Homologs in group_9

Help

20 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05295 FBDBKF_05295 45.8 Morganella morganii S1 oppA oligopeptide ABC transporter substrate-binding protein OppA
FBDBKF_05300 FBDBKF_05300 43.1 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
FBDBKF_05570 FBDBKF_05570 88.8 Morganella morganii S1 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12020 EHELCC_12020 88.8 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12290 EHELCC_12290 43.1 Morganella morganii S2 oppA ABC-type oligopeptide transport system, periplasmic component
EHELCC_12295 EHELCC_12295 45.8 Morganella morganii S2 oppA oligopeptide ABC transporter substrate-binding protein OppA
NLDBIP_12360 NLDBIP_12360 88.8 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12630 NLDBIP_12630 43.1 Morganella morganii S4 oppA ABC-type oligopeptide transport system, periplasmic component
NLDBIP_12635 NLDBIP_12635 45.8 Morganella morganii S4 oppA oligopeptide ABC transporter substrate-binding protein OppA
LHKJJB_12220 LHKJJB_12220 88.8 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12490 LHKJJB_12490 43.1 Morganella morganii S3 oppA ABC-type oligopeptide transport system, periplasmic component
LHKJJB_12495 LHKJJB_12495 45.8 Morganella morganii S3 oppA oligopeptide ABC transporter substrate-binding protein OppA
HKOGLL_10835 HKOGLL_10835 88.8 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11105 HKOGLL_11105 43.1 Morganella morganii S5 oppA ABC-type oligopeptide transport system, periplasmic component
HKOGLL_11110 HKOGLL_11110 45.8 Morganella morganii S5 oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS05750 F4V73_RS05750 45.0 Morganella psychrotolerans oppA oligopeptide ABC transporter substrate-binding protein OppA
F4V73_RS05755 F4V73_RS05755 42.9 Morganella psychrotolerans - ABC transporter substrate-binding protein
PMI_RS06600 PMI_RS06600 73.2 Proteus mirabilis HI4320 - peptide ABC transporter substrate-binding protein
PMI_RS07140 PMI_RS07140 47.1 Proteus mirabilis HI4320 oppA oligopeptide ABC transporter substrate-binding protein OppA
PMI_RS07145 PMI_RS07145 43.6 Proteus mirabilis HI4320 - ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_9

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_9

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77348 0.0 790 70 1 517 1 mppA Periplasmic murein peptide-binding protein MppA Escherichia coli (strain K12)
P23843 2.18e-171 498 47 1 519 1 oppA Periplasmic oligopeptide-binding protein OppA Escherichia coli (strain K12)
P06202 1.5e-167 488 46 1 515 1 oppA Periplasmic oligopeptide-binding protein OppA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P71370 1.39e-155 457 44 4 522 3 oppA Periplasmic oligopeptide-binding protein OppA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46863 5.92e-135 404 42 3 518 1 ygiS Probable deoxycholate-binding periplasmic protein YgiS Escherichia coli (strain K12)
P24141 3.68e-76 253 33 10 495 1 oppA Oligopeptide-binding protein OppA Bacillus subtilis (strain 168)
P26906 6.87e-72 241 31 10 494 1 dppE Dipeptide-binding protein DppE Bacillus subtilis (strain 168)
P44572 2.08e-59 207 29 12 489 3 HI_0213 Putative binding protein HI_0213 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI74 3.2e-46 172 28 16 519 1 dppA Dipeptide-binding protein Lactococcus lactis subsp. cremoris (strain MG1363)
P76128 2.27e-35 142 26 13 494 2 ddpA Probable D,D-dipeptide-binding periplasmic protein DdpA Escherichia coli (strain K12)
P33950 6.06e-30 126 27 18 472 1 hbpA Heme-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HVS1 2.62e-29 124 24 19 517 1 PA4500 Dipeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGN2 5.31e-29 123 24 18 502 1 dppA3 Di/tripeptide-binding protein 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGW2 8.53e-29 123 25 20 495 1 dppA2 Di/tripeptide-binding protein 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGV2 1.01e-28 122 25 17 500 1 dppA1 Di/tripeptide-binding protein 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS4 2.92e-28 121 25 20 495 1 PA4497 Tripeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGV7 6.43e-26 114 23 18 482 1 dppA4 Di/tripeptide-binding protein 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
P0A4G1 4.04e-25 112 27 10 322 1 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4G0 4.04e-25 112 27 10 322 3 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P31306 3.68e-24 110 27 10 318 1 sarA Oligopeptide-binding protein SarA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P23847 5.71e-24 108 23 15 473 1 dppA Dipeptide-binding protein Escherichia coli (strain K12)
A0A0H2ZI72 1.49e-21 101 24 21 514 1 dppA5 Probable di/tripeptide-binding protein 5 Pseudomonas aeruginosa (strain UCBPP-PA14)
P35592 6.92e-21 99 26 14 349 3 aliA Oligopeptide-binding protein AliA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P33590 1.91e-18 92 23 16 477 1 nikA Nickel-binding periplasmic protein Escherichia coli (strain K12)
P06109 7.9e-18 90 26 20 484 3 xp55 Protein XP55 Streptomyces lividans
P18791 1.45e-16 86 22 20 544 1 amiA Oligopeptide-binding protein AmiA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1RE95 3.45e-15 81 23 14 489 3 gsiB Glutathione-binding protein GsiB Escherichia coli (strain UTI89 / UPEC)
Q8CW88 3.45e-15 81 23 14 489 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A968 3.45e-15 81 23 14 489 3 gsiB Glutathione-binding protein GsiB Escherichia coli O1:K1 / APEC
Q32IB6 3.51e-15 81 22 12 488 3 gsiB Glutathione-binding protein GsiB Shigella dysenteriae serotype 1 (strain Sd197)
Q0TJL8 4.92e-15 81 23 14 489 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q47622 5.95e-15 81 22 19 460 3 sapA Probable ABC transporter periplasmic-binding protein SapA Escherichia coli (strain K12)
Q8X6V9 8.16e-15 80 23 14 489 3 gsiB Glutathione-binding protein GsiB Escherichia coli O157:H7
Q3Z3V3 9.49e-15 80 23 14 489 3 gsiB Glutathione-binding protein GsiB Shigella sonnei (strain Ss046)
Q323W4 2.07e-14 79 22 14 489 3 gsiB Glutathione-binding protein GsiB Shigella boydii serotype 4 (strain Sb227)
P36634 2.41e-14 79 22 19 490 2 sapA Peptide transport periplasmic protein SapA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q821B3 3.49e-14 78 22 14 489 3 gsiB Glutathione-binding protein GsiB Shigella flexneri
P42061 3.51e-14 78 23 19 473 1 appA Oligopeptide-binding protein AppA Bacillus subtilis (strain 168)
Q57RB1 4.02e-14 78 20 11 473 3 gsiB Glutathione-binding protein GsiB Salmonella choleraesuis (strain SC-B67)
P75797 4.24e-14 78 22 14 489 1 gsiB Glutathione-binding protein GsiB Escherichia coli (strain K12)
Q8ZQM3 4.48e-14 78 21 11 473 3 gsiB Glutathione-binding protein GsiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z863 5.68e-14 77 20 11 473 3 gsiB Glutathione-binding protein GsiB Salmonella typhi
Q5PGP4 7.89e-14 77 20 11 473 3 gsiB Glutathione-binding protein GsiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0T6D2 4.85e-13 75 22 14 489 3 gsiB Glutathione-binding protein GsiB Shigella flexneri serotype 5b (strain 8401)
Q8FUX2 4.07e-12 72 24 23 514 3 BRA1090 Putative peptide-binding periplasmic protein BRA1090/BS1330_II1082 Brucella suis biovar 1 (strain 1330)
Q8YDG6 1.18e-11 70 24 23 514 3 BMEII0210 Putative peptide-binding periplasmic protein BMEII0210 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK2 1.36e-11 70 24 23 511 3 BAB2_1049 Putative peptide-binding periplasmic protein BAB2_1049 Brucella abortus (strain 2308)
Q8VQK3 1.36e-11 70 24 23 511 3 BruAb2_1030 Putative peptide-binding periplasmic protein BruAb2_1030 Brucella abortus biovar 1 (strain 9-941)
P45285 2.14e-11 70 21 9 358 3 sapA Peptide transport periplasmic protein SapA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q07741 3.28e-11 69 25 21 415 1 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis
Q02VA9 5.78e-11 68 25 19 415 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. cremoris (strain SK11)
Q2FVE7 3.46e-09 62 21 14 393 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9CEK0 4.27e-09 62 25 18 386 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis (strain IL1403)
O07570 6.13e-09 62 22 15 320 3 yhjP Uncharacterized protein YhjP Bacillus subtilis (strain 168)
Q8FWN7 3.5e-08 59 23 15 465 3 BRA0409 Putative ABC transporter peptide-binding protein BRA0409/BS1330_II0406 Brucella suis biovar 1 (strain 1330)
Q2YK66 3.5e-08 59 23 15 465 3 BAB2_0812 Putative ABC transporter peptide-binding protein BAB2_0812 Brucella abortus (strain 2308)
Q577J8 3.5e-08 59 23 15 465 3 BruAb2_0792 Putative ABC transporter peptide-binding protein BruAb2_0792 Brucella abortus biovar 1 (strain 9-941)
A5VU91 3.5e-08 59 23 15 465 3 BOV_A0352 Putative ABC transporter peptide-binding protein BOV_A0352 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBP0 3.63e-08 59 23 15 465 3 BMEII0859 Putative ABC transporter peptide-binding protein BMEII0859 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P55669 6.21e-08 58 23 24 522 3 NGR_a01440 Probable peptide ABC transporter periplasmic-binding protein y4tO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A0A0H3JTL0 7.15e-08 58 21 14 393 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6D3B0 8.67e-08 58 22 11 375 3 gsiB Glutathione-binding protein GsiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9RU24 9.97e-08 58 22 19 403 1 DR_1571 Probable ABC transporter-binding protein DR_1571 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A9CIN5 1.11e-05 52 22 11 271 3 yepA Peptidoglycan-binding protein YepA Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03735
Feature type CDS
Gene -
Product peptide ABC transporter substrate-binding protein
Location 792389 - 793945 (strand: 1)
Length 1557 (nucleotides) / 518 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_9
Orthogroup size 21
N. genomes 7

Actions

Genomic region

Domains

PF00496 Bacterial extracellular solute-binding proteins, family 5 Middle

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4166 Amino acid transport and metabolism (E) E ABC-type oligopeptide transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15580 oligopeptide transport system substrate-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing		 -

Protein Sequence

MAAVIPAGTELAKEQSVYRHLKDEPASLDPVKAVGLTEAQLLRDLFEGLTSQDAGGKPVPGVASSWETNNNLVWTFHLRKDAQWSDGTPVTAQDFVYSWRRLVDPKSLSTFAWFAPLAGINNAQAIIDGKMAPATLGAEAIDPHTLRITLDRPVPYFPNLAANFSLFPVNRATIEKYGDNWVRAGHLVGNGAFVLHERVVNEKIVLTPNPHYWDNKHTVLTSVTFVPINHESQATKRYLAGDLDITESFPKNQYQKLKKSIPDQIYIPDQLGTYYYAFNTQRAPTNDPRVRQALSMTIDRAVIAEKVLGTGEKPAWRFTPDVTAGFTPEPGRYQKFSQSELDSQAKTLMAAAGYGPHNPMKLSLLYNSSENHQKIAIAVGSMWKKKLGVEVRLVNQEWKTYIDSRNTGNFDVIRASWVGDYNEPSTFLSLLSSIHTGNISKYHSKKYDELLKTAALETDDEARNADYNEAEKLLAEDTPIAPIYQYTNGRLIKPWLKGYPVNNPEDVAYSHNLYIIKH

Flanking regions ( +/- flanking 50bp)

CCGCATTTCTTGCTGGTGCGGTGTTCACCTTTTCTTCTCTGTTCTGTGCCATGGCGGCGGTGATCCCCGCCGGAACTGAGCTGGCAAAAGAGCAATCTGTTTATCGTCATCTTAAAGACGAACCTGCATCACTTGATCCGGTAAAAGCGGTCGGGCTGACCGAAGCGCAGCTCCTGCGTGATTTATTTGAAGGGCTGACCAGCCAGGATGCGGGCGGAAAGCCTGTTCCCGGAGTAGCTTCCTCCTGGGAAACAAATAACAATCTGGTCTGGACATTCCATCTGCGCAAAGATGCGCAGTGGTCAGACGGCACCCCTGTCACCGCACAGGACTTTGTTTACAGTTGGCGGCGTTTGGTTGATCCGAAAAGCCTTTCAACATTCGCCTGGTTCGCACCTCTTGCCGGTATTAATAATGCGCAGGCGATTATCGACGGCAAAATGGCACCCGCCACACTGGGGGCAGAAGCCATTGATCCGCACACATTGCGCATTACGCTGGACAGACCCGTCCCTTACTTCCCGAATTTAGCGGCGAATTTCAGCCTTTTCCCGGTAAATCGCGCGACAATAGAGAAATATGGCGATAACTGGGTCCGCGCCGGGCATCTGGTCGGAAACGGTGCATTTGTCCTGCATGAGCGGGTGGTAAATGAAAAAATTGTTCTGACACCGAACCCGCATTACTGGGATAACAAACACACAGTACTGACATCCGTTACCTTTGTGCCGATTAATCATGAATCACAGGCAACAAAGCGCTATCTTGCCGGTGATTTGGATATCACTGAATCCTTCCCGAAAAATCAGTATCAGAAGCTGAAAAAATCCATTCCGGATCAGATTTATATTCCGGATCAGCTCGGCACCTATTATTACGCCTTTAATACACAGCGCGCGCCGACCAATGATCCGCGTGTGCGCCAGGCGCTTTCCATGACTATCGACCGCGCGGTGATTGCCGAAAAAGTCCTTGGCACCGGCGAAAAACCGGCATGGCGCTTTACGCCTGATGTCACCGCCGGCTTTACCCCGGAACCGGGACGTTATCAGAAATTCAGTCAGAGCGAACTGGACAGCCAGGCAAAAACGCTGATGGCGGCCGCCGGTTATGGCCCGCATAACCCGATGAAACTTTCCCTGCTGTACAACAGCTCGGAAAATCATCAGAAAATTGCTATTGCGGTCGGATCGATGTGGAAGAAAAAGCTGGGCGTGGAAGTCAGGCTGGTGAACCAGGAGTGGAAAACCTACATTGACAGCCGTAATACCGGGAATTTTGATGTGATCCGCGCCTCCTGGGTGGGCGATTATAATGAGCCGTCGACCTTCCTGTCGCTGCTGAGCAGTATTCACACCGGTAATATTTCGAAGTATCACAGTAAAAAATATGATGAATTACTGAAAACAGCGGCACTGGAAACCGATGATGAAGCCCGCAATGCCGATTATAACGAAGCTGAAAAACTGCTGGCGGAAGATACCCCGATTGCACCTATCTATCAGTACACCAATGGCCGCCTGATCAAACCGTGGCTGAAAGGGTATCCGGTTAATAATCCGGAAGATGTGGCGTACAGCCATAATCTCTATATTATTAAGCACTAAACCTGCCTCCTGTCATTTCCCCGCAGGGAGCGGGGGAATGCGGCAGAACC