Homologs in group_335

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13310 FBDBKF_13310 100.0 Morganella morganii S1 fepD ABC-type Fe3+-siderophore transport system, permease component
EHELCC_08785 EHELCC_08785 100.0 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_09110 NLDBIP_09110 100.0 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_05155 LHKJJB_05155 100.0 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
F4V73_RS03445 F4V73_RS03445 77.0 Morganella psychrotolerans - iron ABC transporter permease
PMI_RS06915 PMI_RS06915 52.6 Proteus mirabilis HI4320 - iron ABC transporter permease
PMI_RS14625 PMI_RS14625 28.2 Proteus mirabilis HI4320 - iron chelate uptake ABC transporter family permease subunit

Distribution of the homologs in the orthogroup group_335

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_335

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56992 1.27e-104 312 56 3 306 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
Q6LQ76 7.76e-51 174 41 4 279 3 btuC Vitamin B12 import system permease protein BtuC Photobacterium profundum (strain SS9)
Q8D927 9.96e-51 174 41 4 280 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
Q7MLE7 1.61e-50 173 40 4 280 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
Q57552 1.83e-49 171 37 5 291 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6TAH6 3.68e-49 170 39 3 283 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8GDR2 2.98e-48 167 37 4 285 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
B1JJ25 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Z9 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype I (strain IP32953)
A9R099 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX4 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis
B2K660 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHG9 4.14e-48 167 37 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
O31569 1.24e-47 166 36 3 282 1 yfhA Probable siderophore transport system permease protein YfhA Bacillus subtilis (strain 168)
O34451 1.46e-47 166 36 6 322 3 yvrB Uncharacterized ABC transporter permease protein YvrB Bacillus subtilis (strain 168)
A1JPQ9 3.5e-47 165 38 5 285 3 btuC Vitamin B12 import system permease protein BtuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6D656 2.82e-46 162 37 3 283 3 btuC Vitamin B12 import system permease protein BtuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z259 3.51e-46 162 38 5 293 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
Q81L64 4.53e-46 169 36 7 299 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q81L64 3.85e-26 112 31 7 313 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
P15029 9.13e-46 160 38 7 311 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
Q8Z6I5 1.15e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhi
B5BA35 1.23e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain AKU_12601)
Q5PH87 1.23e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4N5 1.28e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella newport (strain SL254)
B5RAW6 1.28e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVW1 1.28e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella enteritidis PT4 (strain P125109)
Q8ZPS8 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUF7 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella schwarzengrund (strain CVM19633)
A9N235 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGH8 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella heidelberg (strain SL476)
B5FJA1 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella dublin (strain CT_02021853)
B5F7F5 1.63e-45 160 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella agona (strain SL483)
Q32FI8 5.08e-45 159 40 6 291 3 btuC Vitamin B12 import system permease protein BtuC Shigella dysenteriae serotype 1 (strain Sd197)
Q57PU6 5.89e-45 159 39 4 288 3 btuC Vitamin B12 import system permease protein BtuC Salmonella choleraesuis (strain SC-B67)
Q9KSL2 6.18e-45 159 39 4 276 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P49937 2.12e-44 157 35 9 326 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
A8AHA4 2.73e-44 157 38 4 291 3 btuC Vitamin B12 import system permease protein BtuC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57130 3.11e-44 157 37 4 292 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9MFB6 5.67e-44 156 38 5 290 3 btuC Vitamin B12 import system permease protein BtuC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q87Q39 9.7e-43 153 39 4 260 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B1IPL6 8.08e-42 150 39 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q3 8.08e-42 150 39 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O9:H4 (strain HS)
B7L6I4 8.43e-42 150 39 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain 55989 / EAEC)
B2U360 8.61e-42 150 39 5 293 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O05731 1.11e-41 150 36 3 293 3 HP_0889 Probable iron chelatin transport system permease protein HP_0889 Helicobacter pylori (strain ATCC 700392 / 26695)
Q0T4S1 1.38e-41 150 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri serotype 5b (strain 8401)
Q8FH26 2.02e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7M1C0 2.09e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O8 (strain IAI1)
A7ZMH9 2.09e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I8R6 2.25e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SE11)
B7N549 2.32e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7MVJ0 2.69e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O81 (strain ED1a)
Q7C1M5 2.75e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri
Q1RB84 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain UTI89 / UPEC)
B1LE19 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SMS-3-5 / SECEC)
P06609 2.87e-41 149 39 5 290 1 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12)
A1ABP7 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O1:K1 / APEC
B1XG18 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / DH10B)
C4ZYH3 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / MC4100 / BW2952)
B7NT65 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAS2 2.87e-41 149 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0THB7 3.29e-41 149 39 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LQ78 7.25e-41 148 38 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7US50 1.52e-40 147 39 5 290 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5YPZ9 1.62e-40 147 38 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4L7 1.62e-40 147 38 5 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7
Q9ZKW2 1.72e-40 147 35 3 293 3 jhp_0822 Probable iron chelatin transport system permease protein jhp_0822 Helicobacter pylori (strain J99 / ATCC 700824)
Q321G8 1.85e-40 147 38 5 293 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 4 (strain Sb227)
Q7N3Q3 4.32e-40 146 36 4 285 3 btuC Vitamin B12 import system permease protein BtuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P40411 5.35e-38 141 30 5 302 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
Q9HQ19 4.34e-37 139 36 9 308 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 4.34e-37 139 36 9 308 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P15030 5.05e-36 135 34 6 321 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
O34832 7.67e-36 135 35 8 321 3 yfmE Fe(3+)-citrate import system permease protein YfmE Bacillus subtilis (strain 168)
P49936 6.78e-35 134 34 6 295 3 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Bacillus subtilis (strain 168)
Q47085 5.63e-33 127 36 4 276 3 cbrB Achromobactin transport system permease protein CbrB Dickeya dadantii (strain 3937)
O34933 9.83e-33 127 32 3 273 3 yfmD Fe(3+)-citrate import system permease protein YfmD Bacillus subtilis (strain 168)
O31568 7.95e-31 122 32 5 283 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
P23876 6.31e-26 108 35 8 304 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
P40410 1.07e-25 108 30 6 289 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
Q2YX91 5.43e-23 100 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain bovine RF122 / ET3-1)
P23877 8.96e-23 100 33 6 321 1 fepG Ferric enterobactin transport system permease protein FepG Escherichia coli (strain K12)
Q47086 1.14e-22 100 32 3 288 3 cbrC Achromobactin transport system permease protein CbrC Dickeya dadantii (strain 3937)
Q6GHV2 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MRSA252)
Q7A651 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain N315)
Q99UX0 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG35 4.28e-22 97 31 5 274 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Newman)
Q5HGV0 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain COL)
Q2FHU7 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain USA300)
A7X154 4.28e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NX64 4.83e-22 97 31 5 274 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MW2)
Q6GA81 4.83e-22 97 31 5 274 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MSSA476)
O87656 6.54e-22 100 33 7 289 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87656 5.52e-16 82 31 11 279 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P06972 1.6e-21 98 33 4 283 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P06972 6.24e-11 67 30 13 276 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P37738 1.64e-21 96 28 5 284 1 fatD Ferric-anguibactin transport system permease protein FatD Vibrio anguillarum (strain ATCC 68554 / 775)
Q58286 2.82e-20 93 26 11 325 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2FZE5 2.23e-19 90 30 6 274 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain NCTC 8325 / PS 47)
P94418 6.13e-16 80 24 7 293 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
Q81XB1 6.19e-15 77 29 12 292 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis
P94419 8.9e-12 68 21 3 283 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)
Q58287 3.02e-07 52 34 1 86 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_05760
Feature type CDS
Gene fepD
Product ABC-type Fe3+-siderophore transport system, permease component
Location 218288 - 219280 (strand: -1)
Length 993 (nucleotides) / 330 (amino acids)
In genomic island -

Contig

Accession ZDB_682
Length 259781 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_335
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0609 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-siderophore transport system, permease component

Protein Sequence

MNNPPAFHLRRLCLCFLLVIMILTAMNTGGLPVSVSAFLRGEVTPQLWQIWLSVRLPRIVLAVLVGMALATAGVLLQGLFRNPLADPGLLGISSGAAVAVALGIVFIAPYLNGAVTLYLHIITAFSGALCISGLIFLLNRRRQPLLRLLLCGIAVNAISMSFVGVLNYLSDDKELRQFSLWMMGSTGHISWTLLLPAIVLTLPVFYAAFRLARPLDMIQLGEEEAHYAGVNVRRTQQCVLLISALLTGIAVALSGIIGFIGLVIPHLMRMIFGWHHRLLLVTSALAGALLLLLSDTLARTLVVPAEIPVGLLTGLLGAPYFLWLIFSVKE

Flanking regions ( +/- flanking 50bp)

CCGGATACACTGCATCAGTTACGTGAAGCGATGGAGGCAGCAGCCGTGTTATGAATAATCCGCCCGCCTTTCATCTGCGCCGCCTGTGCCTCTGTTTTCTGTTGGTGATCATGATATTAACTGCCATGAATACCGGCGGACTGCCGGTTTCTGTCAGTGCATTCCTGCGGGGTGAAGTAACCCCGCAACTCTGGCAGATCTGGTTATCTGTCCGTCTGCCGCGGATTGTTCTGGCAGTTCTGGTGGGCATGGCACTGGCCACCGCCGGAGTATTATTACAGGGATTATTCCGCAACCCGCTGGCAGACCCCGGTTTGCTCGGGATCAGCAGCGGCGCAGCCGTTGCGGTGGCACTGGGGATTGTCTTTATCGCGCCTTATCTGAATGGTGCGGTCACACTGTATCTGCATATTATTACTGCCTTCAGCGGTGCACTTTGTATCAGCGGACTGATTTTTCTGCTCAACCGCCGCCGTCAGCCTTTGCTGCGTCTGTTACTGTGCGGTATTGCCGTTAACGCAATCAGTATGTCCTTTGTCGGCGTGCTCAATTATCTGAGTGATGATAAAGAATTACGTCAGTTTTCACTGTGGATGATGGGCAGCACCGGGCACATCAGCTGGACTTTGCTTCTGCCTGCTATCGTACTGACACTCCCTGTGTTTTATGCCGCATTCAGACTGGCACGTCCGCTGGATATGATTCAGCTGGGGGAAGAAGAAGCGCATTATGCCGGAGTGAATGTCCGCCGGACACAACAGTGTGTCCTGCTGATCAGTGCCCTGCTCACCGGGATTGCCGTGGCACTGAGCGGGATTATCGGTTTTATCGGCCTGGTTATCCCGCACCTGATGCGTATGATTTTCGGCTGGCACCACCGGCTTCTGCTGGTGACATCAGCCCTTGCCGGTGCACTTCTGTTACTGCTCTCCGATACACTCGCCCGCACGCTGGTGGTTCCGGCAGAAATCCCGGTCGGATTACTGACCGGGCTGCTTGGCGCACCCTATTTTCTCTGGCTGATTTTCTCTGTGAAGGAATGATATGCCCCGTATAACCGCCAATAATCCGCCACCAGTGCTGGTTGCAGAGA