Homologs in group_9

Help

20 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05295 FBDBKF_05295 43.6 Morganella morganii S1 oppA oligopeptide ABC transporter substrate-binding protein OppA
FBDBKF_05300 FBDBKF_05300 43.5 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
FBDBKF_05570 FBDBKF_05570 70.9 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12020 EHELCC_12020 70.9 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12290 EHELCC_12290 43.5 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12295 EHELCC_12295 43.6 Morganella morganii S2 oppA oligopeptide ABC transporter substrate-binding protein OppA
NLDBIP_12360 NLDBIP_12360 70.9 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12630 NLDBIP_12630 43.5 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12635 NLDBIP_12635 43.6 Morganella morganii S4 oppA oligopeptide ABC transporter substrate-binding protein OppA
LHKJJB_12220 LHKJJB_12220 70.9 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12490 LHKJJB_12490 43.5 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12495 LHKJJB_12495 43.6 Morganella morganii S3 oppA oligopeptide ABC transporter substrate-binding protein OppA
HKOGLL_10835 HKOGLL_10835 70.9 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11105 HKOGLL_11105 43.5 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11110 HKOGLL_11110 43.6 Morganella morganii S5 oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS03735 F4V73_RS03735 73.2 Morganella psychrotolerans - peptide ABC transporter substrate-binding protein
F4V73_RS05750 F4V73_RS05750 43.6 Morganella psychrotolerans oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS05755 F4V73_RS05755 43.1 Morganella psychrotolerans - ABC transporter substrate-binding protein
PMI_RS07140 PMI_RS07140 45.1 Proteus mirabilis HI4320 oppA oligopeptide ABC transporter substrate-binding protein OppA
PMI_RS07145 PMI_RS07145 41.3 Proteus mirabilis HI4320 - ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_9

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_9

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77348 0.0 770 67 2 536 1 mppA Periplasmic murein peptide-binding protein MppA Escherichia coli (strain K12)
P23843 1.72e-169 493 46 2 536 1 oppA Periplasmic oligopeptide-binding protein OppA Escherichia coli (strain K12)
P06202 6.51e-168 489 47 1 515 1 oppA Periplasmic oligopeptide-binding protein OppA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P71370 2.55e-155 457 44 6 544 3 oppA Periplasmic oligopeptide-binding protein OppA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46863 7.18e-135 405 42 5 520 1 ygiS Probable deoxycholate-binding periplasmic protein YgiS Escherichia coli (strain K12)
P24141 4.76e-77 255 32 11 555 1 oppA Oligopeptide-binding protein OppA Bacillus subtilis (strain 168)
P26906 5.26e-72 242 31 13 532 1 dppE Dipeptide-binding protein DppE Bacillus subtilis (strain 168)
P44572 6.16e-68 231 31 11 493 3 HI_0213 Putative binding protein HI_0213 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI74 3.41e-48 178 28 16 543 1 dppA Dipeptide-binding protein Lactococcus lactis subsp. cremoris (strain MG1363)
A0A0H2ZGV2 3e-33 136 25 20 544 1 dppA1 Di/tripeptide-binding protein 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P33950 2.17e-32 134 28 25 484 1 hbpA Heme-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HVS1 1.01e-31 132 25 19 507 1 PA4500 Dipeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGN2 5.62e-31 129 25 19 493 1 dppA3 Di/tripeptide-binding protein 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
P76128 6.59e-31 129 25 16 498 2 ddpA Probable D,D-dipeptide-binding periplasmic protein DdpA Escherichia coli (strain K12)
A0A0H2ZGV7 6.59e-29 123 25 17 453 1 dppA4 Di/tripeptide-binding protein 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS4 5.63e-28 120 25 17 453 1 PA4497 Tripeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGW2 1.81e-27 119 25 17 453 1 dppA2 Di/tripeptide-binding protein 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P33590 7.34e-27 117 25 16 504 1 nikA Nickel-binding periplasmic protein Escherichia coli (strain K12)
P23847 3.88e-24 109 23 17 477 1 dppA Dipeptide-binding protein Escherichia coli (strain K12)
A0A0H2ZI72 2.85e-22 103 24 19 508 1 dppA5 Probable di/tripeptide-binding protein 5 Pseudomonas aeruginosa (strain UCBPP-PA14)
P31306 9.83e-21 99 26 11 318 1 sarA Oligopeptide-binding protein SarA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0A4G1 1.6e-19 95 26 10 308 1 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4G0 1.6e-19 95 26 10 308 3 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P35592 4.07e-19 94 26 13 332 3 aliA Oligopeptide-binding protein AliA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P06109 5.35e-16 84 24 20 487 3 xp55 Protein XP55 Streptomyces lividans
P18791 1.9e-15 83 25 12 320 1 amiA Oligopeptide-binding protein AmiA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1RE95 7.25e-15 80 22 11 495 3 gsiB Glutathione-binding protein GsiB Escherichia coli (strain UTI89 / UPEC)
Q8CW88 7.25e-15 80 22 11 495 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A968 7.25e-15 80 22 11 495 3 gsiB Glutathione-binding protein GsiB Escherichia coli O1:K1 / APEC
Q8X6V9 1.35e-14 80 22 11 495 3 gsiB Glutathione-binding protein GsiB Escherichia coli O157:H7
Q323W4 1.52e-14 79 22 11 495 3 gsiB Glutathione-binding protein GsiB Shigella boydii serotype 4 (strain Sb227)
P75797 2.15e-14 79 22 11 495 1 gsiB Glutathione-binding protein GsiB Escherichia coli (strain K12)
P36634 3.28e-14 79 22 20 535 2 sapA Peptide transport periplasmic protein SapA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0TJL8 3.76e-14 78 22 11 495 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z3V3 3.79e-14 78 22 11 495 3 gsiB Glutathione-binding protein GsiB Shigella sonnei (strain Ss046)
Q821B3 4.03e-14 78 22 11 495 3 gsiB Glutathione-binding protein GsiB Shigella flexneri
Q32IB6 5.69e-14 78 21 12 519 3 gsiB Glutathione-binding protein GsiB Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZQM3 7.23e-14 77 21 12 483 3 gsiB Glutathione-binding protein GsiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z863 9.67e-14 77 20 12 483 3 gsiB Glutathione-binding protein GsiB Salmonella typhi
Q0T6D2 1.03e-13 77 22 12 499 3 gsiB Glutathione-binding protein GsiB Shigella flexneri serotype 5b (strain 8401)
Q57RB1 1.41e-13 76 20 12 483 3 gsiB Glutathione-binding protein GsiB Salmonella choleraesuis (strain SC-B67)
Q5PGP4 1.73e-13 76 20 12 483 3 gsiB Glutathione-binding protein GsiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q47622 1.87e-12 73 23 22 536 3 sapA Probable ABC transporter periplasmic-binding protein SapA Escherichia coli (strain K12)
Q07741 1.07e-11 71 25 18 416 1 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis
Q02VA9 2.91e-11 69 24 18 416 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. cremoris (strain SK11)
P45285 5.42e-11 68 22 20 505 3 sapA Peptide transport periplasmic protein SapA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42061 1.29e-10 67 25 13 340 1 appA Oligopeptide-binding protein AppA Bacillus subtilis (strain 168)
Q9CEK0 1.93e-10 67 24 15 397 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis (strain IL1403)
Q8FWN7 3.3e-10 66 26 16 392 3 BRA0409 Putative ABC transporter peptide-binding protein BRA0409/BS1330_II0406 Brucella suis biovar 1 (strain 1330)
Q2YK66 3.3e-10 66 26 16 392 3 BAB2_0812 Putative ABC transporter peptide-binding protein BAB2_0812 Brucella abortus (strain 2308)
Q577J8 3.3e-10 66 26 16 392 3 BruAb2_0792 Putative ABC transporter peptide-binding protein BruAb2_0792 Brucella abortus biovar 1 (strain 9-941)
A5VU91 3.3e-10 66 26 16 392 3 BOV_A0352 Putative ABC transporter peptide-binding protein BOV_A0352 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBP0 3.7e-10 66 26 16 392 3 BMEII0859 Putative ABC transporter peptide-binding protein BMEII0859 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9CIN5 1.82e-09 63 24 12 315 3 yepA Peptidoglycan-binding protein YepA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8FUX2 7.86e-09 62 23 24 509 3 BRA1090 Putative peptide-binding periplasmic protein BRA1090/BS1330_II1082 Brucella suis biovar 1 (strain 1330)
Q8YDG6 2.3e-08 60 23 24 509 3 BMEII0210 Putative peptide-binding periplasmic protein BMEII0210 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A0A0H3JTL0 2.43e-08 60 23 24 544 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YJK2 2.94e-08 60 23 24 509 3 BAB2_1049 Putative peptide-binding periplasmic protein BAB2_1049 Brucella abortus (strain 2308)
Q8VQK3 2.94e-08 60 23 24 509 3 BruAb2_1030 Putative peptide-binding periplasmic protein BruAb2_1030 Brucella abortus biovar 1 (strain 9-941)
Q2FVE7 3.82e-08 59 22 23 544 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G2P5 7.79e-07 55 22 14 450 1 nikA Nickel-binding protein NikA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9X4Y1 4.15e-06 53 23 17 349 2 agpA Periplasmic alpha-galactoside-binding protein Rhizobium meliloti (strain 1021)
Q8YC41 4.25e-06 53 24 11 249 3 BMEII0691 Putative binding protein BMEII0691 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FW84 4.44e-06 53 24 11 249 3 BRA0576 Putative binding protein BRA0576/BS1330_II0571 Brucella suis biovar 1 (strain 1330)
Q2YKJ5 4.68e-06 53 24 11 249 3 BAB2_0664 Putative binding protein BAB2_0664 Brucella abortus (strain 2308)
Q577X5 4.68e-06 53 24 11 249 3 BruAb2_0648 Putative binding protein BruAb2_0648 Brucella abortus biovar 1 (strain 9-941)
Q6D3B0 5.75e-06 52 21 13 469 3 gsiB Glutathione-binding protein GsiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O07570 0.000103 48 21 13 321 3 yhjP Uncharacterized protein YhjP Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06600
Feature type CDS
Gene -
Product peptide ABC transporter substrate-binding protein
Location 1445339 - 1446958 (strand: -1)
Length 1620 (nucleotides) / 539 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_9
Orthogroup size 21
N. genomes 7

Actions

Genomic region

Domains

PF00496 Bacterial extracellular solute-binding proteins, family 5 Middle

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4166 Amino acid transport and metabolism (E) E ABC-type oligopeptide transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15580 oligopeptide transport system substrate-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing		 -

Protein Sequence

MRKIFVISCALVVQGLLISQANAAVVPSGTILDKKQEVVRHLKDEPASLDPINAVGLTEAQVQRDLFEGLVIEDERGRPIPGVAQSWRTEDNRVWIFTLRDNAKWSNGEKVTASDFVYSWQRLVDPKNLSPFAWYASLASIENAQKIIDGKLKPTALGVEAIDEKTLKVTLERPVPYFPSLATNFSLYPVPKHTIEKYGSEWIKVGNLVGNGAFILKDRVVNEKIVLTPNPYYWDHHNTVLTKVTFVPINHESQATKRYLAGDIDITESFPKHLYHKLMKDIPDQVYIPEQLGTYYYAFNTQAGPTKDIRVRKALAMAIDRKIITDKVLGTGEKSANRFTPDVTANFTPEPTLYDEYSQDELDSQAKILLSAAGYGPHNPLTLSLLYNNSENHQKIAIAVASMWKKKLGVKVNLRNQEWKTYIDSRNSGDFDVIRASWIGDYNEPSTFLSLLGSKHAGNIPKYQSQQYDEILVQANMTTDEEERNRLYNRAEQVIAEEAPIAPIYQYTNGRLIKPWLKGYPIENPEDVAYSHMLYVIKH

Flanking regions ( +/- flanking 50bp)

TTTTATAATTATTAAGTTAACTCGCTTATAGACTACAGGACGAAACAGACATGCGCAAAATATTCGTTATATCATGTGCACTTGTCGTTCAAGGATTGCTCATATCACAGGCTAATGCGGCAGTGGTGCCATCAGGAACGATACTCGACAAAAAACAGGAAGTAGTGCGACATTTAAAAGATGAACCCGCATCACTTGATCCCATTAATGCCGTAGGTTTAACGGAGGCTCAAGTTCAACGAGACTTATTTGAAGGATTAGTGATAGAAGATGAGCGAGGGCGTCCCATTCCTGGAGTGGCACAATCATGGCGAACAGAAGACAACCGGGTTTGGATTTTTACATTACGTGATAATGCTAAATGGTCAAATGGCGAAAAGGTGACGGCTTCTGACTTTGTTTATAGTTGGCAAAGATTAGTTGATCCAAAAAATCTTTCTCCTTTTGCTTGGTATGCATCCCTAGCTTCTATTGAGAATGCCCAAAAAATTATTGATGGTAAATTAAAACCAACCGCGTTAGGTGTGGAAGCCATTGATGAAAAAACGTTAAAAGTTACCTTAGAACGACCTGTTCCTTATTTCCCTAGTTTAGCGACCAATTTTTCACTTTATCCTGTACCTAAACACACAATCGAAAAATACGGTTCAGAATGGATCAAAGTAGGTAATTTAGTCGGCAATGGGGCTTTTATACTAAAAGATCGCGTTGTGAATGAGAAAATTGTGTTAACGCCAAACCCTTACTATTGGGATCACCACAATACGGTGTTAACCAAAGTCACTTTTGTGCCTATTAATCATGAATCACAAGCGACTAAACGTTATTTAGCTGGGGATATTGATATTACAGAGTCTTTTCCTAAACACTTATATCACAAATTGATGAAAGATATTCCTGATCAAGTGTATATCCCTGAGCAGTTAGGTACTTACTATTATGCATTTAATACACAAGCAGGGCCTACCAAAGATATTCGGGTTCGCAAAGCGTTAGCTATGGCAATTGATAGAAAAATTATTACTGACAAAGTCCTTGGTACTGGAGAAAAATCAGCGAATCGCTTTACTCCTGATGTGACGGCTAATTTTACGCCTGAGCCAACACTATATGATGAATACAGTCAGGATGAATTAGATAGCCAAGCAAAAATATTGTTATCAGCAGCCGGCTATGGTCCTCATAATCCTTTAACTCTCTCTCTGCTTTATAATAATTCAGAAAATCATCAAAAGATCGCCATTGCTGTCGCTTCTATGTGGAAGAAAAAGTTAGGCGTAAAGGTAAACTTACGCAATCAAGAGTGGAAAACTTATATTGATAGTCGTAATTCAGGTGATTTTGATGTGATAAGAGCGTCATGGATAGGCGATTACAATGAACCCTCCACATTTTTATCTTTATTAGGTTCTAAGCATGCTGGAAATATCCCAAAATATCAGAGCCAGCAATATGATGAGATTTTAGTCCAAGCCAATATGACGACAGATGAAGAGGAAAGAAATCGTCTCTATAATCGTGCAGAACAGGTTATTGCGGAAGAGGCGCCTATTGCCCCTATCTATCAGTATACTAATGGTCGTCTAATCAAACCTTGGCTAAAAGGTTATCCCATTGAGAATCCTGAAGATGTCGCTTATAGCCATATGCTGTATGTTATAAAGCATTAAATAAGTGTTACAGGCAATAAGATAAGAAAGCCAAAATATTAGCAAAGAGT