Homologs in group_224

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00500 FBDBKF_00500 100.0 Morganella morganii S1 putP sodium/proline symporter PutP
EHELCC_01045 EHELCC_01045 100.0 Morganella morganii S2 putP sodium/proline symporter PutP
NLDBIP_02415 NLDBIP_02415 100.0 Morganella morganii S4 putP sodium/proline symporter PutP
HKOGLL_03115 HKOGLL_03115 100.0 Morganella morganii S5 putP sodium/proline symporter PutP
F4V73_RS06510 F4V73_RS06510 92.3 Morganella psychrotolerans putP sodium/proline symporter PutP
PMI_RS07890 PMI_RS07890 77.7 Proteus mirabilis HI4320 putP sodium/proline symporter PutP
PMI_RS18035 PMI_RS18035 27.2 Proteus mirabilis HI4320 panF sodium/pantothenate symporter

Distribution of the homologs in the orthogroup group_224

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_224

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P10502 0.0 727 73 1 491 1 putP Sodium/proline symporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07117 0.0 721 73 1 491 1 putP Sodium/proline symporter Escherichia coli (strain K12)
P45174 0.0 612 61 3 495 3 putP Sodium/proline symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94392 2.47e-169 489 51 3 473 1 putP High-affinity proline transporter PutP Bacillus subtilis (strain 168)
O06493 1.6e-165 480 48 4 497 1 opuE Osmoregulated proline transporter OpuE Bacillus subtilis (strain 168)
Q4A070 2.87e-154 452 48 6 480 3 putP1 Sodium/proline symporter 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49YU6 2.52e-152 447 46 7 494 3 putP2 Sodium/proline symporter 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HN32 9.52e-149 438 47 7 485 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CNP2 1.95e-148 437 47 6 484 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A0H2 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain MW2)
Q6G831 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain MSSA476)
Q7A4Q7 2.45e-144 426 46 7 489 1 putP Sodium/proline symporter Staphylococcus aureus (strain N315)
Q99SY5 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEM0 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain COL)
A5IU69 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH9)
Q2FWY7 2.45e-144 426 46 7 489 1 putP Sodium/proline symporter Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U307 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH1)
A7X430 2.45e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L7L6 3.86e-144 426 48 6 481 3 putP Sodium/proline symporter Staphylococcus haemolyticus (strain JCSC1435)
A8Z2R6 3.95e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300 / TCH1516)
Q2FFJ3 3.95e-144 426 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300)
Q2YU74 9.93e-144 425 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q53584 1.48e-143 424 45 6 488 3 putP Sodium/proline symporter Staphylococcus aureus
A6QID0 3.28e-143 424 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain Newman)
Q6GFF5 3.81e-143 424 46 7 489 3 putP Sodium/proline symporter Staphylococcus aureus (strain MRSA252)
P23723 4.94e-59 195 64 1 148 2 putP Sodium/proline symporter (Fragment) Klebsiella oxytoca
P44963 2.75e-40 154 27 10 493 3 panF Sodium/pantothenate symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7LMN9 4.38e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Z1C8 4.38e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5T7 4.38e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7
B7NG10 4.65e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LPN2 5.42e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain SMS-3-5 / SECEC)
Q0T9Y2 5.42e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSM7 5.42e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R3J9 5.48e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain UTI89 / UPEC)
A1AIQ8 5.48e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O1:K1 / APEC
B7MSH6 5.48e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O81 (strain ED1a)
B7MJT5 5.48e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPN5 5.48e-34 138 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I5T5 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain SE11)
P32705 8.8e-34 137 27 8 445 1 actP Cation/acetate symporter ActP Escherichia coli (strain K12)
B1IUI4 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCV3 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / DH10B)
C5A160 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / MC4100 / BW2952)
B7LB16 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli (strain 55989 / EAEC)
A7ZUU1 8.8e-34 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31TS7 1.21e-33 137 27 8 445 3 actP Cation/acetate symporter ActP Shigella boydii serotype 4 (strain Sb227)
A8A7G7 1.26e-33 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O9:H4 (strain HS)
B7M7Y0 1.26e-33 137 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O8 (strain IAI1)
Q3YUR7 2.04e-33 136 27 8 445 3 actP Cation/acetate symporter ActP Shigella sonnei (strain Ss046)
Q83P94 2.06e-33 136 27 8 445 3 actP Cation/acetate symporter ActP Shigella flexneri
Q8FAZ0 2.52e-33 136 27 8 445 3 actP Cation/acetate symporter ActP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
C6D930 5.29e-33 135 25 13 517 3 actP Cation/acetate symporter ActP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2TXA0 1.52e-32 134 26 8 445 3 actP Cation/acetate symporter ActP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8AN31 3.04e-32 133 27 6 445 3 actP Cation/acetate symporter ActP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D913 1.09e-31 131 26 8 451 3 actP Cation/acetate symporter ActP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5R937 2.73e-31 130 27 8 445 3 actP Cation/acetate symporter ActP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZ97 3.73e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella enteritidis PT4 (strain P125109)
B5FRF0 3.73e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella dublin (strain CT_02021853)
A9MGK8 3.73e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C0Q552 3.81e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella paratyphi C (strain RKS4594)
Q8ZKF8 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRK2 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella schwarzengrund (strain CVM19633)
B5BJZ5 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain AKU_12601)
A9N1R2 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ05 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TEB2 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella heidelberg (strain SL476)
B5F2E9 3.88e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella agona (strain SL483)
Q57GV4 3.95e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella choleraesuis (strain SC-B67)
B4T1W9 3.99e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella newport (strain SL254)
Q8Z1R2 6.94e-31 129 27 8 445 3 actP Cation/acetate symporter ActP Salmonella typhi
B2VKE4 1.12e-30 128 26 15 518 3 actP Cation/acetate symporter ActP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4W5I3 1.54e-28 122 25 9 447 3 actP Cation/acetate symporter ActP Enterobacter sp. (strain 638)
A1JIK1 5.34e-28 120 26 9 452 3 actP Cation/acetate symporter ActP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TGZ7 1.21e-27 119 26 8 445 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XXT7 1.21e-27 119 26 8 445 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae (strain 342)
A4TS08 3.68e-27 118 25 8 451 3 actP Cation/acetate symporter ActP Yersinia pestis (strain Pestoides F)
Q1CE35 3.68e-27 118 25 8 451 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R563 3.68e-27 118 25 8 451 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ73 3.68e-27 118 25 8 451 3 actP Cation/acetate symporter ActP Yersinia pestis
Q1C0M8 3.68e-27 118 25 8 451 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNG3 4.43e-27 117 25 9 452 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNK6 4.73e-27 117 25 9 452 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN0 4.73e-27 117 25 9 452 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K137 4.73e-27 117 25 9 452 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
P16256 7.36e-26 113 25 11 467 1 panF Sodium/pantothenate symporter Escherichia coli (strain K12)
Q7NA72 1.11e-25 114 25 8 446 3 actP Cation/acetate symporter ActP Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P39599 3.43e-20 97 25 11 446 3 ywcA Uncharacterized symporter YwcA Bacillus subtilis (strain 168)
P96169 1.42e-18 92 25 18 474 1 sglT Sodium/glucose cotransporter Vibrio parahaemolyticus
O07556 2.79e-17 87 23 13 447 3 yhjB Uncharacterized symporter YhjB Bacillus subtilis (strain 168)
Q9JKZ2 5.3e-16 84 23 19 562 1 Slc5a3 Sodium/myo-inositol cotransporter Mus musculus
P53794 9.33e-16 84 23 17 560 1 SLC5A3 Sodium/myo-inositol cotransporter Homo sapiens
P31637 2.91e-15 82 23 17 560 1 SLC5A3 Sodium/myo-inositol cotransporter Canis lupus familiaris
P53793 7.67e-15 80 23 14 504 3 SLC5A3 Sodium/myo-inositol cotransporter Bos taurus
Q9NY91 2.14e-14 79 21 13 490 1 SLC5A4 Probable glucose sensor protein SLC5A4 Homo sapiens
O34745 1.37e-13 76 24 18 510 2 yodF Uncharacterized symporter YodF Bacillus subtilis (strain 168)
Q8NS49 3.83e-13 75 25 19 489 1 mctC Monocarboxylic acid transporter Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P26429 6.51e-13 74 22 11 409 2 SLC5A1 Sodium/glucose cotransporter 1 (Fragment) Sus scrofa
P11170 1.28e-12 73 23 14 491 1 SLC5A1 Sodium/glucose cotransporter 1 Oryctolagus cuniculus
D3ZIS0 2.29e-12 73 21 13 493 3 Slc5a4 Solute carrier family 5 member 4 Rattus norvegicus
Q92911 2.99e-12 72 22 8 395 1 SLC5A5 Sodium/iodide cotransporter Homo sapiens
Q9ET37 1.24e-11 70 21 13 493 1 Slc5a4a Solute carrier family 5 member 4A Mus musculus
P13866 2.29e-11 70 22 12 381 1 SLC5A1 Sodium/glucose cotransporter 1 Homo sapiens
P53791 4.3e-11 68 22 11 387 2 SLC5A1 Sodium/glucose cotransporter 1 Ovis aries
O02228 9.22e-11 67 23 8 424 2 cho-1 High-affinity choline transporter 1 Caenorhabditis elegans
Q5E733 2.06e-10 66 22 16 461 3 nanT Sodium/sialic acid symporter NanT Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8C3K6 6.27e-10 65 22 10 384 1 Slc5a1 Sodium/glucose cotransporter 1 Mus musculus
P31636 1.08e-09 64 22 10 387 1 SLC5A4 Solute carrier family 5 member 4 Sus scrofa
P53790 1.35e-09 64 22 10 384 2 Slc5a1 Sodium/glucose cotransporter 1 Rattus norvegicus
Q63008 2.34e-09 63 20 11 441 1 Slc5a5 Sodium/iodide cotransporter Rattus norvegicus
A8WHP3 2.81e-09 63 20 10 373 2 slc5a9 Sodium/glucose cotransporter 4 Danio rerio
Q8BGY9 1.05e-08 61 25 10 376 1 Slc5a7 High affinity choline transporter 1 Mus musculus
Q8N695 1.1e-08 61 23 17 462 1 SLC5A8 Sodium-coupled monocarboxylate transporter 1 Homo sapiens
Q99PN0 2.03e-08 60 20 10 437 1 Slc5a5 Sodium/iodide cotransporter Mus musculus
Q5BL81 2.53e-08 60 23 12 423 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus tropicalis
Q91ZP4 2.83e-08 60 29 2 120 2 Slc5a4b Solute carrier family 5 member 4B Mus musculus
Q9JMD7 3.99e-08 59 25 10 372 1 Slc5a7 High affinity choline transporter 1 Rattus norvegicus
A0PJK1 6.06e-08 58 21 10 377 1 SLC5A10 Sodium/mannose cotransporter SLC5A10 Homo sapiens
Q7SYH5 2.29e-07 57 22 12 423 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus laevis
Q5SWY8 2.83e-07 57 19 9 377 1 Slc5a10 Sodium/mannose cotransporter SLC5A10 Mus musculus
Q8BYF6 2.94e-07 56 23 17 453 1 Slc5a8 Sodium-coupled monocarboxylate transporter 1 Mus musculus
Q8UWF0 3.21e-07 56 23 10 413 2 CHT1 High-affinity choline transporter 1 Torpedo marmorata
A7MBD8 5.67e-07 55 23 17 434 2 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Bos taurus
P31640 8.94e-07 55 24 3 183 3 H16_A2524 Uncharacterized symporter H16_A2524 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P31640 0.000282 47 29 0 87 3 H16_A2524 Uncharacterized symporter H16_A2524 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9GZV3 1.81e-06 54 24 11 404 1 SLC5A7 High affinity choline transporter 1 Homo sapiens
Q9URY6 2.47e-06 53 25 7 212 3 dur3-3 Probable urea active transporter 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P53792 4.8e-06 53 23 14 416 1 Slc5a2 Sodium/glucose cotransporter 2 Rattus norvegicus
Q1EHB4 8.29e-06 52 22 17 438 1 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Homo sapiens
Q8VDT1 9.28e-06 52 20 9 372 1 Slc5a9 Sodium/glucose cotransporter 4 Mus musculus
Q923I7 9.6e-06 52 23 14 416 1 Slc5a2 Sodium/glucose cotransporter 2 Mus musculus
Q3ZMH1 1.08e-05 51 21 14 434 1 slc5a8 Sodium-coupled monocarboxylate transporter 1 Danio rerio
Q9XT77 1.14e-05 51 21 17 447 2 SLC5A6 Sodium-dependent multivitamin transporter Oryctolagus cuniculus
Q9Y289 3.66e-05 50 21 14 361 1 SLC5A6 Sodium-dependent multivitamin transporter Homo sapiens
P31448 4.45e-05 49 20 10 396 1 yidK Uncharacterized symporter YidK Escherichia coli (strain K12)
P26430 8.88e-05 48 21 8 333 2 SLC5A2 Sodium/glucose cotransporter 2 Oryctolagus cuniculus
Q49B93 0.00016 48 22 15 439 1 Slc5a12 Sodium-coupled monocarboxylate transporter 2 Mus musculus
Q5U4D8 0.000169 48 20 13 367 1 Slc5a6 Sodium-dependent multivitamin transporter Mus musculus
Q8K0E3 0.000198 47 21 13 365 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Mus musculus
Q3ZC26 0.000389 47 21 11 360 2 SLC5A11 Sodium/myo-inositol cotransporter 2 Bos taurus
Q2M3M2 0.000405 47 24 2 114 1 SLC5A9 Sodium/glucose cotransporter 4 Homo sapiens
O70247 0.000438 46 20 19 443 1 Slc5a6 Sodium-dependent multivitamin transporter Rattus norvegicus
B4EZY7 0.000613 46 23 17 459 1 siaT Sodium/sialic acid symporter SiaT Proteus mirabilis (strain HI4320)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_03930
Feature type CDS
Gene putP
Product sodium/proline symporter PutP
Location 58168 - 59661 (strand: -1)
Length 1494 (nucleotides) / 497 (amino acids)

Contig

Accession ZDB_361
Length 286024 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_224
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00474 Sodium:solute symporter family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0591 Amino acid transport and metabolism (E) E Na+/proline symporter

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11928 sodium/proline symporter - -

Protein Sequence

MTMTLTTPLIVTFIVYIAGMLFIGYMAYRSTNNFDDYILGGRRMGSFVTALSAGASDMSGWLLMGLPGVVFFSGISESWIAIGLCIGAWLNWRIVAGRLRLQTEVNHALTLPDYFTQRFEDKSRVLRIVSAAVILIFFTIYCASGIVAGGLLFESTFGISYEKAMWLGAGATIAYTFLGGFLAVSWTDTVQATLMIFALILTPVMVIVSVGGFDTALAIIEAKSPAYVDMFRGLDIVAIISLLGWGLGYFGQPHILARFMAADSHHTIRSARRISMTWMILCLAGTICVGFFGIAFFQQNPELAGSVTENRERIFMSLTSILFNPWIAGILLSAILAAVMSTLSCQLLVSASALTEDIYKPFFRKNASQKEMVLVGRIMVLVIAAIAIYIAMDKNNKVLGLVSNAWAGFGAAFGPVILFSVIWKRMTRNGALAGMFTGAVTVLIWIEYKWFNLYEIIPGFILAGIAIVVVSLAGREPDKSVQGRFAEAEDRYLGRTE

Flanking regions ( +/- flanking 50bp)

ACGCAATGCTGATACGTGACGGACTATAAATTCAGTACAGGAACTTAATTATGACAATGACGCTGACCACACCGCTGATTGTGACATTTATTGTCTATATCGCCGGGATGCTGTTCATCGGCTATATGGCCTACCGCTCCACCAATAACTTCGACGACTATATTCTCGGCGGCCGCCGGATGGGCAGTTTTGTGACTGCATTATCCGCCGGTGCATCCGACATGAGCGGCTGGCTGCTGATGGGATTACCGGGTGTGGTTTTCTTCTCCGGTATTTCCGAATCCTGGATTGCCATCGGTCTGTGTATCGGTGCCTGGCTTAACTGGCGGATTGTTGCCGGTCGTCTGCGCCTTCAGACGGAAGTCAACCATGCGCTGACGCTGCCGGATTACTTTACGCAGCGTTTTGAGGATAAAAGCCGTGTTCTGCGGATTGTCTCTGCAGCCGTGATCCTGATTTTCTTCACCATTTACTGTGCTTCCGGCATCGTGGCCGGTGGTCTGCTGTTTGAAAGCACCTTCGGTATCAGTTATGAAAAAGCCATGTGGCTCGGGGCAGGGGCAACTATTGCCTATACCTTCCTCGGCGGGTTCCTGGCGGTAAGCTGGACAGATACCGTGCAGGCGACACTGATGATTTTCGCCCTGATCCTGACACCGGTTATGGTGATTGTGTCTGTCGGCGGGTTTGATACTGCACTGGCAATTATCGAAGCAAAAAGCCCGGCGTATGTGGATATGTTCCGCGGGCTGGATATTGTCGCGATTATCTCCCTGCTGGGCTGGGGATTGGGCTATTTCGGGCAGCCGCATATCCTGGCGCGCTTTATGGCGGCGGATTCTCATCACACCATCCGCAGTGCACGCCGTATCAGTATGACCTGGATGATCCTTTGCCTTGCGGGAACCATTTGTGTCGGTTTCTTCGGTATTGCCTTCTTCCAGCAGAACCCGGAACTGGCGGGCTCGGTGACTGAAAACCGCGAGCGGATTTTCATGAGCCTGACTTCTATCTTATTTAATCCGTGGATTGCCGGTATTCTGCTCTCTGCCATCCTGGCAGCGGTCATGAGTACCCTGAGCTGTCAGCTGCTGGTCAGTGCCAGTGCCCTGACGGAAGATATCTACAAACCGTTTTTCCGTAAGAATGCCTCACAGAAAGAGATGGTGCTGGTCGGGCGCATTATGGTGCTGGTGATTGCGGCGATCGCTATTTACATTGCGATGGATAAAAATAACAAAGTGCTGGGGCTGGTCAGTAACGCATGGGCCGGGTTCGGCGCAGCATTCGGGCCGGTTATCCTGTTCTCTGTTATCTGGAAGCGGATGACCCGTAACGGCGCACTGGCGGGGATGTTTACCGGCGCGGTGACGGTTCTTATCTGGATAGAATATAAGTGGTTTAATTTATATGAAATTATCCCGGGCTTTATTCTGGCCGGTATTGCTATTGTGGTGGTCAGCCTGGCAGGCCGTGAGCCGGACAAATCAGTTCAGGGACGTTTCGCTGAGGCGGAAGACCGTTACCTCGGACGGACTGAGTAACAGAGTATAAAAACAAAAATCCCGGCGTTGCCGGGATTTTTTTGTCCGCT