Homologs in group_971

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05365 FBDBKF_05365 41.0 Morganella morganii S1 rssB two-component system response regulator RssB
EHELCC_12225 EHELCC_12225 41.0 Morganella morganii S2 rssB two-component system response regulator RssB
NLDBIP_12565 NLDBIP_12565 41.0 Morganella morganii S4 rssB two-component system response regulator RssB
LHKJJB_12425 LHKJJB_12425 41.0 Morganella morganii S3 rssB two-component system response regulator RssB
HKOGLL_11040 HKOGLL_11040 41.0 Morganella morganii S5 rssB two-component system response regulator RssB
F4V73_RS05820 F4V73_RS05820 43.1 Morganella psychrotolerans rssB two-component system response regulator RssB

Distribution of the homologs in the orthogroup group_971

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_971

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AEV3 5.01e-82 255 41 2 336 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 5.01e-82 255 41 2 336 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 5.01e-82 255 41 2 336 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q65JK6 2.53e-10 64 35 7 129 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q06065 2.89e-09 61 35 1 102 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q05522 3.74e-09 60 28 9 169 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q8F6P9 4.52e-09 60 30 6 151 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 4.52e-09 60 30 6 151 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P06628 6.32e-09 57 32 1 106 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q8D4X6 7.42e-09 60 37 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q7MBQ5 7.73e-09 60 37 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
P37478 1e-08 58 32 5 131 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q5L0L0 1.2e-08 59 28 8 175 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
A0QTK2 2.45e-08 57 32 2 103 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q93CB8 2.58e-08 57 31 2 103 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 2.72e-08 57 31 2 103 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 2.72e-08 57 31 2 103 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 2.72e-08 57 31 2 103 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ2 2.8e-08 57 31 2 103 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q56312 5.14e-08 54 30 2 106 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9K998 5.26e-08 56 29 3 107 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4ZQV7 7.02e-08 57 33 4 123 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. syringae (strain B728a)
Q884V3 7.15e-08 57 33 4 123 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1IRH0 7.82e-08 57 34 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P0A4H5 7.95e-08 53 32 2 103 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 7.95e-08 53 32 2 103 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1IQS9 8.17e-08 57 33 4 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q48GG6 8.58e-08 57 33 4 123 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P24072 9.5e-08 53 33 2 103 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q2SPQ1 1.41e-07 56 31 6 122 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
Q3BUA2 1.57e-07 55 36 5 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLB4 1.57e-07 55 36 5 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas axonopodis pv. citri (strain 306)
Q5GYV8 1.97e-07 55 36 5 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P1V8 1.97e-07 55 36 5 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P52942 2.45e-07 52 30 2 113 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q4UU97 3.44e-07 55 35 5 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 3.44e-07 55 35 5 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P13792 3.98e-07 53 26 5 164 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q221I1 4.11e-07 54 31 6 123 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1SMR4 4.96e-07 54 30 4 127 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P0AEF7 6.03e-07 53 22 5 230 3 dpiA Transcriptional regulatory protein DpiA Shigella flexneri
P0AEF4 6.03e-07 53 22 5 230 1 dpiA Transcriptional regulatory protein DpiA Escherichia coli (strain K12)
P0AEF5 6.03e-07 53 22 5 230 3 dpiA Transcriptional regulatory protein DpiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEF6 6.03e-07 53 22 5 230 3 dpiA Transcriptional regulatory protein DpiA Escherichia coli O157:H7
Q10WZ6 6.47e-07 53 30 6 136 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q3KFZ6 6.89e-07 53 31 3 121 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain Pf0-1)
Q2HWH1 8.59e-07 51 29 2 117 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 8.59e-07 51 29 2 117 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
O78428 8.96e-07 53 27 3 133 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q30ZJ5 9.22e-07 53 33 2 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q31HL9 9.9e-07 53 28 6 160 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4KG36 1.01e-06 53 31 3 121 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8PX96 1.21e-06 53 29 4 122 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6K9T0 1.46e-06 50 29 2 117 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.46e-06 50 29 2 117 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
P51586 1.74e-06 50 30 2 114 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
O52262 1.75e-06 52 31 3 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudomonas putida
Q88EW5 1.76e-06 52 31 3 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P48259 1.86e-06 52 28 2 105 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q2ILG8 1.88e-06 52 30 5 120 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
P54662 2.08e-06 51 33 2 103 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P41789 2.09e-06 52 29 1 101 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB8 2.2e-06 52 29 1 101 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 2.2e-06 52 29 1 101 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q0AYL3 4.73e-06 51 30 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9LYP5 4.89e-06 52 31 3 113 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q21G20 5.07e-06 51 35 5 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2FWH6 5.23e-06 50 29 4 129 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9APD9 5.57e-06 51 31 2 117 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q30RX5 6.77e-06 50 32 4 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
O87125 6.87e-06 50 31 4 123 1 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0PVB3 7.68e-06 49 27 2 118 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
P62646 7.86e-06 50 33 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q00934 9.19e-06 50 31 3 119 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62636 9.23e-06 50 33 2 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2RRX2 9.27e-06 50 32 4 121 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P39486 1.12e-05 49 24 3 112 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P42244 1.22e-05 49 28 2 102 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
O25408 1.33e-05 50 33 3 103 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q2LSL3 1.39e-05 50 31 5 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Syntrophus aciditrophicus (strain SB)
Q9I4F9 1.66e-05 48 25 5 158 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7NZB3 1.71e-05 49 30 3 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
O69730 1.72e-05 48 26 1 101 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1TEL7 1.81e-05 48 28 1 102 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1GZZ0 1.88e-05 49 30 7 149 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A1W0A5 1.89e-05 47 26 4 129 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.89e-05 47 26 4 129 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.89e-05 47 26 4 129 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P28835 1.91e-05 48 27 2 105 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q97GZ3 2.1e-05 49 30 3 120 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O80365 2.15e-05 48 31 4 133 1 ARR8 Two-component response regulator ARR8 Arabidopsis thaliana
Q2W5V5 2.19e-05 49 35 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P03029 2.31e-05 49 30 1 99 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q15RF6 2.38e-05 49 28 5 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
O29221 2.6e-05 49 27 5 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P09432 2.72e-05 49 28 4 146 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P14375 2.83e-05 49 29 1 102 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q2RAP3 2.89e-05 47 25 3 143 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 2.89e-05 47 25 3 143 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
Q1B3X8 2.9e-05 48 28 1 102 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 2.9e-05 48 28 1 102 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 2.9e-05 48 28 1 102 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q87MK5 2.96e-05 48 28 5 141 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZWS9 3.01e-05 48 33 4 123 1 ARR3 Two-component response regulator ARR3 Arabidopsis thaliana
Q6H468 3.05e-05 47 28 2 117 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 3.05e-05 47 28 2 117 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
Q8X613 3.09e-05 49 29 1 102 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q3ADA6 3.27e-05 48 31 5 122 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
O82798 3.4e-05 48 31 3 122 1 ARR4 Two-component response regulator ARR4 Arabidopsis thaliana
Q9K621 3.45e-05 48 27 3 104 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2QXY3 3.66e-05 47 25 3 143 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 3.66e-05 47 25 3 143 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
Q7A1J1 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 4.75e-05 47 28 1 103 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 4.75e-05 47 28 1 103 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 4.75e-05 47 28 1 103 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 4.75e-05 47 28 1 103 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 4.75e-05 47 28 1 103 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q47GX7 5.27e-05 48 29 4 109 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Dechloromonas aromatica (strain RCB)
P39663 5.81e-05 47 28 2 115 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P35163 5.86e-05 47 29 3 106 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
O05251 6.25e-05 47 42 0 57 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q8RAZ3 7.2e-05 47 32 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9SB04 8.24e-05 46 29 3 123 1 ARR5 Two-component response regulator ARR5 Arabidopsis thaliana
Q8DPL7 8.64e-05 47 31 4 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 8.64e-05 47 31 4 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 8.64e-05 47 31 4 108 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P94439 8.65e-05 46 33 3 106 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
A0PWB4 9e-05 46 27 1 102 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1KHB7 9.2e-05 46 27 1 102 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 9.2e-05 46 27 1 102 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2T8Y5 9.44e-05 47 35 5 120 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9ZWS6 9.81e-05 46 27 3 137 1 ARR6 Two-component response regulator ARR6 Arabidopsis thaliana
Q8GVV6 0.000102 44 32 3 105 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 0.000102 44 32 3 105 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
O83639 0.000103 47 30 4 122 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q742C1 0.000106 46 27 1 102 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 0.000106 46 27 1 102 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q2WAJ8 0.000108 47 32 6 134 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P44918 0.000108 46 31 4 108 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CD68 0.000111 46 27 1 102 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q9HUI2 0.000114 46 33 4 109 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0R3I8 0.000116 46 27 1 102 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P72253 0.000119 47 31 5 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P28787 0.000134 47 26 1 101 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q2RZD2 0.000134 47 27 3 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Salinibacter ruber (strain DSM 13855 / M31)
Q6LTM2 0.000137 47 29 5 121 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
Q888V8 0.000142 47 31 4 113 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P9WGM9 0.000146 46 27 1 102 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 0.000146 46 27 1 102 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 0.000146 46 27 1 102 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P96686 0.000146 45 28 3 107 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q8TUQ0 0.000163 46 28 4 122 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P32040 0.000177 46 27 1 110 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q06239 0.000178 45 28 2 102 3 vanR Regulatory protein VanR Enterococcus faecium
Q2HWG1 0.000189 43 31 3 105 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
Q942A1 0.000191 45 26 5 167 2 RR4 Two-component response regulator ORR4 Oryza sativa subsp. japonica
Q4GZK7 0.000191 45 26 5 167 2 RR4 Two-component response regulator ORR4 Oryza sativa subsp. indica
Q4A160 0.000196 45 27 5 118 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2RX18 0.000203 46 31 5 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3A5A8 0.000244 46 27 4 121 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q6AJV3 0.000245 46 30 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P13800 0.000247 45 30 2 102 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
Q0HKN5 0.000251 46 29 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
P26275 0.000255 45 29 3 107 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5V0B3 0.000259 46 28 6 127 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
B0R4K1 0.000304 43 23 1 105 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q0HWY6 0.00036 45 29 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
E0X9C7 0.000366 46 26 4 121 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P62598 0.000387 45 31 2 107 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
Q2HWG0 0.000406 43 32 3 105 2 RR13 Two-component response regulator ORR13 Oryza sativa subsp. japonica
Q5QZQ3 0.000447 45 27 3 120 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8Z333 0.000488 45 28 1 102 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q4ZYD3 0.000499 45 28 3 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. syringae (strain B728a)
Q50136 0.00052 44 33 3 106 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P25852 0.000533 45 28 1 102 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45709 0.000544 42 28 2 103 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q1D359 0.000549 45 32 4 108 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q39SY1 0.000551 45 31 5 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q7NV40 0.000576 45 31 3 108 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8CQ17 0.000592 44 28 1 103 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 0.000592 44 28 1 103 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A5W4E3 0.000608 45 26 4 121 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q7MIQ5 0.000622 45 27 5 140 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain YJ016)
P0C5S5 0.000645 45 34 0 58 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 0.000645 45 34 0 58 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q2YZ24 0.000661 44 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
B8GZM2 0.000663 45 30 3 110 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 0.000663 45 30 3 110 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O34903 0.000668 44 29 1 101 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q87MX7 0.000669 45 34 0 58 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DB67 0.000686 44 27 5 140 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain CMCP6)
Q12PJ3 0.000694 44 28 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8ECD7 0.000721 44 28 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P62640 0.000724 44 29 4 117 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7A0U4 0.000761 43 28 2 107 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 0.000761 43 28 2 107 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 0.000761 43 28 2 107 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 0.000761 43 28 2 107 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 0.000761 43 28 2 107 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 0.000761 43 28 2 107 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 0.000761 43 28 2 107 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 0.000761 43 28 2 107 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A039 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 0.000773 43 28 2 100 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9KQD8 0.000843 44 27 4 121 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KA55 0.000868 44 27 3 120 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q23917 0.001 44 30 4 121 1 regA 3',5'-cyclic-nucleotide phosphodiesterase regA Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07220
Feature type CDS
Gene rssB
Product two-component system response regulator RssB
Location 1581673 - 1582692 (strand: -1)
Length 1020 (nucleotides) / 339 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_971
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0784 Signal transduction mechanisms (T) T CheY-like REC (receiver) domain, includes chemotaxis protein CheY and sporulation regulator Spo0F

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02485 two-component system, response regulator - -

Protein Sequence

MNKALVGKKILIIDDEVVFRTMLTEYFSHEKACVYATDNGSQALLLLEEGLRPDLILCDIRMPVMNGPTFLCHLEQRHWSFPVIAISCTDNMAEIDDMLRFGAQDVFLKPVTNLAKLKQKVIEVLCPGFFESELIARGQLGPLWNNLREQPHYIQSFVKQMQPQVKQIVAGYNVNYRQLNDASQMGLLFDIATLSKDQIIFYCVDVSNDEENGLLVALLLRVVFNRFLKATEKRRFLPSMYNILNKINKMLEDMGVRGSFPLILGYYHTKEKNILLASAGLRAEIKTENKKYVLNSGIPLGTLHSLYINQIKCVGIDWQCKIWNQHHKINLMFSPIHKR

Flanking regions ( +/- flanking 50bp)

ATGTAACGCTAAATAAACCGCAAGTGAAATGATAGTTATGGGTATTACTAATGAATAAAGCCTTAGTCGGTAAAAAAATTCTCATTATTGATGATGAGGTTGTATTTCGCACAATGCTCACTGAGTATTTTTCACACGAAAAGGCTTGCGTTTATGCGACTGACAATGGTAGCCAAGCATTGTTGTTACTTGAAGAGGGACTAAGACCTGATCTTATTTTATGTGATATCAGAATGCCTGTTATGAATGGGCCGACTTTTTTATGTCATCTAGAGCAGCGTCATTGGTCTTTCCCTGTTATTGCTATTTCATGTACTGACAACATGGCTGAAATTGATGATATGTTGCGCTTTGGCGCTCAGGACGTTTTTCTTAAGCCCGTAACTAATTTAGCTAAGTTAAAACAGAAGGTCATTGAAGTATTATGTCCAGGTTTTTTTGAGTCTGAATTAATTGCAAGGGGACAACTTGGACCTCTTTGGAATAACTTACGAGAACAGCCTCATTATATTCAATCCTTTGTTAAACAGATGCAACCGCAAGTTAAACAAATTGTCGCAGGATATAATGTTAATTATCGTCAATTAAATGATGCATCCCAAATGGGGTTGTTATTTGATATAGCGACTTTATCAAAAGATCAAATCATTTTTTACTGTGTTGACGTCTCTAATGATGAAGAAAATGGGTTACTCGTTGCGCTGCTTTTAAGGGTGGTTTTTAATCGTTTCCTAAAAGCTACTGAGAAAAGACGCTTCTTACCTAGTATGTATAACATATTGAATAAAATCAATAAAATGCTTGAGGATATGGGGGTGAGAGGATCATTCCCGCTGATTTTAGGTTATTACCACACCAAGGAAAAAAATATATTATTAGCGTCAGCAGGACTACGAGCTGAAATAAAAACAGAGAATAAAAAATATGTTTTAAATAGTGGTATACCTTTAGGAACACTACACTCTTTATATATTAACCAAATAAAGTGTGTGGGAATAGATTGGCAATGTAAAATTTGGAATCAGCACCATAAAATTAATTTAATGTTCTCACCTATACATAAACGTTAAATTTAGATTAAATAAAATCTGTTATTGCACATATATTAAACATAAATGAA