2 1.82e-82 258 45 6 357 3 aroC Chorismate synthase Chlamydia pneumoniae
C7PC56 5.36e-82 256 43 8 346 3 aroC Chorismate synthase Chitinophaga pinensis (strain ATCC 43595 / DSM 2588 / LMG 13176 / NBRC 15968 / NCIMB 11800 / UQM 2034)
B1L5G9 7.72e-82 256 44 6 358 3 aroC Chorismate synthase Korarchaeum cryptofilum (strain OPF8)
E3PV41 3.14e-81 255 40 7 357 3 aroC Chorismate synthase Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
A8MC69 6.5e-81 254 41 4 354 3 aroC Chorismate synthase Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A4FWK1 5.45e-80 252 41 4 363 3 aroC Chorismate synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q5V5K5 2.07e-78 249 43 4 356 3 aroC Chorismate synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q6MHP7 6.69e-77 243 39 7 354 3 aroC Chorismate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C7NZH8 4.2e-76 243 42 6 372 3 aroC Chorismate synthase Halomicrobium mukohataei (strain ATCC 700874 / DSM 12286 / JCM 9738 / NCIMB 13541)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_04915
Feature type CDS
Gene aroC
Product chorismate synthase
Location 32760 - 33848 (strand: 1)
Length 1089 (nucleotides) / 362 (amino acids)
In genomic island -

Contig

Accession ZDB_682
Length 259781 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1965
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01264 Chorismate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0082 Amino acid transport and metabolism (E) E Chorismate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MAGNSIGELFRVTTFGESHGPALGCIVDGVPPGLALTEADMQADLDRRRPGTSRYTTQRREPDQVRILSGVFEGKTTGTSIGLLIENTDQRSQDYGAIKDLFRPGHADYTYEQKYGFRDYRGGGRSSARETAMRVAAGAIAKKYLHEKFGVTVRACLTQMGDIKCDIRDWALAEQNPFFCPDERQLDALDELLRGLKKEGDSIGAKVTVVAENVPAGLGEPVFDRLDADLAHALMSINAVKGVEIGDGFGVVNLKGSENRDEIYQTGFTGNHAGGILGGISSGQPIIAHIALKPTSSITVPGNTLNRQGEEVAMITKGRHDPCVGIRAVPIAEAMTAIVLLDHLLRHRGQCADVTPPLPAWS

Flanking regions ( +/- flanking 50bp)

AAACAGGTTAAAACCATTCACTTGCACACAATCAGAGACAGGAAAACACGATGGCCGGAAACAGTATCGGCGAACTCTTTCGCGTAACCACCTTTGGTGAATCACACGGCCCGGCGCTGGGTTGTATTGTTGACGGCGTACCGCCGGGACTGGCGCTGACTGAAGCCGATATGCAGGCAGATCTTGACCGCCGCCGTCCGGGCACATCCCGCTATACCACGCAGCGCCGTGAGCCGGACCAGGTCAGAATTCTGTCAGGGGTATTTGAAGGAAAAACCACCGGAACCAGTATCGGGCTGCTGATTGAAAATACCGATCAGCGCTCACAGGATTACGGTGCCATCAAAGATCTCTTCCGGCCGGGACACGCGGATTACACCTATGAGCAGAAGTACGGCTTTCGTGACTACCGCGGCGGCGGCCGCTCATCAGCCCGTGAAACGGCGATGCGCGTGGCAGCCGGGGCTATCGCCAAAAAGTACCTGCATGAGAAATTCGGTGTGACAGTCCGTGCCTGTCTGACTCAGATGGGGGATATCAAATGTGATATCCGCGACTGGGCACTGGCAGAGCAAAATCCGTTTTTCTGTCCTGATGAACGTCAGCTGGATGCGCTGGATGAATTATTGCGCGGCCTGAAAAAAGAGGGAGATTCCATCGGTGCGAAAGTCACGGTAGTGGCGGAAAACGTCCCGGCGGGTCTGGGTGAACCGGTCTTTGATCGTCTGGATGCGGATCTGGCGCATGCGCTGATGAGCATCAACGCGGTGAAAGGCGTCGAAATCGGGGACGGATTCGGTGTGGTTAACCTCAAAGGCAGCGAAAACCGGGATGAAATTTATCAGACCGGCTTTACCGGCAATCACGCGGGCGGCATTCTCGGCGGCATCAGCAGCGGCCAGCCAATCATCGCGCATATTGCCCTGAAACCGACATCATCGATTACTGTTCCCGGTAATACGCTGAACCGGCAGGGCGAAGAGGTGGCTATGATCACCAAAGGGCGTCATGACCCCTGTGTCGGGATACGTGCTGTGCCGATTGCCGAAGCAATGACAGCGATTGTGCTGCTCGATCACCTTCTGCGTCACCGCGGACAATGTGCGGATGTCACGCCGCCGTTACCGGCCTGGTCATGATTTAAACAGACGTCCCGGGTATTGCGCCCGGGATTTTATTGGCAGGTAAA