Homologs in group_224

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00500 FBDBKF_00500 27.2 Morganella morganii S1 putP sodium/proline symporter PutP
EHELCC_01045 EHELCC_01045 27.2 Morganella morganii S2 putP sodium/proline symporter PutP
NLDBIP_02415 NLDBIP_02415 27.2 Morganella morganii S4 putP sodium/proline symporter PutP
LHKJJB_03930 LHKJJB_03930 27.2 Morganella morganii S3 putP sodium/proline symporter PutP
HKOGLL_03115 HKOGLL_03115 27.2 Morganella morganii S5 putP sodium/proline symporter PutP
F4V73_RS06510 F4V73_RS06510 27.4 Morganella psychrotolerans putP sodium/proline symporter PutP
PMI_RS07890 PMI_RS07890 27.8 Proteus mirabilis HI4320 putP sodium/proline symporter PutP

Distribution of the homologs in the orthogroup group_224

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_224

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16256 0.0 735 78 1 480 1 panF Sodium/pantothenate symporter Escherichia coli (strain K12)
P44963 0.0 603 61 0 477 3 panF Sodium/pantothenate symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O06493 1.01e-44 166 28 12 491 1 opuE Osmoregulated proline transporter OpuE Bacillus subtilis (strain 168)
Q49YU6 7.55e-41 156 28 14 497 3 putP2 Sodium/proline symporter 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CNP2 3.3e-40 154 28 15 498 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN32 1.03e-39 153 28 15 498 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0H2 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain MW2)
Q6G831 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain MSSA476)
Q7A4Q7 3.36e-39 152 29 18 499 1 putP Sodium/proline symporter Staphylococcus aureus (strain N315)
Q99SY5 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEM0 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain COL)
A5IU69 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH9)
Q2FWY7 3.36e-39 152 29 18 499 1 putP Sodium/proline symporter Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U307 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH1)
A7X430 3.36e-39 152 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YU74 4.15e-39 151 29 17 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z2R6 5.65e-39 151 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300 / TCH1516)
Q2FFJ3 5.65e-39 151 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300)
Q53584 6.4e-39 150 29 16 492 3 putP Sodium/proline symporter Staphylococcus aureus
Q4L7L6 7.85e-39 150 29 17 498 3 putP Sodium/proline symporter Staphylococcus haemolyticus (strain JCSC1435)
Q6GFF5 2.12e-38 149 29 18 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain MRSA252)
A6QID0 3.22e-38 149 28 17 499 3 putP Sodium/proline symporter Staphylococcus aureus (strain Newman)
P94392 2.01e-34 137 28 11 455 1 putP High-affinity proline transporter PutP Bacillus subtilis (strain 168)
Q4A070 3.77e-33 134 29 13 476 3 putP1 Sodium/proline symporter 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P07117 2.94e-28 120 26 10 485 1 putP Sodium/proline symporter Escherichia coli (strain K12)
P45174 1.16e-24 110 29 16 428 3 putP Sodium/proline symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P10502 1.75e-24 109 25 9 446 1 putP Sodium/proline symporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C6D930 8.2e-18 89 23 10 468 3 actP Cation/acetate symporter ActP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8WHP3 1.42e-17 89 24 18 461 2 slc5a9 Sodium/glucose cotransporter 4 Danio rerio
Q9NY91 4.34e-16 84 22 15 479 1 SLC5A4 Probable glucose sensor protein SLC5A4 Homo sapiens
Q6D913 2.26e-15 82 22 10 468 3 actP Cation/acetate symporter ActP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7FNG3 6.72e-15 80 22 11 474 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNK6 7.61e-15 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN0 7.61e-15 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K137 7.61e-15 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TS08 1.1e-14 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pestis (strain Pestoides F)
Q1CE35 1.1e-14 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R563 1.1e-14 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ73 1.1e-14 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pestis
Q1C0M8 1.1e-14 80 22 11 479 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Antiqua)
O70247 1.23e-14 80 24 13 451 1 Slc5a6 Sodium-dependent multivitamin transporter Rattus norvegicus
Q7NA72 1.28e-14 79 24 14 471 3 actP Cation/acetate symporter ActP Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P39599 2.4e-14 79 23 11 432 3 ywcA Uncharacterized symporter YwcA Bacillus subtilis (strain 168)
O07556 6.03e-14 77 22 11 457 3 yhjB Uncharacterized symporter YhjB Bacillus subtilis (strain 168)
P53791 1.29e-13 77 24 17 483 2 SLC5A1 Sodium/glucose cotransporter 1 Ovis aries
P26429 1.3e-13 76 25 17 451 2 SLC5A1 Sodium/glucose cotransporter 1 (Fragment) Sus scrofa
B7LMN9 2.52e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Z1C8 2.52e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5T7 2.52e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7
B7NG10 3.34e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R3J9 3.58e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain UTI89 / UPEC)
A1AIQ8 3.58e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O1:K1 / APEC
B7MSH6 3.58e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O81 (strain ED1a)
B7MJT5 3.58e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPN5 3.58e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
D3ZIS0 3.97e-13 75 22 16 482 3 Slc5a4 Solute carrier family 5 member 4 Rattus norvegicus
B1LPN2 4.02e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain SMS-3-5 / SECEC)
Q0T9Y2 4.02e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSM7 4.02e-13 75 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P31448 9.75e-13 73 24 14 426 1 yidK Uncharacterized symporter YidK Escherichia coli (strain K12)
Q8K0E3 1.37e-12 73 23 12 477 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Mus musculus
B6I5T5 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain SE11)
P32705 1.4e-12 73 22 14 481 1 actP Cation/acetate symporter ActP Escherichia coli (strain K12)
B1IUI4 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCV3 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / DH10B)
C5A160 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / MC4100 / BW2952)
B7LB16 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli (strain 55989 / EAEC)
A7ZUU1 1.4e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O139:H28 (strain E24377A / ETEC)
Q9Z1F2 1.61e-12 73 23 12 477 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Rattus norvegicus
A8A7G7 1.61e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O9:H4 (strain HS)
B7M7Y0 1.61e-12 73 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O8 (strain IAI1)
A8AN31 2.06e-12 72 21 13 484 3 actP Cation/acetate symporter ActP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8FAZ0 2.1e-12 72 22 14 481 3 actP Cation/acetate symporter ActP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1EHB4 2.13e-12 73 21 11 434 1 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Homo sapiens
B2VKE4 3.31e-12 72 21 14 492 3 actP Cation/acetate symporter ActP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1JIK1 3.39e-12 72 22 14 472 3 actP Cation/acetate symporter ActP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q49B93 3.65e-12 72 21 10 433 1 Slc5a12 Sodium-coupled monocarboxylate transporter 2 Mus musculus
Q3YUR7 3.82e-12 72 23 14 459 3 actP Cation/acetate symporter ActP Shigella sonnei (strain Ss046)
Q83P94 4.89e-12 71 22 14 481 3 actP Cation/acetate symporter ActP Shigella flexneri
Q31TS7 5.63e-12 71 22 14 481 3 actP Cation/acetate symporter ActP Shigella boydii serotype 4 (strain Sb227)
B4T1W9 8.3e-12 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella newport (strain SL254)
P53792 8.43e-12 71 25 12 407 1 Slc5a2 Sodium/glucose cotransporter 2 Rattus norvegicus
Q8ZKF8 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRK2 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella schwarzengrund (strain CVM19633)
B5BJZ5 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain AKU_12601)
A9N1R2 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ05 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TEB2 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella heidelberg (strain SL476)
B5R937 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5F2E9 1.11e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella agona (strain SL483)
B5QZ97 1.12e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella enteritidis PT4 (strain P125109)
B5FRF0 1.12e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella dublin (strain CT_02021853)
A9MGK8 1.12e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q57GV4 1.15e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella choleraesuis (strain SC-B67)
C0Q552 1.2e-11 70 22 14 489 3 actP Cation/acetate symporter ActP Salmonella paratyphi C (strain RKS4594)
A7MBD8 1.28e-11 70 23 12 431 2 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Bos taurus
P11170 1.3e-11 70 23 16 482 1 SLC5A1 Sodium/glucose cotransporter 1 Oryctolagus cuniculus
B2TXA0 2.29e-11 69 22 14 481 3 actP Cation/acetate symporter ActP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q92911 2.35e-11 69 23 10 356 1 SLC5A5 Sodium/iodide cotransporter Homo sapiens
Q923I7 4.01e-11 68 25 14 412 1 Slc5a2 Sodium/glucose cotransporter 2 Mus musculus
P96169 4.38e-11 68 24 17 448 1 sglT Sodium/glucose cotransporter Vibrio parahaemolyticus
Q9Y289 4.46e-11 68 24 13 426 1 SLC5A6 Sodium-dependent multivitamin transporter Homo sapiens
Q8Z1R2 6.93e-11 68 22 14 489 3 actP Cation/acetate symporter ActP Salmonella typhi
Q6R4Q5 8.53e-11 67 24 11 395 2 SLC5A10 Sodium/mannose cotransporter SLC5A10 Bos taurus
P31639 1.02e-10 67 25 13 412 1 SLC5A2 Sodium/glucose cotransporter 2 Homo sapiens
Q9XT77 1.64e-10 67 24 16 463 2 SLC5A6 Sodium-dependent multivitamin transporter Oryctolagus cuniculus
P83740 1.99e-10 66 25 15 431 2 CG32669 Putative sodium-dependent multivitamin transporter Drosophila melanogaster
A4W5I3 2.25e-10 66 22 14 489 3 actP Cation/acetate symporter ActP Enterobacter sp. (strain 638)
Q28728 2.73e-10 66 23 12 468 1 SLC5A11 Sodium/myo-inositol cotransporter 2 Oryctolagus cuniculus
P13866 3.58e-10 65 23 16 475 1 SLC5A1 Sodium/glucose cotransporter 1 Homo sapiens
P53794 4.09e-10 65 23 18 493 1 SLC5A3 Sodium/myo-inositol cotransporter Homo sapiens
Q5SWY8 4.58e-10 65 21 10 370 1 Slc5a10 Sodium/mannose cotransporter SLC5A10 Mus musculus
A0PJK1 4.91e-10 65 25 14 382 1 SLC5A10 Sodium/mannose cotransporter SLC5A10 Homo sapiens
Q5FY69 5.56e-10 65 23 11 393 2 SLC5A10 Sodium/mannose cotransporter SLC5A10 Sus scrofa
Q8WWX8 5.9e-10 65 22 12 467 1 SLC5A11 Sodium/myo-inositol cotransporter 2 Homo sapiens
Q91ZP4 6.36e-10 65 21 14 476 2 Slc5a4b Solute carrier family 5 member 4B Mus musculus
Q5U4D8 6.95e-10 65 24 14 453 1 Slc5a6 Sodium-dependent multivitamin transporter Mus musculus
Q9JKZ2 7.59e-10 65 23 18 493 1 Slc5a3 Sodium/myo-inositol cotransporter Mus musculus
P31636 8.34e-10 64 22 7 305 1 SLC5A4 Solute carrier family 5 member 4 Sus scrofa
Q9ET37 8.6e-10 64 22 15 476 1 Slc5a4a Solute carrier family 5 member 4A Mus musculus
P31637 1.16e-09 64 23 18 504 1 SLC5A3 Sodium/myo-inositol cotransporter Canis lupus familiaris
Q7T384 1.48e-09 63 20 9 363 1 slc5a12 Sodium-coupled monocarboxylate transporter 2 Danio rerio
P53793 2.2e-09 63 23 17 499 3 SLC5A3 Sodium/myo-inositol cotransporter Bos taurus
Q3ZMH1 4.93e-09 62 21 17 457 1 slc5a8 Sodium-coupled monocarboxylate transporter 1 Danio rerio
Q7SYH5 6.26e-09 62 20 12 426 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus laevis
P26430 1.17e-08 61 24 15 412 2 SLC5A2 Sodium/glucose cotransporter 2 Oryctolagus cuniculus
Q3ZC26 1.34e-08 60 23 10 364 2 SLC5A11 Sodium/myo-inositol cotransporter 2 Bos taurus
A6TGZ7 1.54e-08 60 22 14 492 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XXT7 1.54e-08 60 22 14 492 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae (strain 342)
A8I1B9 1.55e-08 60 23 10 366 2 SLC5A11 Sodium/myo-inositol cotransporter 2 Sus scrofa
O02228 2.01e-08 60 24 14 464 2 cho-1 High-affinity choline transporter 1 Caenorhabditis elegans
Q5BL81 2.16e-08 60 21 13 428 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus tropicalis
Q2M3M2 2.68e-08 60 25 9 363 1 SLC5A9 Sodium/glucose cotransporter 4 Homo sapiens
Q99PN0 4.14e-08 59 23 10 343 1 Slc5a5 Sodium/iodide cotransporter Mus musculus
P53790 4.46e-08 59 25 13 392 2 Slc5a1 Sodium/glucose cotransporter 1 Rattus norvegicus
Q63008 4.76e-08 59 23 9 344 1 Slc5a5 Sodium/iodide cotransporter Rattus norvegicus
Q8C3K6 5.36e-07 55 23 12 388 1 Slc5a1 Sodium/glucose cotransporter 1 Mus musculus
Q8VDT1 2.56e-06 53 23 9 297 1 Slc5a9 Sodium/glucose cotransporter 4 Mus musculus
Q8BYF6 4.18e-06 53 21 13 430 1 Slc5a8 Sodium-coupled monocarboxylate transporter 1 Mus musculus
O34745 4.59e-06 52 20 11 440 2 yodF Uncharacterized symporter YodF Bacillus subtilis (strain 168)
Q28610 1.36e-05 51 23 13 330 2 SLC5A10 Sodium/mannose cotransporter SLC5A10 Oryctolagus cuniculus
Q1M7A2 4.65e-05 49 27 3 174 1 mctP Monocarboxylate transport permease protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8N695 6.31e-05 49 20 12 434 1 SLC5A8 Sodium-coupled monocarboxylate transporter 1 Homo sapiens
Q9VE46 0.000127 48 22 18 455 2 ChT High-affinity choline transporter 1 Drosophila melanogaster
B4EZY7 0.00016 47 24 5 204 1 siaT Sodium/sialic acid symporter SiaT Proteus mirabilis (strain HI4320)
Q8NS49 0.000211 47 22 10 436 1 mctC Monocarboxylic acid transporter Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9GZV3 0.00025 47 22 19 469 1 SLC5A7 High affinity choline transporter 1 Homo sapiens
Q8BGY9 0.00031 47 22 17 468 1 Slc5a7 High affinity choline transporter 1 Mus musculus
Q9JMD7 0.000466 46 22 17 468 1 Slc5a7 High affinity choline transporter 1 Rattus norvegicus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18035
Feature type CDS
Gene panF
Product sodium/pantothenate symporter
Location 3962153 - 3963598 (strand: -1)
Length 1446 (nucleotides) / 481 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_224
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00474 Sodium:solute symporter family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4145 Coenzyme transport and metabolism (H) H Na+/panthothenate symporter

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14392 sodium/pantothenate symporter - -

Protein Sequence

MQTEVIVPLVGYLLLVFLLSAYAYRKREKGQFLNEYFLGNRSMGGFVLAMTITATYVSASSFIGGPGAAYKYGIGWVLLSMIQLPAIWLSLGVLGKKFAILARRYNAVTLNDMLYARYQSRFLVWFASLSLLVAFVGAMTVQFIGGARLLETAAGIPYEFGLLIFGISIALYTAIGGFRASVLNDALQGLVMLLGTFILLFAIIYKAGGLDIAIQKLNAIDPALTSPHGADGILTGPFMASFWVLVCFGVIGLPHTAVRCISYKDSKAMHRGIIIGTIVMALLMFGMHFAGALGRAIIPDLTVPDQVIPTLMVDVLPPFAAGIFLAAPMAAIMSTINAQLLQSSATLVKDLYLNLAPHAINNEKRIARLSSLSTLILGILLLFAAWNPPSMIIWLNLLAFGGLQAVFLWPLVLGLYWNKANRYGAIAGMITGATLYATLATFNIQIAGFHPIIPALLLSLVAFLVANRFGEQTLPQSAPLQ

Flanking regions ( +/- flanking 50bp)

GATGGTACGCTATTTTTTCAAAGATATGCCGTTAGGAGATGAGCATGACAATGCAAACTGAGGTTATCGTGCCACTGGTTGGCTATCTCTTATTGGTCTTCCTATTATCCGCATACGCATATCGTAAACGTGAAAAAGGGCAATTTCTTAACGAGTATTTTCTTGGTAACCGCTCTATGGGTGGATTTGTCCTTGCAATGACCATCACGGCAACCTATGTCAGTGCTAGCTCTTTTATTGGTGGACCAGGAGCGGCTTACAAATACGGCATTGGTTGGGTACTTCTTTCGATGATCCAGCTCCCCGCTATTTGGCTCTCCCTCGGGGTACTAGGTAAAAAATTTGCTATTTTGGCGCGTCGTTATAACGCCGTCACCCTAAATGATATGCTCTATGCTCGCTACCAAAGTCGCTTTTTAGTCTGGTTTGCCAGCTTAAGTCTACTGGTAGCTTTTGTCGGCGCCATGACCGTACAATTTATTGGTGGTGCTCGCTTATTAGAAACCGCGGCGGGTATTCCCTATGAATTTGGTTTGCTGATATTTGGTATCTCAATCGCATTATATACAGCGATTGGCGGATTTAGAGCCAGTGTATTAAATGATGCCTTACAAGGCCTTGTGATGTTATTGGGCACCTTTATTTTGCTTTTTGCCATTATCTACAAGGCGGGTGGTTTAGATATTGCAATACAAAAACTAAATGCTATCGATCCTGCCCTTACCTCTCCTCATGGTGCTGACGGCATTTTAACTGGCCCCTTTATGGCGTCATTTTGGGTATTGGTCTGTTTTGGGGTTATCGGCCTTCCCCATACTGCAGTGCGCTGTATCTCTTATAAAGACAGCAAAGCCATGCACAGAGGGATCATCATCGGCACCATCGTGATGGCGTTATTAATGTTTGGTATGCACTTTGCGGGCGCATTAGGTCGGGCAATCATTCCTGATCTCACCGTGCCAGATCAAGTTATTCCAACCTTAATGGTTGATGTATTACCACCTTTTGCTGCCGGTATATTTTTAGCGGCACCGATGGCAGCCATCATGTCAACGATTAACGCACAACTGCTACAATCATCAGCGACATTGGTCAAAGATCTCTATCTCAATCTCGCGCCTCATGCCATAAACAATGAAAAACGCATTGCGCGTTTATCTAGCCTATCTACTTTGATTTTAGGGATCTTATTGCTATTTGCTGCATGGAACCCGCCATCAATGATAATTTGGCTCAATTTACTTGCCTTTGGTGGACTACAAGCGGTTTTCTTATGGCCTCTAGTACTTGGCCTTTACTGGAACAAAGCAAACCGTTATGGCGCGATTGCGGGCATGATAACCGGTGCCACACTCTATGCTACACTGGCAACATTTAATATCCAGATTGCTGGATTTCATCCTATTATTCCTGCGCTGTTATTGAGCTTAGTGGCTTTTCTTGTCGCAAATAGGTTTGGAGAACAAACCTTGCCTCAATCTGCTCCATTACAGTGAACTTGTTTTTAAAAGAGATTAATTATGCCTTGGATACAATTAAGACTAAA