Homologs in group_224

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00500 FBDBKF_00500 77.7 Morganella morganii S1 putP sodium/proline symporter PutP
EHELCC_01045 EHELCC_01045 77.7 Morganella morganii S2 putP sodium/proline symporter PutP
NLDBIP_02415 NLDBIP_02415 77.7 Morganella morganii S4 putP sodium/proline symporter PutP
LHKJJB_03930 LHKJJB_03930 77.7 Morganella morganii S3 putP sodium/proline symporter PutP
HKOGLL_03115 HKOGLL_03115 77.7 Morganella morganii S5 putP sodium/proline symporter PutP
F4V73_RS06510 F4V73_RS06510 78.1 Morganella psychrotolerans putP sodium/proline symporter PutP
PMI_RS18035 PMI_RS18035 27.8 Proteus mirabilis HI4320 panF sodium/pantothenate symporter

Distribution of the homologs in the orthogroup group_224

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_224

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07117 0.0 736 74 0 493 1 putP Sodium/proline symporter Escherichia coli (strain K12)
P10502 0.0 731 73 0 493 1 putP Sodium/proline symporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45174 0.0 617 61 2 498 3 putP Sodium/proline symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94392 4.26e-172 496 52 3 478 1 putP High-affinity proline transporter PutP Bacillus subtilis (strain 168)
O06493 8.15e-166 480 50 2 485 1 opuE Osmoregulated proline transporter OpuE Bacillus subtilis (strain 168)
Q49YU6 6.78e-154 451 47 7 494 3 putP2 Sodium/proline symporter 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A070 1.05e-150 442 48 6 481 3 putP1 Sodium/proline symporter 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A0H2 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain MW2)
Q6G831 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain MSSA476)
Q7A4Q7 3.23e-148 436 47 6 498 1 putP Sodium/proline symporter Staphylococcus aureus (strain N315)
Q99SY5 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEM0 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain COL)
A5IU69 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH9)
Q2FWY7 3.23e-148 436 47 6 498 1 putP Sodium/proline symporter Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U307 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH1)
A7X430 3.23e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z2R6 4.67e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300 / TCH1516)
Q2FFJ3 4.67e-148 436 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300)
Q5HN32 7.06e-148 435 47 8 495 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YU74 1.53e-147 434 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q53584 2.26e-147 434 46 5 497 3 putP Sodium/proline symporter Staphylococcus aureus
A6QID0 4.15e-147 433 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain Newman)
Q8CNP2 4.57e-147 433 47 8 495 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GFF5 6.2e-147 433 47 6 498 3 putP Sodium/proline symporter Staphylococcus aureus (strain MRSA252)
Q4L7L6 1.19e-146 432 47 5 497 3 putP Sodium/proline symporter Staphylococcus haemolyticus (strain JCSC1435)
P23723 8e-62 202 64 0 148 2 putP Sodium/proline symporter (Fragment) Klebsiella oxytoca
P44963 1.61e-41 158 27 9 487 3 panF Sodium/pantothenate symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7LMN9 9.85e-33 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Z1C8 9.85e-33 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5T7 9.85e-33 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7
B7NG10 1.02e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R3J9 1.25e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain UTI89 / UPEC)
A1AIQ8 1.25e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O1:K1 / APEC
B7MSH6 1.25e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O81 (strain ED1a)
B7MJT5 1.25e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPN5 1.25e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LPN2 1.53e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain SMS-3-5 / SECEC)
Q0T9Y2 1.53e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSM7 1.53e-32 134 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8A7G7 2.09e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O9:H4 (strain HS)
B7M7Y0 2.09e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O8 (strain IAI1)
B6I5T5 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain SE11)
P32705 2.15e-32 133 28 8 452 1 actP Cation/acetate symporter ActP Escherichia coli (strain K12)
B1IUI4 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCV3 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / DH10B)
C5A160 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / MC4100 / BW2952)
B7LB16 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli (strain 55989 / EAEC)
A7ZUU1 2.15e-32 133 28 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O139:H28 (strain E24377A / ETEC)
B5R937 2.92e-32 133 28 8 453 3 actP Cation/acetate symporter ActP Salmonella gallinarum (strain 287/91 / NCTC 13346)
C6D930 2.94e-32 133 26 8 454 3 actP Cation/acetate symporter ActP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4T1W9 2.98e-32 133 28 8 453 3 actP Cation/acetate symporter ActP Salmonella newport (strain SL254)
B5QZ97 2.98e-32 133 28 8 453 3 actP Cation/acetate symporter ActP Salmonella enteritidis PT4 (strain P125109)
B5FRF0 2.98e-32 133 28 8 453 3 actP Cation/acetate symporter ActP Salmonella dublin (strain CT_02021853)
A9MGK8 2.98e-32 133 28 8 453 3 actP Cation/acetate symporter ActP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q57GV4 3.15e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella choleraesuis (strain SC-B67)
Q8ZKF8 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRK2 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella schwarzengrund (strain CVM19633)
B5BJZ5 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain AKU_12601)
A9N1R2 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ05 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TEB2 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella heidelberg (strain SL476)
B5F2E9 3.21e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella agona (strain SL483)
C0Q552 3.28e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella paratyphi C (strain RKS4594)
Q3YUR7 4.45e-32 132 28 8 452 3 actP Cation/acetate symporter ActP Shigella sonnei (strain Ss046)
Q83P94 6.05e-32 132 28 8 452 3 actP Cation/acetate symporter ActP Shigella flexneri
Q8Z1R2 6.41e-32 132 28 8 453 3 actP Cation/acetate symporter ActP Salmonella typhi
Q31TS7 7.4e-32 132 27 8 452 3 actP Cation/acetate symporter ActP Shigella boydii serotype 4 (strain Sb227)
Q8FAZ0 7.47e-32 132 27 8 452 3 actP Cation/acetate symporter ActP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8AN31 9.87e-32 131 28 8 453 3 actP Cation/acetate symporter ActP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2TXA0 3.17e-31 130 27 8 452 3 actP Cation/acetate symporter ActP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6D913 4.17e-31 129 26 8 454 3 actP Cation/acetate symporter ActP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P16256 4.69e-31 128 25 10 459 1 panF Sodium/pantothenate symporter Escherichia coli (strain K12)
B2VKE4 2.67e-30 127 27 8 454 3 actP Cation/acetate symporter ActP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4W5I3 5.9e-30 126 27 8 453 3 actP Cation/acetate symporter ActP Enterobacter sp. (strain 638)
A4TS08 3.03e-29 124 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pestis (strain Pestoides F)
Q1CE35 3.03e-29 124 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R563 3.03e-29 124 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ73 3.03e-29 124 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pestis
Q1C0M8 3.03e-29 124 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Antiqua)
A1JIK1 7.08e-29 123 26 8 454 3 actP Cation/acetate symporter ActP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FNG3 2.02e-28 122 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNK6 2.03e-28 122 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN0 2.03e-28 122 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K137 2.03e-28 122 25 8 454 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q7NA72 3.72e-27 118 25 13 511 3 actP Cation/acetate symporter ActP Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6TGZ7 1.08e-26 116 26 8 453 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XXT7 1.08e-26 116 26 8 453 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae (strain 342)
P39599 1.29e-26 116 30 14 443 3 ywcA Uncharacterized symporter YwcA Bacillus subtilis (strain 168)
P96169 6.88e-19 93 23 17 491 1 sglT Sodium/glucose cotransporter Vibrio parahaemolyticus
O07556 6.88e-15 80 22 15 466 3 yhjB Uncharacterized symporter YhjB Bacillus subtilis (strain 168)
Q7SYH5 4.59e-14 78 23 8 376 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus laevis
O34745 8.65e-14 77 23 17 496 2 yodF Uncharacterized symporter YodF Bacillus subtilis (strain 168)
Q92911 2.33e-13 76 22 8 368 1 SLC5A5 Sodium/iodide cotransporter Homo sapiens
Q5BL81 2.91e-13 75 23 8 376 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus tropicalis
Q8N695 4.5e-13 75 24 11 374 1 SLC5A8 Sodium-coupled monocarboxylate transporter 1 Homo sapiens
P26429 4.92e-13 75 23 10 403 2 SLC5A1 Sodium/glucose cotransporter 1 (Fragment) Sus scrofa
Q63008 1.39e-12 73 23 10 367 1 Slc5a5 Sodium/iodide cotransporter Rattus norvegicus
P11170 2.1e-12 73 23 13 498 1 SLC5A1 Sodium/glucose cotransporter 1 Oryctolagus cuniculus
Q91ZP4 5.74e-12 71 23 12 395 2 Slc5a4b Solute carrier family 5 member 4B Mus musculus
P31637 6.17e-12 71 23 20 549 1 SLC5A3 Sodium/myo-inositol cotransporter Canis lupus familiaris
Q9JKZ2 8.75e-12 71 23 18 548 1 Slc5a3 Sodium/myo-inositol cotransporter Mus musculus
Q9NY91 9.61e-12 71 22 10 392 1 SLC5A4 Probable glucose sensor protein SLC5A4 Homo sapiens
Q8NS49 1.79e-11 70 22 16 470 1 mctC Monocarboxylic acid transporter Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5E733 1.82e-11 69 22 18 514 3 nanT Sodium/sialic acid symporter NanT Aliivibrio fischeri (strain ATCC 700601 / ES114)
P53793 4.04e-11 69 23 16 492 3 SLC5A3 Sodium/myo-inositol cotransporter Bos taurus
Q8BYF6 7.58e-11 68 23 11 382 1 Slc5a8 Sodium-coupled monocarboxylate transporter 1 Mus musculus
Q99PN0 8.95e-11 67 22 10 369 1 Slc5a5 Sodium/iodide cotransporter Mus musculus
Q3ZMH1 2.67e-10 66 21 16 436 1 slc5a8 Sodium-coupled monocarboxylate transporter 1 Danio rerio
P53791 4.68e-10 65 24 14 379 2 SLC5A1 Sodium/glucose cotransporter 1 Ovis aries
D3ZIS0 5.86e-10 65 21 11 396 3 Slc5a4 Solute carrier family 5 member 4 Rattus norvegicus
A7MBD8 6.56e-10 65 23 15 440 2 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Bos taurus
P53794 9.73e-10 64 22 21 550 1 SLC5A3 Sodium/myo-inositol cotransporter Homo sapiens
Q8C3K6 1.33e-09 64 23 10 376 1 Slc5a1 Sodium/glucose cotransporter 1 Mus musculus
P13866 2.65e-09 63 22 10 367 1 SLC5A1 Sodium/glucose cotransporter 1 Homo sapiens
P53790 4.4e-09 62 24 11 376 2 Slc5a1 Sodium/glucose cotransporter 1 Rattus norvegicus
A8WHP3 9.4e-09 61 20 11 377 2 slc5a9 Sodium/glucose cotransporter 4 Danio rerio
Q2M3M2 2.08e-08 60 21 11 368 1 SLC5A9 Sodium/glucose cotransporter 4 Homo sapiens
Q8VDT1 2.61e-08 60 20 11 368 1 Slc5a9 Sodium/glucose cotransporter 4 Mus musculus
Q49B93 3.42e-08 59 21 14 439 1 Slc5a12 Sodium-coupled monocarboxylate transporter 2 Mus musculus
P31640 8.14e-08 58 24 2 177 3 H16_A2524 Uncharacterized symporter H16_A2524 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1EHB4 1.13e-07 58 21 15 444 1 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Homo sapiens
O02228 1.77e-07 57 23 9 372 2 cho-1 High-affinity choline transporter 1 Caenorhabditis elegans
Q9ET37 1.95e-07 57 21 11 393 1 Slc5a4a Solute carrier family 5 member 4A Mus musculus
Q5SWY8 3.27e-07 56 19 13 389 1 Slc5a10 Sodium/mannose cotransporter SLC5A10 Mus musculus
Q9GZV3 3.39e-07 56 24 10 407 1 SLC5A7 High affinity choline transporter 1 Homo sapiens
Q8BGY9 8.31e-07 55 23 12 411 1 Slc5a7 High affinity choline transporter 1 Mus musculus
Q9URY6 9.85e-07 55 25 11 299 3 dur3-3 Probable urea active transporter 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5FY69 1.43e-06 54 20 13 382 2 SLC5A10 Sodium/mannose cotransporter SLC5A10 Sus scrofa
Q8UWF0 2.72e-06 53 22 8 392 2 CHT1 High-affinity choline transporter 1 Torpedo marmorata
Q9JMD7 3.01e-06 53 23 12 411 1 Slc5a7 High affinity choline transporter 1 Rattus norvegicus
A0PJK1 6.22e-06 52 20 11 374 1 SLC5A10 Sodium/mannose cotransporter SLC5A10 Homo sapiens
P31448 1.11e-05 51 22 13 421 1 yidK Uncharacterized symporter YidK Escherichia coli (strain K12)
Q9XT77 1.13e-05 51 21 16 451 2 SLC5A6 Sodium-dependent multivitamin transporter Oryctolagus cuniculus
Q7T384 1.22e-05 51 20 15 434 1 slc5a12 Sodium-coupled monocarboxylate transporter 2 Danio rerio
B4EZY7 5.14e-05 49 21 7 305 1 siaT Sodium/sialic acid symporter SiaT Proteus mirabilis (strain HI4320)
Q8K0E3 5.24e-05 49 22 12 363 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Mus musculus
P31636 5.38e-05 49 32 3 122 1 SLC5A4 Solute carrier family 5 member 4 Sus scrofa
Q9VE46 5.9e-05 49 20 10 399 2 ChT High-affinity choline transporter 1 Drosophila melanogaster
Q9Y289 0.000134 48 19 13 421 1 SLC5A6 Sodium-dependent multivitamin transporter Homo sapiens
Q3ZC26 0.00022 47 21 11 358 2 SLC5A11 Sodium/myo-inositol cotransporter 2 Bos taurus
Q5U4D8 0.000233 47 19 13 379 1 Slc5a6 Sodium-dependent multivitamin transporter Mus musculus
Q28610 0.000424 46 21 12 374 2 SLC5A10 Sodium/mannose cotransporter SLC5A10 Oryctolagus cuniculus
Q9Z1F2 0.000504 46 22 12 363 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Rattus norvegicus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07890
Feature type CDS
Gene putP
Product sodium/proline symporter PutP
Location 1725788 - 1727272 (strand: -1)
Length 1485 (nucleotides) / 494 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_224
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00474 Sodium:solute symporter family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0591 Amino acid transport and metabolism (E) E Na+/proline symporter

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11928 sodium/proline symporter - -

Protein Sequence

MALNSPMLITFTIYILGMLFIGYLAYRSTKNFDDYILGGRRLGSVVTALSAGASDMSGWLLMGLPGVVFFAGISESWIAIGLCLGAWLNWRLVAGRLRLQTEKNNNALTLPDYLTSRFDDKSKMLRIISALVILIFFTIYCASGVVAGGMLFESTFGIPYHEAMIYGALATIAYTFLGGFLAVSWTDTVQATLMIFALILTPIIVIFSIGGIDTSIEIIKAKDPAYLDMFKGLDFIAIVSLLAWGLGYFGQPHILARFMAADSNQTIRKARRIGMTWMILCLGGTVAVGFFGIAYFEVNPTVAGPVMAKNERIFMELASLLFNPWIAGILLSAILAAVMSTLSCQLLVCASALTEDLYKPFIRKNASQKELVWVGRGMVLLVAVIAIYLARDPENKVLDLVSNAWAGFGAAFGPVILISVTWKRMTRNGAFAGMLIGALTVLVWMQYKWFGLYEIIPGFIFASIAIVIVSLMGKSPTAENQQRFDEAEAEYRNT

Flanking regions ( +/- flanking 50bp)

AGTTGAAAGCATAGCAATTGATCGTAACAGATATATGGAGAACTGCGATTATGGCTCTAAATTCGCCAATGCTAATTACCTTTACGATCTATATATTGGGGATGCTTTTTATCGGCTATCTAGCGTATCGATCAACAAAAAATTTTGATGATTATATTTTAGGGGGCCGAAGGCTTGGTAGTGTAGTAACGGCACTTTCTGCGGGCGCTTCTGATATGAGTGGCTGGCTATTAATGGGATTACCAGGTGTGGTTTTTTTTGCGGGGATCTCCGAAAGTTGGATAGCCATTGGTTTATGTTTAGGTGCATGGCTTAACTGGCGTTTAGTTGCAGGGCGATTACGTTTACAAACAGAAAAAAACAATAATGCACTGACTCTACCAGACTATTTAACTTCTCGCTTTGATGACAAAAGCAAAATGCTACGCATTATTTCTGCGTTAGTTATTCTTATTTTCTTCACTATTTATTGTGCATCAGGTGTCGTCGCAGGAGGTATGCTTTTTGAGTCTACCTTTGGCATTCCTTATCATGAAGCGATGATTTATGGTGCACTAGCAACCATTGCATATACTTTCCTAGGTGGTTTTTTGGCGGTAAGTTGGACGGATACGGTACAAGCCACATTAATGATTTTCGCACTTATTCTGACACCAATTATTGTTATTTTCTCAATTGGTGGAATTGACACCTCTATAGAGATCATTAAAGCGAAAGATCCGGCTTATCTTGATATGTTTAAAGGGCTTGATTTTATTGCTATTGTTTCATTATTAGCTTGGGGATTAGGTTATTTTGGACAGCCTCATATTCTCGCGCGTTTTATGGCTGCAGATTCAAATCAAACTATTCGTAAAGCGCGCCGTATTGGTATGACTTGGATGATCCTCTGTTTAGGCGGAACGGTGGCGGTGGGCTTCTTTGGTATTGCTTATTTTGAAGTTAATCCGACCGTTGCAGGTCCGGTTATGGCTAAAAATGAGCGTATCTTTATGGAATTAGCTTCGTTACTTTTTAACCCGTGGATAGCTGGTATTTTGTTATCTGCGATTTTAGCTGCGGTAATGAGTACGTTAAGCTGCCAATTATTAGTCTGCGCCAGTGCATTAACTGAAGATTTATATAAGCCTTTTATTCGTAAAAATGCCAGTCAAAAAGAGCTAGTTTGGGTTGGTCGTGGCATGGTGTTATTAGTTGCGGTTATCGCTATTTATTTAGCCCGTGATCCAGAAAATAAAGTACTTGATTTGGTGAGTAATGCTTGGGCAGGATTTGGTGCTGCATTTGGTCCGGTGATCCTTATCTCTGTCACTTGGAAACGTATGACTCGTAATGGTGCTTTTGCGGGAATGTTAATTGGTGCATTAACGGTACTGGTATGGATGCAATATAAATGGTTCGGTCTTTATGAAATTATTCCGGGCTTTATTTTCGCGTCCATAGCCATTGTTATTGTCAGTTTAATGGGTAAGTCACCAACGGCAGAAAATCAACAACGTTTTGATGAAGCAGAAGCGGAATATCGTAACACTTAATTATTAATAAGCAGTAAGATTTTATTTAATGAAATACCATCTATATAAGA