Homologs in group_1793

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13310 FBDBKF_13310 52.6 Morganella morganii S1 fepD ABC-type Fe3+-siderophore transport system, permease component
EHELCC_08785 EHELCC_08785 52.6 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_09110 NLDBIP_09110 52.6 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_05155 LHKJJB_05155 52.6 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
HKOGLL_05760 HKOGLL_05760 52.6 Morganella morganii S5 fepD ABC-type Fe3+-siderophore transport system, permease component
F4V73_RS03445 F4V73_RS03445 54.1 Morganella psychrotolerans - iron ABC transporter permease

Distribution of the homologs in the orthogroup group_1793

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1793

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56992 1.43e-142 409 68 0 308 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
Q6LQ76 1.99e-59 197 40 4 313 3 btuC Vitamin B12 import system permease protein BtuC Photobacterium profundum (strain SS9)
A6TAH6 1.75e-58 194 42 6 283 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7MLE7 1.59e-57 192 42 4 284 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
Q8D927 2.97e-57 191 40 4 284 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
A8GDR2 7.54e-57 190 38 4 291 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
B1JJ25 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Z9 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype I (strain IP32953)
A9R099 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX4 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis
B2K660 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHG9 2.64e-56 189 35 4 315 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JPQ9 6.84e-56 187 38 2 275 3 btuC Vitamin B12 import system permease protein BtuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q57552 1.73e-54 184 37 3 292 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57130 1.56e-52 179 35 7 330 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A8AHA4 4.06e-52 177 41 4 277 3 btuC Vitamin B12 import system permease protein BtuC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D656 2.65e-51 176 37 3 286 3 btuC Vitamin B12 import system permease protein BtuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5BA35 4.18e-51 175 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain AKU_12601)
Q5PH87 4.18e-51 175 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q32FI8 4.91e-51 175 40 6 283 3 btuC Vitamin B12 import system permease protein BtuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z6I5 4.96e-51 175 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhi
B4T4N5 7.05e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella newport (strain SL254)
B5RAW6 7.05e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVW1 7.05e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella enteritidis PT4 (strain P125109)
Q8ZPS8 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUF7 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella schwarzengrund (strain CVM19633)
A9N235 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGH8 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella heidelberg (strain SL476)
B5FJA1 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella dublin (strain CT_02021853)
B5F7F5 8.37e-51 174 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella agona (strain SL483)
Q3Z259 1.05e-50 174 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
Q57PU6 2.94e-50 173 39 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella choleraesuis (strain SC-B67)
A9MFB6 3.69e-50 172 39 4 277 3 btuC Vitamin B12 import system permease protein BtuC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9KSL2 5.52e-50 172 37 5 329 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O34451 7.28e-50 172 35 3 313 3 yvrB Uncharacterized ABC transporter permease protein YvrB Bacillus subtilis (strain 168)
Q7N3Q3 9.31e-49 169 39 4 283 3 btuC Vitamin B12 import system permease protein BtuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B7N549 6.77e-48 167 40 6 295 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q87Q39 7.28e-48 167 37 2 262 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7C1M5 1.09e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri
B6I8R6 1.12e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SE11)
B7M1C0 1.22e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O8 (strain IAI1)
A7ZMH9 1.22e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T4S1 1.38e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri serotype 5b (strain 8401)
Q1RB84 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain UTI89 / UPEC)
B1LE19 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SMS-3-5 / SECEC)
P06609 1.52e-47 166 40 5 282 1 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12)
A1ABP7 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O1:K1 / APEC
B1XG18 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / DH10B)
C4ZYH3 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / MC4100 / BW2952)
B7NT65 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAS2 1.52e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7MVJ0 1.65e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O81 (strain ED1a)
Q0THB7 1.84e-47 166 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O31569 1.93e-47 166 34 8 339 1 yfhA Probable siderophore transport system permease protein YfhA Bacillus subtilis (strain 168)
B5YPZ9 2.37e-47 165 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4L7 2.37e-47 165 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7
B7US50 2.42e-47 165 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7L6I4 3.41e-47 165 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain 55989 / EAEC)
B1IPL6 3.52e-47 165 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q3 3.52e-47 165 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O9:H4 (strain HS)
Q8FH26 3.59e-47 165 40 5 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7LQ78 3.75e-47 165 40 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2U360 3.87e-47 165 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O34832 5.34e-46 162 36 7 333 3 yfmE Fe(3+)-citrate import system permease protein YfmE Bacillus subtilis (strain 168)
Q321G8 1.1e-45 161 40 4 277 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 4 (strain Sb227)
P49937 2.84e-45 160 32 6 336 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
Q81L64 3.62e-43 160 35 7 333 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q81L64 7.46e-34 134 35 6 310 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q9HQ19 9.91e-43 154 36 4 276 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 9.91e-43 154 36 4 276 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P15029 4.67e-42 151 37 7 298 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
P40411 1.02e-41 150 32 10 336 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
O34933 1.77e-41 150 34 6 298 3 yfmD Fe(3+)-citrate import system permease protein YfmD Bacillus subtilis (strain 168)
O05731 3.54e-41 149 36 5 282 3 HP_0889 Probable iron chelatin transport system permease protein HP_0889 Helicobacter pylori (strain ATCC 700392 / 26695)
P49936 7.14e-41 150 32 5 324 3 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Bacillus subtilis (strain 168)
P15030 3.55e-40 147 36 4 279 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
O31568 7.05e-40 146 33 9 336 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
Q9ZKW2 7.73e-40 145 36 5 282 3 jhp_0822 Probable iron chelatin transport system permease protein jhp_0822 Helicobacter pylori (strain J99 / ATCC 700824)
Q47085 2.51e-37 139 34 4 295 3 cbrB Achromobactin transport system permease protein CbrB Dickeya dadantii (strain 3937)
Q2YX91 7.76e-35 132 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain bovine RF122 / ET3-1)
P40410 1.88e-34 131 33 4 297 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
P23876 5.21e-34 130 36 5 289 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
Q6GHV2 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MRSA252)
Q7A651 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain N315)
Q99UX0 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG35 7.85e-32 124 32 6 317 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Newman)
Q5HGV0 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain COL)
Q2FHU7 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain USA300)
A7X154 7.85e-32 124 32 6 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NX64 2.08e-31 123 32 5 312 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MW2)
Q6GA81 2.08e-31 123 32 5 312 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MSSA476)
P37738 8.35e-31 121 30 6 310 1 fatD Ferric-anguibactin transport system permease protein FatD Vibrio anguillarum (strain ATCC 68554 / 775)
Q2FZE5 9.26e-29 116 32 7 317 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q58286 1.61e-28 116 30 10 308 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P23877 5.75e-27 111 32 2 274 1 fepG Ferric enterobactin transport system permease protein FepG Escherichia coli (strain K12)
Q47086 1.39e-23 102 35 7 282 3 cbrC Achromobactin transport system permease protein CbrC Dickeya dadantii (strain 3937)
P94418 1.37e-20 94 26 4 322 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
O87656 2.14e-20 95 29 2 274 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87656 2.06e-14 77 29 7 289 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P06972 4.14e-20 94 32 8 281 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P06972 6.95e-13 72 30 8 288 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
Q81XB1 4.71e-17 84 26 4 289 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis
P94419 2.24e-14 76 25 7 299 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)
Q58287 3.54e-11 63 40 1 81 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q81XB2 0.000118 47 24 4 279 1 fatC Petrobactin import system permease protein FatC Bacillus anthracis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06915
Feature type CDS
Gene -
Product iron ABC transporter permease
Location 1513607 - 1514611 (strand: 1)
Length 1005 (nucleotides) / 334 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1793
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0609 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-siderophore transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K25133 heme transport system permease protein - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044294 iron ABC transporter permease VF1253 Nutritional/Metabolic factor

Protein Sequence

MSRFRSPWMSIAILLILFTIITLISVNSGPLALSFSTLWDRSFDDIEWQIWLDIRLPRVLLAILVGGALAISGTIMQGLFRNSLADPGLLGISSGAALMVAIVIILPFSFLSVFSFYSHIIAAFIGGLIVAMIIFSLHQLSDGNLARLLLAGIAINALCMSFIGVLSYISTDQQLRQFSLWMMGSLSKIDWNTLAIATLVIIPISALACWQGHKLNLLQLGDEEAHYLGLNVRKTKFILLLLSAILIGCAVALSGVIGFVGLVVPHLIRMRLGSNHIWLLPATLLGGAILLLAADTLSRTLVSPAEIPVGLITGLLGGPYFLWLILRQPAGRMS

Flanking regions ( +/- flanking 50bp)

TTATCAACCCCCAAAGTTATGCAACAAATTCGTCAAGCATTGGAGCAATAATGTCTCGTTTTCGCTCACCGTGGATGAGTATTGCCATTTTACTCATCTTATTTACCATCATTACGCTTATTTCTGTTAATAGCGGCCCGCTAGCACTCTCATTTAGTACTTTATGGGATCGCTCTTTTGATGATATAGAGTGGCAAATTTGGCTTGATATTCGTTTACCTCGAGTACTATTAGCTATTCTCGTCGGTGGCGCTTTAGCCATATCAGGCACCATCATGCAAGGACTATTTAGAAACTCACTTGCCGATCCTGGATTACTAGGTATTAGCAGTGGTGCTGCGCTAATGGTCGCTATTGTGATTATTTTACCCTTCTCTTTTTTATCCGTATTTTCTTTCTACAGTCATATTATTGCCGCCTTTATTGGCGGCTTAATAGTGGCAATGATTATTTTTTCATTGCATCAATTAAGTGATGGTAACTTGGCAAGATTGCTCCTAGCGGGAATTGCCATTAATGCGCTTTGTATGTCTTTTATTGGTGTATTGAGCTATATCAGCACAGATCAGCAACTGCGCCAATTTTCACTATGGATGATGGGCTCTTTAAGTAAAATAGACTGGAACACCTTGGCGATTGCAACTCTCGTGATTATTCCCATTAGTGCATTAGCCTGTTGGCAAGGTCATAAACTTAACCTATTACAACTCGGTGATGAAGAAGCACATTATTTAGGGTTAAATGTAAGAAAAACAAAATTTATTTTACTACTACTCAGTGCCATTTTAATCGGTTGTGCCGTTGCATTAAGTGGTGTTATTGGGTTTGTTGGTCTTGTGGTGCCCCACCTTATTCGTATGCGATTAGGCAGTAACCATATTTGGTTATTACCGGCCACCCTATTAGGGGGAGCAATACTCTTATTAGCCGCAGATACCCTGTCAAGAACCTTGGTATCCCCTGCGGAAATTCCTGTAGGACTTATTACCGGACTTCTTGGTGGACCTTATTTTCTTTGGCTTATTTTACGACAACCAGCAGGACGCATGTCATGATGGAAAATCAACACACTCCATTATTATATGGCAATAACTTGAGCTATAAA