Homologs in group_1794

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13315 FBDBKF_13315 42.2 Morganella morganii S1 fepC heme ABC transporter ATP-binding protein
EHELCC_08780 EHELCC_08780 42.2 Morganella morganii S2 fepC heme ABC transporter ATP-binding protein
NLDBIP_09105 NLDBIP_09105 42.2 Morganella morganii S4 fepC heme ABC transporter ATP-binding protein
LHKJJB_05160 LHKJJB_05160 42.2 Morganella morganii S3 fepC heme ABC transporter ATP-binding protein
HKOGLL_05755 HKOGLL_05755 42.2 Morganella morganii S5 fepC heme ABC transporter ATP-binding protein
F4V73_RS03440 F4V73_RS03440 46.1 Morganella psychrotolerans - heme ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1794

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1794

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N3S7 2.79e-121 349 64 0 254 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D645 2.07e-114 332 61 1 255 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q66FK0 6.79e-111 323 58 1 265 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 6.79e-111 323 58 1 265 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 6.79e-111 323 58 1 265 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 6.79e-111 323 58 1 265 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
P74981 5.57e-106 310 60 0 257 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q2NSR0 4.21e-92 275 52 0 255 3 hmuV Hemin import ATP-binding protein HmuV Sodalis glossinidius (strain morsitans)
O70014 1.32e-90 271 52 2 256 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q32AY3 2.04e-90 271 52 2 256 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCJ1 3.13e-90 270 52 2 256 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 3.13e-90 270 52 2 256 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8X5N2 5.64e-90 270 51 2 256 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q1R597 2.14e-89 268 51 2 256 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q84EY8 6.22e-88 265 54 2 253 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q87J32 5.24e-68 214 46 4 255 3 hmuV Hemin import ATP-binding protein HmuV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q88DY1 3.98e-65 206 45 3 246 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7NN36 4.7e-65 207 44 4 259 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9KL34 4.21e-64 204 44 3 252 3 hmuV Hemin import ATP-binding protein HmuV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MFA1 8.49e-64 203 42 3 254 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
Q3K6R9 1.31e-63 202 45 3 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
Q8D3S8 1.76e-63 202 42 3 254 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain CMCP6)
Q5E5I1 2.1e-63 202 44 5 254 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q70YG7 2e-62 199 42 4 258 1 hmuV Hemin import ATP-binding protein HmuV Vibrio anguillarum (strain ATCC 68554 / 775)
Q4K5Z7 1.46e-60 194 43 3 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1I4Q5 3.71e-60 194 43 3 253 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas entomophila (strain L48)
Q659V4 3.82e-60 194 40 4 263 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
O68877 4.42e-60 193 43 3 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FW7 4.42e-60 193 43 3 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2SB47 6.23e-60 193 43 4 244 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q93SS1 6.62e-60 193 43 5 256 3 hmuV Hemin import ATP-binding protein HmuV Plesiomonas shigelloides
Q70GD4 1.07e-59 193 41 4 255 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q1H0W2 1.46e-59 192 38 3 268 3 hmuV Hemin import ATP-binding protein HmuV Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2RZ08 1.25e-57 188 41 4 255 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
Q8EB59 1.47e-57 187 42 2 251 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q31J97 4.06e-57 186 43 3 251 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9RZU5 3.29e-56 184 42 5 258 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1J255 3.78e-56 184 43 7 263 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q138A9 4.12e-55 181 39 3 243 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q2J3T0 4.15e-55 181 38 3 244 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q6LQC0 2.17e-54 179 41 5 255 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium profundum (strain SS9)
Q217B2 6.48e-53 176 39 2 238 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q12R52 8.41e-53 175 42 3 234 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q1LC89 8.47e-53 175 41 2 250 3 hmuV Hemin import ATP-binding protein HmuV Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q98L75 3.61e-52 173 38 4 259 3 hmuV Hemin import ATP-binding protein HmuV Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q92N13 6.85e-52 172 35 4 258 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q07LU3 1.08e-51 172 37 2 243 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q47MA5 1.65e-51 172 40 3 259 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q8L1U3 1.82e-51 171 41 2 248 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 1.82e-51 171 41 2 248 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q93SH7 4.18e-51 171 37 3 257 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8UCM5 1.42e-50 169 36 2 255 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2T3B8 2.46e-50 169 38 5 258 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3ICT8 6.04e-50 167 37 3 258 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
Q3SQ65 6.29e-50 168 35 2 251 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q6N7Y6 1.3e-49 167 39 3 238 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1GJU0 3.05e-49 166 38 7 259 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q0SIB7 5.43e-49 166 38 3 248 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q9RKQ4 6.95e-49 166 39 3 249 3 hmuV Hemin import ATP-binding protein HmuV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q63NR0 2.77e-48 164 40 5 257 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain K96243)
Q3JHM1 2.77e-48 164 40 5 257 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain 1710b)
Q62A98 2.77e-48 164 40 5 257 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia mallei (strain ATCC 23344)
Q0B697 5.15e-48 163 38 6 263 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5YVL8 6.09e-48 163 40 3 236 3 hmuV Hemin import ATP-binding protein HmuV Nocardia farcinica (strain IFM 10152)
Q9HQ18 6.58e-48 166 36 2 245 1 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G4 6.58e-48 166 36 2 245 3 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q1BJA5 7.08e-48 163 37 6 265 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia orbicola (strain AU 1054)
A0B3E2 7.08e-48 163 37 6 265 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia cenocepacia (strain HI2424)
Q28QF9 7.14e-48 162 36 3 247 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q5QXD0 7.31e-48 162 39 5 255 3 hmuV Hemin import ATP-binding protein HmuV Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7WEH6 1.15e-47 162 40 3 252 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P07821 3.63e-47 160 33 3 256 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
Q7W359 4.01e-47 160 40 3 252 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q6G098 4.57e-47 160 37 4 254 3 hmuV Hemin import ATP-binding protein HmuV Bartonella quintana (strain Toulouse)
Q7W025 5.03e-47 160 40 3 252 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q6G475 7.92e-47 160 37 5 251 3 hmuV Hemin import ATP-binding protein HmuV Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q39B28 8.98e-47 160 37 6 260 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P23878 2.44e-46 159 34 2 258 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
Q160G4 4.89e-46 157 36 3 254 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1DCP5 3.61e-45 155 38 3 247 3 hmuV Hemin import ATP-binding protein HmuV Myxococcus xanthus (strain DK1622)
Q2K551 4.06e-44 153 36 5 255 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P94420 7.63e-44 152 31 2 242 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q1MCZ1 8.61e-44 152 36 4 254 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9AE30 2.26e-43 151 36 4 254 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium leguminosarum
O34631 2.39e-43 155 37 4 262 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
Q11ID5 3.76e-43 150 36 5 258 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q81LM1 1.79e-41 146 33 2 243 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
P15031 1.47e-40 143 33 4 260 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q58283 1.16e-39 142 34 3 242 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O34510 3.7e-39 140 34 3 255 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
P49938 4.84e-39 140 31 2 245 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
Q81V82 2.86e-36 132 30 2 255 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
O32188 1.56e-35 131 30 2 251 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q6LQ77 5.8e-35 129 34 4 229 3 btuD Vitamin B12 import ATP-binding protein BtuD Photobacterium profundum (strain SS9)
Q92AF9 4.24e-33 124 33 8 242 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q47087 1.57e-32 123 29 2 255 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q57554 1.82e-32 122 32 6 242 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8Y651 1.92e-32 122 33 8 242 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5ZWE4 3.33e-32 124 37 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q57243 5.88e-32 121 34 5 253 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q50801 6.9e-32 121 34 9 241 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
P48334 2e-31 119 31 7 247 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q5WXF0 4.33e-31 121 37 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
O34338 7.54e-31 118 34 8 245 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
A8AHA1 8.73e-31 117 36 4 227 3 btuD Vitamin B12 import ATP-binding protein BtuD Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5X627 1.07e-30 120 37 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q58488 2.69e-29 114 31 7 226 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8NVB5 1.91e-28 112 30 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MW2)
Q6G799 1.91e-28 112 30 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MSSA476)
P44513 3.94e-28 113 32 4 237 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9K8N1 4.3e-28 111 31 7 260 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q31I51 5.09e-28 110 33 7 244 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P96117 5.39e-28 111 31 7 257 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q97JB8 6.04e-28 111 32 6 220 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P54537 6.2e-28 110 35 7 227 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q4QP85 8.55e-28 112 32 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q6GEL3 9.9e-28 110 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q7A470 9.9e-28 110 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 9.9e-28 110 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2ISN3 1.11e-27 110 31 5 239 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
O26236 1.14e-27 110 32 8 227 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9CIS9 1.34e-27 110 33 6 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
B5YPZ7 1.82e-27 109 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5W0 1.82e-27 109 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7
Q132E8 1.84e-27 109 31 4 239 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
O68106 2.14e-27 109 34 7 236 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q2YYM4 2.15e-27 109 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q89C51 2.36e-27 109 32 6 253 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5LUR8 2.56e-27 108 32 8 241 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6LX68 2.84e-27 109 30 7 234 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8TIX0 2.99e-27 110 28 5 239 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q0ASQ1 3.59e-27 108 32 8 259 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q839D5 4.78e-27 108 31 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q4A5A5 5.57e-27 108 32 6 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
Q5FA19 6.93e-27 110 34 4 231 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q18KE1 7.02e-27 108 30 9 266 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q8VNL9 7.1e-27 108 32 5 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q5HDY6 7.61e-27 108 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 7.61e-27 108 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 7.61e-27 108 29 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
A0A0H2ZLL3 8.62e-27 107 31 4 228 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1RB86 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain UTI89 / UPEC)
Q8FH28 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THB9 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABP5 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O1:K1 / APEC
B7MV91 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O81 (strain ED1a)
B7MAS0 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US48 9.64e-27 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A0ALT7 1.02e-26 108 31 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q7M8M4 1.03e-26 107 31 6 243 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q6KHL1 1.05e-26 107 30 7 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q3Z257 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella sonnei (strain Ss046)
Q7C1M3 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri
Q0T4R9 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri serotype 5b (strain 8401)
Q32FJ0 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella dysenteriae serotype 1 (strain Sd197)
B1LE21 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SMS-3-5 / SECEC)
B6I8R4 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SE11)
B7N547 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPL8 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q1 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O9:H4 (strain HS)
B7M1B8 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O8 (strain IAI1)
B7NTS2 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L6I2 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain 55989 / EAEC)
A7ZMH7 1.09e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q04G50 1.27e-26 109 31 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B2U358 1.29e-26 107 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8ELR4 1.33e-26 109 32 8 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q20Y31 1.7e-26 107 31 6 247 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q032H4 1.71e-26 107 32 6 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 1.71e-26 107 32 6 219 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
Q92VJ2 1.73e-26 108 33 6 227 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q8RCU0 2.23e-26 106 33 7 217 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B7VPD0 2.4e-26 106 32 6 226 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio atlanticus (strain LGP32)
Q8UH62 2.72e-26 108 32 4 220 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P06611 2.72e-26 106 34 6 232 1 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12)
B1XG16 2.72e-26 106 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / DH10B)
C4ZYH1 2.72e-26 106 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / MC4100 / BW2952)
Q321G6 2.93e-26 106 34 6 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 4 (strain Sb227)
Q8A883 3.16e-26 109 33 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q10V16 3.55e-26 106 31 7 241 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Trichodesmium erythraeum (strain IMS101)
Q58967 3.81e-26 106 33 9 231 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7N6Z2 4.72e-26 107 33 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3KCC5 4.82e-26 107 31 5 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q38UT9 5.3e-26 106 32 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q5L222 6.37e-26 107 33 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q71WH7 6.95e-26 105 31 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serotype 4b (strain F2365)
O27739 8.6e-26 106 32 8 228 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q042G7 8.64e-26 107 31 4 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q65M34 9.75e-26 106 31 8 238 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Y454 9.8e-26 105 30 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q4QK57 1.08e-25 107 31 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
B5QVV9 1.38e-25 104 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella enteritidis PT4 (strain P125109)
Q1WSB9 1.4e-25 105 29 5 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q9WXX8 1.48e-25 103 32 6 230 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q927N8 1.53e-25 104 30 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q03PY5 1.58e-25 104 33 6 218 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8YK28 1.63e-25 104 32 8 254 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P63354 1.67e-25 106 32 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.67e-25 106 32 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9G4F5 1.84e-25 105 32 4 246 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q31DV4 1.97e-25 104 32 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P63351 1.97e-25 103 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63352 1.97e-25 103 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhi
B4TGI0 1.97e-25 103 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella heidelberg (strain SL476)
B5FJ99 1.97e-25 103 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella dublin (strain CT_02021853)
Q57PU4 1.97e-25 103 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella choleraesuis (strain SC-B67)
Q890R2 2.02e-25 104 31 8 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium tetani (strain Massachusetts / E88)
Q8YUI9 2.09e-25 103 35 5 221 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2IYS5 2.25e-25 104 32 8 251 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q50966 2.57e-25 105 33 4 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q4W575 2.68e-25 105 33 4 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.68e-25 105 33 4 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9I6L0 2.83e-25 105 33 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6D734 2.91e-25 105 29 4 222 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q88ZJ6 2.96e-25 105 30 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q74K65 3.03e-25 105 30 4 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q07LY2 3.08e-25 103 31 5 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q8PZN0 3.33e-25 106 31 8 235 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A5F1V0 3.68e-25 103 36 9 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q890D1 3.79e-25 102 39 6 187 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q3MGT2 3.79e-25 103 35 5 221 3 phnC Phosphonates import ATP-binding protein PhnC Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q64SQ6 3.8e-25 106 32 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
P45171 4.17e-25 105 31 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5LBT4 4.19e-25 106 32 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8PSR0 4.72e-25 107 31 7 254 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PSR0 3e-18 87 30 9 226 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B5BA33 4.88e-25 102 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain AKU_12601)
Q5PH81 4.88e-25 102 33 7 241 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6D654 4.98e-25 102 37 5 213 3 btuD Vitamin B12 import ATP-binding protein BtuD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8TTN2 5.03e-25 106 31 7 232 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q7AH43 5.07e-25 104 28 4 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q89AJ0 5.17e-25 102 30 5 221 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q03EE4 5.38e-25 103 30 6 245 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q0SBZ1 5.4e-25 104 31 9 263 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
A3CVD3 5.4e-25 103 31 3 219 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
P47425 6.35e-25 103 32 7 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q7VNG4 6.92e-25 104 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6NBX6 7.01e-25 102 31 5 236 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2JLH7 7.09e-25 102 32 7 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q03PF2 7.26e-25 104 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6MCV4 7.69e-25 104 32 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q73P71 7.96e-25 102 31 9 242 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q57S53 8.26e-25 103 33 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q9KD30 8.67e-25 102 31 8 245 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2FNX9 9.08e-25 102 29 4 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q88CL2 9.6e-25 103 33 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P21410 9.72e-25 103 29 9 280 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
A3DJK3 9.8e-25 102 32 6 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3SGJ8 1.03e-24 102 31 5 230 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q160Y9 1.07e-24 102 32 8 235 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
O85818 1.34e-24 103 31 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7N8B9 1.38e-24 103 30 4 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C3LLU1 1.46e-24 101 33 8 242 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 1.46e-24 101 33 8 242 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q98GF5 1.53e-24 102 30 6 248 3 phnC Phosphonates import ATP-binding protein PhnC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6NA00 1.57e-24 102 31 7 263 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1WSB8 1.62e-24 102 30 6 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q8Z8R5 1.64e-24 103 33 5 221 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8PYH5 1.67e-24 103 29 4 213 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q81CT8 1.7e-24 105 31 5 230 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 2.19e-12 70 25 8 243 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8ZR89 1.72e-24 103 33 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57399 1.89e-24 101 33 7 227 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7N3A6 2.01e-24 100 36 8 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q04EY5 2.08e-24 101 34 6 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7MLE6 2.21e-24 101 32 10 251 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio vulnificus (strain YJ016)
Q0SML1 2.33e-24 103 30 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q38VW6 2.64e-24 103 31 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q0S0Z3 2.68e-24 102 33 8 240 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q8Z0H0 2.84e-24 102 29 6 266 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O69063 2.94e-24 102 31 7 244 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q92XW1 3.07e-24 102 31 4 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q63E84 3.42e-24 102 29 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.42e-24 102 29 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.42e-24 102 29 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q66A01 3.68e-24 100 33 11 251 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 3.68e-24 100 33 11 251 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
Q6HLQ9 4.11e-24 102 29 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8D928 4.13e-24 100 31 10 251 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio vulnificus (strain CMCP6)
Q9V1Q4 4.14e-24 101 32 8 238 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q82WT5 4.45e-24 102 30 3 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q14Q07 4.47e-24 102 31 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q98QH5 4.53e-24 100 31 6 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9MUN1 5.02e-24 102 31 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q03ZQ0 5.42e-24 102 30 8 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q81TH8 5.53e-24 101 29 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
P37009 5.73e-24 102 28 4 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q668K6 5.81e-24 102 32 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8CUY0 5.94e-24 100 32 11 256 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0S0X2 5.97e-24 100 34 6 219 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q8EUF1 6.02e-24 100 32 7 227 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Malacoplasma penetrans (strain HF-2)
Q9KIF7 6.36e-24 102 35 7 232 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q0SWH9 6.44e-24 100 28 7 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q2SJY7 7.3e-24 102 31 5 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q21PQ7 7.57e-24 100 31 8 246 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1MMZ3 7.62e-24 100 29 5 246 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1R5D8 7.65e-24 100 34 6 234 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 7.65e-24 100 34 6 234 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 7.65e-24 100 34 6 234 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3ISC1 7.73e-24 99 31 5 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8CRI6 7.8e-24 100 27 6 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM27 7.8e-24 100 27 6 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q07PZ0 8.21e-24 100 32 9 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q0TUN8 8.25e-24 100 28 7 234 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3AKM8 8.37e-24 99 33 6 233 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q8D0W8 8.45e-24 101 32 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8TK65 8.65e-24 102 30 8 243 3 MA_3551 Putative ABC transporter ATP-binding protein MA_3551 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q0A9E2 8.69e-24 99 29 6 246 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q6WB63 8.8e-24 100 31 7 244 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
P14788 8.84e-24 101 30 5 265 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q035B2 9.41e-24 100 32 5 225 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P74548 9.54e-24 101 31 5 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q110U3 9.66e-24 101 32 5 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q5PCG9 1.01e-23 101 33 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q65TB7 1.02e-23 99 35 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I3Y9 1.12e-23 101 29 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
O86751 1.22e-23 101 33 5 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8DMX9 1.23e-23 99 28 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 1.23e-23 99 28 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 1.23e-23 99 28 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q0RYP7 1.26e-23 100 31 9 253 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q72FW5 1.31e-23 101 31 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q032D0 1.33e-23 99 31 5 236 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q9KFN9 1.39e-23 99 30 7 258 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q81GC1 1.43e-23 100 30 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q3A9G5 1.45e-23 100 33 6 218 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P16678 1.53e-23 99 34 9 241 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q88ZZ2 1.54e-23 102 28 5 237 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 1.49e-17 85 28 6 239 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6D201 1.54e-23 100 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5HBR8 1.56e-23 98 27 6 237 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.56e-23 98 27 6 237 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q9KFL0 1.59e-23 98 30 8 234 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q31VE6 1.6e-23 99 33 6 234 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q8XNY7 1.65e-23 99 28 7 232 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q5WBL0 1.65e-23 98 29 5 232 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q1B677 1.73e-23 100 30 6 230 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
O34900 1.81e-23 99 30 7 233 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q03AH0 1.95e-23 100 30 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q1GIE5 1.98e-23 100 32 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q88XV2 2.05e-23 99 29 5 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9K876 2.11e-23 100 31 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1WXT0 2.18e-23 98 28 5 245 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q7W9U5 2.25e-23 100 31 5 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8ESM5 2.28e-23 98 28 7 260 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A3DDF6 2.28e-23 100 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q660M8 2.37e-23 100 30 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q2JPW6 2.41e-23 98 31 5 247 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8X5I6 2.46e-23 98 33 5 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q6D2F6 2.59e-23 100 28 6 244 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q50294 2.59e-23 99 32 8 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q65UE1 2.59e-23 100 30 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65P77 2.62e-23 99 30 6 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P31134 2.74e-23 100 33 9 252 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q5FL41 2.94e-23 100 31 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q2SPI3 3.23e-23 98 29 6 241 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
O51587 3.24e-23 99 30 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8TYV9 3.4e-23 98 30 3 220 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q32AQ1 3.77e-23 98 33 6 234 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q9CIQ6 3.8e-23 97 31 5 236 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. lactis (strain IL1403)
Q8XBJ8 3.86e-23 100 33 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q18CJ0 3.92e-23 98 30 10 247 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridioides difficile (strain 630)
Q2GJA5 3.93e-23 97 27 5 226 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q7WGW1 4.05e-23 99 31 5 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q30W28 4.11e-23 98 31 8 254 3 phnC Phosphonates import ATP-binding protein PhnC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P16676 4.23e-23 99 33 6 228 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8X4L6 4.31e-23 98 33 6 224 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
P37774 4.38e-23 97 33 10 250 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P54954 4.48e-23 97 30 8 233 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q8FFB3 4.54e-23 99 33 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5WCI1 4.73e-23 97 32 5 224 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
P56344 4.74e-23 97 33 5 226 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q9KS33 4.81e-23 99 29 7 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CN78 4.93e-23 97 36 6 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q2FRT7 5e-23 100 30 6 220 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q65S66 5.12e-23 99 27 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5WIL7 5.16e-23 97 32 8 243 3 phnC Phosphonates import ATP-binding protein PhnC Shouchella clausii (strain KSM-K16)
A3CRB9 5.45e-23 98 29 8 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus sanguinis (strain SK36)
Q1AS06 5.65e-23 99 32 6 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8F6Z1 5.8e-23 99 30 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 5.8e-23 99 30 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q32IZ6 5.83e-23 97 33 5 212 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q9KLQ5 6.02e-23 99 29 6 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0SFW6 6.13e-23 99 32 8 240 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q3YW48 6.52e-23 97 33 6 228 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q92V71 6.6e-23 97 30 5 249 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
Q6LKD4 6.66e-23 99 27 6 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q8DWR3 6.67e-23 97 30 5 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 6.67e-23 97 30 5 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 6.67e-23 97 30 5 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q16BC5 7.15e-23 97 27 6 244 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3Z542 7.79e-23 97 33 5 212 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 7.79e-23 97 33 5 212 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q81J16 7.85e-23 97 30 7 253 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P27675 8.13e-23 96 30 7 232 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q2NIT5 8.29e-23 97 30 7 225 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q2NHA1 8.48e-23 97 30 8 240 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q21BU8 8.59e-23 99 30 6 238 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q160M2 8.63e-23 99 33 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
O59479 8.86e-23 97 30 8 249 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8E8K8 9.18e-23 99 31 3 221 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8RFN2 9.24e-23 98 32 6 224 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q98HF7 9.37e-23 99 33 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7VZE5 1.08e-22 98 31 5 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P33594 1.08e-22 97 33 6 218 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
O32169 1.1e-22 98 31 7 244 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q325N3 1.23e-22 96 33 5 212 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q81XB3 1.24e-22 96 24 2 245 1 fatE Petrobactin import ATP-binding protein FatE Bacillus anthracis
Q8ES39 1.27e-22 99 30 6 222 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 1.5e-15 79 27 7 224 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q73EL7 1.27e-22 98 31 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q2KDV1 1.3e-22 97 28 5 246 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q67JX4 1.3e-22 97 33 8 224 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3KBH4 1.48e-22 98 33 4 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q8NQH4 1.55e-22 96 33 10 251 3 phnC Phosphonates import ATP-binding protein PhnC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q73F67 1.6e-22 96 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q98K23 1.63e-22 97 32 4 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8KFD6 1.7e-22 97 28 5 234 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8XK20 1.82e-22 99 28 10 255 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.46e-11 67 24 8 231 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q7UC29 1.92e-22 98 32 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q6D3Q6 1.92e-22 97 32 5 215 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O34392 1.93e-22 95 30 7 236 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q30V33 1.93e-22 98 28 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q55281 1.96e-22 96 28 8 246 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q32HA3 2.09e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8UA73 2.12e-22 97 30 4 213 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6YR39 2.14e-22 96 31 8 233 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Onion yellows phytoplasma (strain OY-M)
Q9X0Y8 2.21e-22 95 30 8 244 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q83KR7 2.23e-22 95 32 6 243 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 2.23e-22 95 32 6 243 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
P10346 2.25e-22 95 29 6 224 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q6HP89 2.28e-22 97 31 8 235 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 2.31e-22 97 31 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q7NAQ6 2.32e-22 96 30 11 240 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q8PY26 2.35e-22 96 30 7 241 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q63GR8 2.35e-22 97 31 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
A0LCH8 2.46e-22 95 30 5 237 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q88AS5 2.47e-22 97 31 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1RFH8 2.59e-22 95 33 5 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 2.59e-22 95 33 5 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A0PXX7 2.59e-22 96 28 7 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium novyi (strain NT)
Q7VMV4 2.66e-22 95 34 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q65VG9 2.7e-22 97 32 6 216 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I2Z4 2.73e-22 97 27 4 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q6MUF4 2.77e-22 95 32 8 242 3 phnC Phosphonates import ATP-binding protein PhnC Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q1CJS9 2.87e-22 97 29 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.87e-22 97 29 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.87e-22 97 29 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q2YKZ7 2.97e-22 97 30 3 223 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 2.97e-22 97 30 3 223 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q6HPN0 3.02e-22 96 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 3.02e-22 96 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 3.02e-22 96 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q668Q3 3.14e-22 97 29 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8UIW7 3.18e-22 96 28 7 251 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8FVT0 3.18e-22 97 30 3 223 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q3Z2L6 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 3.2e-22 95 31 4 238 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 3.2e-22 95 31 4 238 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q8FKF5 3.22e-22 95 33 5 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0AGP9 3.24e-22 97 31 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q93DX8 3.4e-22 95 32 6 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q60AI1 3.47e-22 97 35 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q58206 3.49e-22 95 30 8 228 1 MJ0796 Uncharacterized ABC transporter ATP-binding protein MJ0796 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q39GW5 3.71e-22 96 29 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8Y8T6 3.72e-22 97 31 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0LUE6 3.73e-22 97 30 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q98G43 3.73e-22 97 28 3 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5QU46 3.8e-22 94 34 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q89UD2 3.92e-22 97 32 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q830W6 3.97e-22 97 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q92DL6 4e-22 97 31 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9CP06 4.26e-22 97 31 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q0BFQ0 4.51e-22 96 29 5 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BWL4 4.51e-22 96 29 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 4.51e-22 96 29 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q8R7Y4 4.7e-22 95 29 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0PY57 4.73e-22 96 29 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q722B1 4.88e-22 97 31 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q11D92 5.03e-22 94 30 4 205 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
Q8RGC8 5.06e-22 97 29 5 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q49ZE0 5.12e-22 95 28 5 236 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1TXH7 5.17e-22 97 31 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0BMC9 5.22e-22 96 33 6 225 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 5.22e-22 96 33 6 225 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
P44692 5.57e-22 95 30 7 250 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q85A69 5.84e-22 97 31 6 233 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
P40860 6.4e-22 96 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 6.52e-22 96 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q6YRJ4 6.66e-22 98 31 8 235 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 4.93e-08 57 23 8 243 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q5E882 6.86e-22 94 32 4 219 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6FFZ1 6.97e-22 94 33 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6LTB1 7.17e-22 94 28 5 242 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q578K3 7.24e-22 96 31 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 7.24e-22 96 31 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q6F0V4 7.57e-22 96 28 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q8DIA0 7.86e-22 95 31 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5L3R0 8.21e-22 94 28 6 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)
Q8ETV6 8.31e-22 95 31 4 218 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06920
Feature type CDS
Gene -
Product heme ABC transporter ATP-binding protein
Location 1514608 - 1515402 (strand: 1)
Length 795 (nucleotides) / 264 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1794
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4559 Inorganic ion transport and metabolism (P) P ABC-type hemin transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10834 heme transport system ATP-binding protein [EC:7.6.2.5] - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044295 heme ABC transporter ATP-binding protein VF1253 Nutritional/Metabolic factor

Protein Sequence

MMENQHTPLLYGNNLSYKIGNKTILEDVSIALNTGELVTIIGPNGAGKSSLLRLLTGYTPPTQGECFFKGKTYSQWNSQLLAQNRAVMRQNSQLSFSFSVEEVVAMGRAPHGQKHKQIAIETALLQTNCLKLKTRDYRQLSGGEQQRVQLARVLAQLWQPTPENVALFLDEPTSALDLYHQQQSLRLLKQLVKTQNLMVCCVLHDLNLASLYADRILLLHQGKLVCEGTPQDVLTAENIEKWYGAEVSVNTHPELSQPQVFLRP

Flanking regions ( +/- flanking 50bp)

GGACCTTATTTTCTTTGGCTTATTTTACGACAACCAGCAGGACGCATGTCATGATGGAAAATCAACACACTCCATTATTATATGGCAATAACTTGAGCTATAAAATCGGCAATAAAACTATTCTTGAGGATGTTTCTATTGCACTTAATACCGGTGAGCTTGTCACAATCATTGGTCCGAATGGTGCTGGGAAATCATCATTATTACGTTTATTGACCGGCTATACTCCCCCGACACAAGGAGAATGTTTTTTTAAAGGGAAAACTTACTCACAGTGGAATAGTCAATTATTAGCGCAAAACCGTGCTGTTATGCGACAAAACAGCCAGCTATCATTCTCTTTTTCTGTAGAAGAAGTCGTCGCTATGGGAAGAGCGCCACATGGGCAAAAACATAAACAAATCGCAATAGAAACCGCGCTATTACAAACCAATTGTTTAAAGCTTAAAACAAGAGATTACCGTCAATTATCAGGTGGAGAGCAACAAAGAGTGCAACTTGCTAGAGTGCTTGCTCAACTTTGGCAACCGACACCTGAGAATGTTGCGCTATTTCTTGATGAACCCACATCGGCACTTGACCTCTACCACCAGCAACAAAGTTTGCGTTTATTAAAGCAACTGGTCAAAACGCAAAATTTGATGGTGTGTTGTGTTCTGCACGATCTCAACCTCGCCTCCCTTTATGCTGATCGTATTTTATTACTGCATCAGGGAAAATTAGTTTGCGAAGGTACACCTCAAGATGTACTCACCGCTGAGAATATTGAAAAATGGTATGGCGCCGAGGTCAGTGTTAATACTCATCCTGAGTTATCTCAACCTCAAGTTTTTTTACGCCCATAAATAATAAAAGAGAAAGGACTGAGTCCTGTTGAATGCAGAGCTCAGTCCTT