Homologs in group_1062

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05555 FBDBKF_05555 83.7 Morganella morganii S1 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
EHELCC_12035 EHELCC_12035 83.7 Morganella morganii S2 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
NLDBIP_12375 NLDBIP_12375 83.7 Morganella morganii S4 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
LHKJJB_12235 LHKJJB_12235 83.7 Morganella morganii S3 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
HKOGLL_10850 HKOGLL_10850 83.7 Morganella morganii S5 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
F4V73_RS03745 F4V73_RS03745 82.0 Morganella psychrotolerans ttcA tRNA 2-thiocytidine(32) synthetase TtcA

Distribution of the homologs in the orthogroup group_1062

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1062

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B7L5B2 0.0 532 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain 55989 / EAEC)
P76055 0.0 532 82 0 302 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12)
B1XCH3 0.0 532 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / DH10B)
C4ZV92 0.0 532 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LRU9 0.0 531 83 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N4F3 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1ISR7 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZT7 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O9:H4 (strain HS)
B7LYL5 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O8 (strain IAI1)
B5Z0R4 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
A7ZLH4 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z194 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella sonnei (strain Ss046)
B1LG84 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6IA61 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SE11)
Q8X8Q5 0.0 531 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7
Q8FHP6 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI22 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MUI7 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O81 (strain ED1a)
Q1RC21 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain UTI89 / UPEC)
B7MM21 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q83KS7 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri
Q0T3Z1 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri serotype 5b (strain 8401)
B2U0Z1 0.0 530 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q7N3Y7 0.0 529 82 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4TIS7 0.0 529 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella heidelberg (strain SL476)
Q8Z783 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhi
B4TWA6 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella schwarzengrund (strain CVM19633)
B5BJ71 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain AKU_12601)
A9MXN4 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PHS1 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7NHP6 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B4T6P5 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella newport (strain SL254)
B5RA25 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R4D8 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella enteritidis PT4 (strain P125109)
B5FUP1 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella dublin (strain CT_02021853)
B7URE9 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8ZP88 0.0 528 82 0 302 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F5C0 0.0 528 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella agona (strain SL483)
Q320D9 0.0 527 81 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 4 (strain Sb227)
A7MLI7 0.0 527 82 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cronobacter sakazakii (strain ATCC BAA-894)
A6T886 0.0 526 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A1AAV5 0.0 526 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O1:K1 / APEC
Q32GI6 0.0 526 81 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella dysenteriae serotype 1 (strain Sd197)
C0Q3V6 0.0 526 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi C (strain RKS4594)
Q57P06 0.0 526 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella choleraesuis (strain SC-B67)
A9MQT5 0.0 526 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WAT7 0.0 526 81 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Enterobacter sp. (strain 638)
B5XRN3 0.0 525 82 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae (strain 342)
A8AGE0 0.0 518 80 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C6DJ78 0.0 516 78 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GF18 0.0 516 81 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Serratia proteamaculans (strain 568)
Q6D5P6 0.0 514 79 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JND8 0.0 512 80 1 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JJU2 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TIV5 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis (strain Pestoides F)
Q1CIQ7 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8Q5 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CIP8 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis
Q1C7C2 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHP9 0.0 511 81 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66A78 0.0 511 80 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5E0 0.0 511 80 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2VKN8 0.0 503 78 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q65TL6 2.91e-175 489 79 2 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VP68 1.49e-173 485 77 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7MKU7 7.32e-173 483 74 2 301 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain YJ016)
Q2NSV5 8.65e-173 485 79 0 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sodalis glossinidius (strain morsitans)
Q8D9J0 4.66e-172 481 74 2 301 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain CMCP6)
C3LMC8 1.12e-171 480 76 1 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KS29 1.12e-171 480 76 1 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CN39 2.42e-171 480 79 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pasteurella multocida (strain Pm70)
A5F888 7.37e-171 478 76 1 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A3N0Y3 1.56e-170 478 78 2 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BPR8 5.37e-170 476 78 2 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q57184 1.91e-169 475 76 4 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UBX9 1.91e-169 475 76 4 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain PittEE)
B3GXW8 2.57e-169 475 78 2 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B5FE41 3.45e-169 474 73 1 300 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain MJ11)
Q5E590 3.45e-169 474 73 1 300 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7VKY7 5.44e-169 474 78 3 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q4QK81 1.72e-168 472 75 4 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain 86-028NP)
A4SMC4 1.69e-166 467 72 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas salmonicida (strain A449)
A0KKM7 3.6e-165 464 71 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0UU61 5.79e-165 464 76 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 2336)
Q0I3K3 7.13e-165 463 76 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 129Pt)
C4L8F7 1.75e-162 457 75 0 281 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B6ELU0 2.68e-160 451 69 1 301 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio salmonicida (strain LFI1238)
Q7NQK6 4.03e-160 451 72 0 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9LZH0 5.97e-156 441 72 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C (strain 053442)
Q3JAS2 7.9e-156 440 67 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1IS67 1.74e-155 440 72 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q3IHG8 1.97e-155 439 71 2 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas translucida (strain TAC 125)
Q47ZU5 2.73e-155 439 67 2 303 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B4RMM2 2.76e-155 439 71 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F956 4.78e-155 439 71 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KU93 1.06e-154 438 71 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZJ6 2.52e-154 437 71 0 287 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1SWS4 5.56e-153 433 68 1 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6VXH3 7.4e-153 432 76 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinomonas sp. (strain MWYL1)
Q0AI06 4.12e-152 431 68 0 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82UJ4 3.58e-149 424 68 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2YBQ4 3e-148 421 71 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5QZ01 2.66e-147 418 70 1 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B2JIL8 2.3e-146 417 66 1 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2T1V1 3.48e-146 417 69 0 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9I4E6 1.68e-145 413 74 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02J28 1.68e-145 413 74 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWY4 1.68e-145 413 74 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain LESB58)
Q2SK22 1.89e-145 413 73 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hahella chejuensis (strain KCTC 2396)
B2T6U6 3.46e-145 414 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13T64 3.66e-145 414 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia xenovorans (strain LB400)
A6V906 4.4e-145 412 73 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain PA7)
A9AKB0 4.97e-145 414 65 1 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q63Y74 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain K96243)
A3N4V9 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 668)
Q3JWX0 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1710b)
A3NQK2 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1106a)
A1V7Z5 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain SAVP1)
Q62EN9 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain ATCC 23344)
A2S7T4 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10229)
A3MND8 1.79e-144 412 68 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10247)
A1U1K6 1.84e-144 411 74 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A4G9W3 5.72e-144 410 67 0 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Herminiimonas arsenicoxydans
Q1QZ76 1.55e-143 408 70 0 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B1YP61 2.41e-143 410 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain MC40-6)
A4VJ19 2.45e-143 407 71 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stutzerimonas stutzeri (strain A1501)
Q0BB90 3.37e-143 409 64 0 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1TUY3 1.16e-142 407 68 0 275 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracidovorax citrulli (strain AAC00-1)
A4XWK1 1.75e-142 405 71 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas mendocina (strain ymp)
C3JY43 1.98e-142 405 71 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain SBW25)
A4JIF6 2.89e-142 407 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A6T3N1 3.09e-142 406 67 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Janthinobacterium sp. (strain Marseille)
Q4ZQ35 3.69e-142 404 70 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. syringae (strain B728a)
Q3K8D5 5.91e-142 404 70 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain Pf0-1)
Q0VQ34 8.91e-142 404 72 0 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4K882 1.02e-141 403 69 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q21IJ4 1.77e-141 404 70 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B1JZU7 3.07e-141 404 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain MC0-3)
Q48FG8 3.48e-141 402 70 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q39C93 3.61e-141 404 63 1 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B3PID5 3.62e-141 403 71 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cellvibrio japonicus (strain Ueda107)
Q1BSY9 1e-140 403 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain AU 1054)
B1J1K3 1.16e-140 400 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain W619)
A0KB51 1.22e-140 403 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia cenocepacia (strain HI2424)
B0KT32 1.46e-140 400 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain GB-1)
Q1IDN2 1.65e-140 400 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas entomophila (strain L48)
A3D4P4 2.17e-140 401 64 2 300 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1RJP0 2.45e-140 401 65 2 300 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain W3-18-1)
A4Y6T9 2.45e-140 401 65 2 300 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HVA7 2.98e-140 401 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-7)
Q0HIM8 2.98e-140 401 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-4)
A0KX28 2.98e-140 401 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain ANA-3)
A5W7U0 3.71e-140 399 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C5BRQ7 4.34e-140 400 65 1 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A9L1D4 4.72e-140 400 64 2 300 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS195)
Q88MD2 8.9e-140 398 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A6WNB3 1.85e-139 399 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS185)
Q885Z7 3.13e-139 397 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1S6K0 7.66e-139 398 62 3 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C1DPQ6 1.13e-138 395 69 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B2AGH6 1.46e-138 397 62 1 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A1WHW6 1.53e-138 397 68 0 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Verminephrobacter eiseniae (strain EF01-2)
Q0KF09 1.76e-138 397 63 2 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8EEM4 2.22e-138 396 62 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B2UD46 2.37e-138 396 64 2 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia pickettii (strain 12J)
Q082E9 2.41e-138 396 64 1 291 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella frigidimarina (strain NCIMB 400)
A4T0E0 2.62e-138 395 67 1 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A1W3C0 3.53e-138 396 64 0 275 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax sp. (strain JS42)
Q220I8 4.06e-138 397 65 0 281 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B9MCI6 4.53e-138 395 64 0 275 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax ebreus (strain TPSY)
A9BXV6 5.6e-138 395 63 1 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q603C7 6.04e-138 394 68 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1XSG8 7.92e-138 394 66 1 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q477W2 1.27e-137 393 64 1 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dechloromonas aromatica (strain RCB)
B1Y629 1.61e-137 395 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1VJK9 2.2e-137 394 66 1 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas naphthalenivorans (strain CJ2)
Q87PG9 4.36e-137 392 67 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q476S4 6.13e-137 392 60 3 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1K2P7 7.69e-137 392 65 1 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azoarcus sp. (strain BH72)
Q15U56 2.81e-136 391 66 0 266 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5P3T7 3.63e-136 391 61 2 291 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q12N51 3.72e-136 391 61 3 309 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3QEG3 4.29e-136 390 66 1 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A7N0R3 5.34e-136 390 67 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio campbellii (strain ATCC BAA-1116)
Q8Y306 6.5e-136 390 63 2 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1LS06 8.49e-136 390 67 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A2SD77 1.19e-135 389 64 0 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q124R0 1.34e-135 389 65 1 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A8H4Q7 3.59e-134 385 60 2 303 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
C5CNK9 1.82e-133 384 64 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Variovorax paradoxus (strain S110)
B0TUN8 1.43e-132 381 60 2 301 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella halifaxensis (strain HAW-EB4)
Q6LR31 1.57e-131 379 66 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photobacterium profundum (strain SS9)
Q7WEL6 6.98e-131 377 64 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1IX43 8.45e-131 376 64 1 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q7W398 1.77e-130 377 64 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VU56 3.09e-130 376 64 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2KU24 1.06e-128 372 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella avium (strain 197N)
A9HY25 1.55e-128 372 61 2 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1KFY6 3.17e-128 371 62 1 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q1H4T8 5.04e-128 370 62 2 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A8FVF7 5.29e-127 367 62 1 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sediminis (strain HAW-EB3)
B2FU61 1.44e-126 366 66 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain K279a)
Q9RX35 2.13e-126 365 62 1 262 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B0CEK4 8.97e-125 360 66 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acaryochloris marina (strain MBIC 11017)
Q0AA41 2.62e-124 360 57 2 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0VDQ2 1.17e-122 356 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AYE)
B2HXA8 1.17e-122 356 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ACICU)
B7I610 1.17e-122 356 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB0057)
B7GY44 1.17e-122 356 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB307-0294)
A5EXQ4 2.35e-122 354 66 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dichelobacter nodosus (strain VCS1703A)
A3M828 2.69e-122 355 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VT10 2.69e-122 355 64 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain SDF)
Q87B85 2.03e-121 353 65 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7H1 2.03e-121 353 65 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M23)
Q6F8Q3 1e-120 351 63 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0U453 1.48e-120 350 65 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M12)
B4SRP3 7.7e-120 348 60 1 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain R551-3)
Q3BMF4 1.29e-119 348 59 1 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1QCP2 1.55e-119 351 56 2 303 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9PFT8 2.46e-119 347 64 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain 9a5c)
Q8PEW6 2.59e-119 348 61 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas axonopodis pv. citri (strain 306)
Q4FTN3 8.19e-119 349 57 1 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B2SIG7 1.05e-117 343 58 2 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q5GUF3 1.07e-117 343 58 2 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NXR3 1.07e-117 343 58 2 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5WG99 5.32e-117 344 63 0 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter sp. (strain PRwf-1)
Q8P3H2 1.97e-116 340 60 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RYY8 1.97e-116 340 60 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UNZ5 2.76e-116 340 60 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain 8004)
B2SGI4 4.3e-115 335 60 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IXY7 4.3e-115 335 60 0 264 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NG17 4.3e-115 335 60 0 264 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HG9 4.3e-115 335 60 0 264 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q6E3 2.12e-114 333 59 0 264 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. novicida (strain U112)
Q0BLX1 4.32e-114 333 60 0 264 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3F9 4.32e-114 333 60 0 264 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain LVS)
A7NC76 4.32e-114 333 60 0 264 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q11U13 6.17e-113 331 56 3 281 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B0U092 5.11e-112 328 60 0 253 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q11IV8 5.76e-105 310 57 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chelativorans sp. (strain BNC1)
Q2IPE3 8.11e-103 305 54 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
A7H8W2 2.86e-102 304 52 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain Fw109-5)
Q8YGM6 4.13e-102 303 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A1B0E2 1.62e-101 302 55 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracoccus denitrificans (strain Pd 1222)
B4UF77 3.27e-101 301 52 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain K)
B8JEH9 4.07e-101 301 52 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A4WWJ3 7.99e-100 298 54 1 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A6U9M6 1.07e-99 297 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium medicae (strain WSM419)
Q3IYY8 1.87e-99 296 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B9KNZ4 2.25e-99 296 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PNA9 2.25e-99 296 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q92PH1 9.81e-99 295 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium meliloti (strain 1021)
C3MD80 4.37e-98 293 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A9G6U6 4.59e-98 293 55 0 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sorangium cellulosum (strain So ce56)
Q2K7U6 9.05e-98 292 55 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q16A99 9.48e-98 291 52 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LW09 2.58e-97 291 53 2 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B0CLF8 2.85e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8G189 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis biovar 1 (strain 1330)
A5VQ10 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RIG5 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MAK8 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57DS4 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus biovar 1 (strain 9-941)
Q2YNH1 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain 2308)
B2S568 3.17e-97 291 58 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain S19)
Q0BYJ5 3.18e-97 291 53 2 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hyphomonas neptunium (strain ATCC 15444)
Q1MG13 3.24e-97 291 55 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1CZQ8 5.7e-97 290 54 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Myxococcus xanthus (strain DK1622)
A8LMA2 7.33e-97 290 53 2 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1GJX4 1.56e-96 289 53 2 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria sp. (strain TM1040)
Q7CYD2 1.13e-95 288 55 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A6X1K4 1.29e-95 287 58 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q6G5E1 2.91e-95 286 54 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A1UT10 6.88e-95 285 55 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q98NP4 4.21e-94 283 55 1 266 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A9IUA2 4.9e-94 283 54 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A5IGL1 2.98e-92 278 48 1 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Corby)
Q5WYK1 6.89e-92 277 48 1 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Lens)
A9KE14 9.25e-92 276 51 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain Dugway 5J108-111)
Q5X752 1.48e-91 276 51 0 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Paris)
Q5ZXN3 1.66e-91 276 47 1 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A9NCM4 2.07e-91 275 51 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J031 2.19e-91 275 51 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuG_Q212)
B6J7A4 5.47e-91 274 51 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuK_Q154)
Q83CP2 1.92e-90 272 51 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q6MLE7 4.69e-90 271 52 2 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B0TY35 4.11e-85 259 47 0 248 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q736 4.48e-85 259 47 1 253 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. novicida (strain U112)
Q5NFP3 3.98e-83 254 46 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H45 3.98e-83 254 46 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BMI3 9.81e-83 253 46 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A447 9.81e-83 253 46 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain LVS)
A7NBC6 9.81e-83 253 46 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4IYL5 2.48e-82 251 46 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q3A6S7 1.52e-71 224 43 2 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q74GW7 1.18e-70 222 41 2 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q39QC5 1.67e-66 211 40 1 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1AUS1 3.01e-63 204 41 1 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5GBX4 2.28e-62 201 41 1 245 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea uraniireducens (strain Rf4)
C6E087 4.35e-59 192 39 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sp. (strain M21)
B5ED57 4.35e-59 192 39 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B9M1Y2 1.88e-58 191 41 1 245 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8JF71 2.28e-20 93 28 6 243 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Chlamydomonas reinhardtii
Q6Z6G6 8.73e-19 89 28 5 233 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Oryza sativa subsp. japonica
O76365 3.62e-18 87 26 6 235 1 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis elegans
A8WR63 4.4e-18 87 26 6 242 3 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis briggsae
B5RV24 9.73e-17 83 26 8 249 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5FW05 9.75e-17 82 28 6 235 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus tropicalis
Q7JWW5 1.43e-15 79 28 8 226 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila melanogaster
B3N7L9 1.51e-15 79 28 8 226 3 GG10584 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila erecta
A5DPQ4 2.17e-15 79 24 8 263 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
O64862 2.37e-15 79 26 5 233 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Arabidopsis thaliana
Q94480 2.55e-15 79 27 6 234 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Dictyostelium discoideum
B4HSL7 3.05e-15 78 28 8 226 3 GM20632 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila sechellia
B4P3W7 3.08e-15 78 28 8 226 3 GE22576 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila yakuba
B3MI77 3.27e-15 78 28 8 226 3 GF12710 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila ananassae
Q9WZ48 8.57e-15 77 30 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1L8R5 1.28e-14 77 30 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga sp. (strain RQ2)
Q05AW7 2.69e-14 75 26 6 235 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus laevis
B4KLL0 3.27e-14 75 27 8 226 3 GI19452 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila mojavensis
Q803X1 3.92e-14 75 27 6 225 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Danio rerio
A3GGB3 4.53e-14 75 25 7 236 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
B4NN33 4.84e-14 75 28 7 225 3 GK22963 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila willistoni
B4LM02 4.84e-14 75 28 6 225 3 GJ21203 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila virilis
B4J5B3 5.08e-14 75 27 8 226 3 GH20281 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila grimshawi
D4GSH6 6.11e-14 74 26 10 257 1 ncsA tRNA 2-thiolation protein NcsA Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P0CS70 1.68e-13 73 26 6 227 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CS71 1.86e-13 73 26 6 227 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q28ZC1 2.01e-13 73 27 8 226 3 GA20807 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila pseudoobscura pseudoobscura
B4GHY8 2.3e-13 73 27 8 226 3 GL16852 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila persimilis
B7IFR8 2.4e-13 73 29 9 191 3 tilS tRNA(Ile)-lysidine synthase Thermosipho africanus (strain TCF52B)
Q8R7K9 3.54e-13 73 28 6 197 3 tilS tRNA(Ile)-lysidine synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5AML2 4.42e-13 72 25 8 259 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2Q879 7.83e-13 71 24 8 245 3 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q16QI1 1.66e-12 70 27 6 216 3 AAEL011283 Cytoplasmic tRNA 2-thiolation protein 1 Aedes aegypti
B0DK66 4.08e-12 69 26 5 223 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q7Q9I4 4.13e-12 69 27 8 225 3 AGAP005220 Cytoplasmic tRNA 2-thiolation protein 1 Anopheles gambiae
Q6C8R5 7.12e-12 68 23 7 236 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q181G3 1.23e-11 68 29 3 181 3 tilS tRNA(Ile)-lysidine synthase Clostridioides difficile (strain 630)
Q755T1 1.37e-11 68 25 7 224 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A8PVM6 1.46e-11 67 24 7 257 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q8RHN5 1.86e-11 67 29 3 177 3 tilS tRNA(Ile)-lysidine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6FMB5 2.27e-11 67 23 5 235 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4P6R3 3.19e-11 67 24 9 265 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Ustilago maydis (strain 521 / FGSC 9021)
A5E3Q3 3.32e-11 67 24 8 223 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q6CWX6 3.47e-11 66 24 7 225 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A8F7F8 6.79e-11 66 29 6 190 3 tilS tRNA(Ile)-lysidine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A6ZTX8 7.49e-11 65 23 8 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain YJM789)
B3LHQ7 7.49e-11 65 23 8 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain RM11-1a)
P53088 7.85e-11 65 23 8 252 1 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B1WBV0 8.53e-11 65 26 6 188 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Rattus norvegicus
Q99J10 1.28e-10 65 26 6 188 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Mus musculus
Q74C65 2.5e-10 64 27 5 179 3 tilS tRNA(Ile)-lysidine synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A7TER7 5.86e-10 63 22 5 235 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q9ZGE2 6.27e-10 63 26 3 186 3 tilS tRNA(Ile)-lysidine synthase Heliobacterium mobile
Q58558 7.16e-10 62 26 7 201 3 MJ1157 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q0TMI0 1.51e-09 62 27 4 187 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XHL1 2.43e-09 61 27 4 187 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain 13 / Type A)
Q8EU18 2.49e-09 61 27 4 190 3 tilS tRNA(Ile)-lysidine synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q899H5 2.58e-09 61 28 4 178 3 tilS tRNA(Ile)-lysidine synthase Clostridium tetani (strain Massachusetts / E88)
Q7Z7A3 7.77e-09 59 23 7 232 1 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Homo sapiens
A3CJX7 8.55e-09 59 28 5 175 3 tilS tRNA(Ile)-lysidine synthase Streptococcus sanguinis (strain SK36)
Q9WY40 9.76e-09 58 26 9 242 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8A7D1 1.19e-08 59 27 5 165 3 tilS tRNA(Ile)-lysidine synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5M6K9 1.34e-08 59 28 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M217 1.34e-08 59 28 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain CNRZ 1066)
Q97EB0 1.62e-08 58 26 4 180 3 tilS tRNA(Ile)-lysidine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O94282 1.68e-08 58 25 7 214 1 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q82VP4 2.04e-08 58 25 8 234 3 tilS tRNA(Ile)-lysidine synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C0QU23 3.43e-08 57 25 9 219 3 tilS tRNA(Ile)-lysidine synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q601M6 3.83e-08 57 27 9 207 3 tilS tRNA(Ile)-lysidine synthase Mesomycoplasma hyopneumoniae (strain 232)
Q8KC15 4.87e-08 57 23 4 190 3 tilS tRNA(Ile)-lysidine synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q3ZYX5 5.1e-08 57 28 4 174 3 tilS tRNA(Ile)-lysidine synthase Dehalococcoides mccartyi (strain CBDB1)
A9BJK2 5.68e-08 56 25 4 154 3 tilS tRNA(Ile)-lysidine synthase Petrotoga mobilis (strain DSM 10674 / SJ95)
A8B000 5.76e-08 57 28 6 172 3 tilS tRNA(Ile)-lysidine synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q4W568 7.99e-08 56 29 6 179 3 tilS1 tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUE9 7.99e-08 56 29 6 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8EWQ7 1.12e-07 55 22 6 202 3 tilS tRNA(Ile)-lysidine synthase Malacoplasma penetrans (strain HF-2)
Q8DIH2 1.54e-07 55 25 4 170 3 tilS tRNA(Ile)-lysidine synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q0VC66 1.64e-07 55 28 3 149 2 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Bos taurus
Q73FE5 1.85e-07 55 27 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q72LF3 2.2e-07 55 26 3 177 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q3KKJ9 6.17e-07 53 28 5 174 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q5P2I9 6.42e-07 53 24 9 257 3 tilS tRNA(Ile)-lysidine synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6MLS8 6.46e-07 53 25 4 210 3 tilS tRNA(Ile)-lysidine synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
O84847 6.52e-07 53 28 5 174 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BAU8 6.7e-07 53 28 5 174 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B969 6.7e-07 53 28 5 174 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q5L3T3 7e-07 53 26 5 179 1 tilS tRNA(Ile)-lysidine synthase Geobacillus kaustophilus (strain HTA426)
A5CFP2 1.09e-06 53 21 4 207 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Boryong)
Q5F8F6 1.1e-06 53 29 6 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6HPV4 1.25e-06 53 27 3 145 3 tilS tRNA(Ile)-lysidine synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VX7 1.26e-06 53 27 3 145 3 tilS tRNA(Ile)-lysidine synthase Bacillus anthracis
Q63HD6 1.31e-06 53 26 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ZK / E33L)
Q822B9 1.54e-06 52 25 6 182 3 tilS tRNA(Ile)-lysidine synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
O58038 1.82e-06 52 25 9 259 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8E2H4 2.4e-06 52 27 6 168 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Y2 2.4e-06 52 27 6 168 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype III (strain NEM316)
A6LBU3 2.45e-06 52 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B3CUJ5 2.67e-06 52 21 4 199 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Ikeda)
Q57909 2.89e-06 51 28 8 217 3 MJ0485 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5R0Q7 3.03e-06 52 25 8 183 3 tilS tRNA(Ile)-lysidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q724J4 3.3e-06 52 24 4 182 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serotype 4b (strain F2365)
Q0BMM2 4.2e-06 51 26 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A488 4.2e-06 51 26 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NB76 4.2e-06 51 26 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q67JG9 4.47e-06 51 26 3 184 3 tilS tRNA(Ile)-lysidine synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q32RX0 5.36e-06 51 24 5 170 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Staurastrum punctulatum
Q8YAC7 5.59e-06 51 24 4 182 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9KGH8 8.12e-06 50 24 4 187 3 tilS tRNA(Ile)-lysidine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7MTC4 9.12e-06 50 27 12 239 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q81J84 9.27e-06 50 26 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C1C992 9.51e-06 50 26 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain 70585)
Q8DRP9 1.05e-05 50 26 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04N53 1.05e-05 50 26 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q97TC5 1.11e-05 50 26 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q58873 1.21e-05 49 25 8 220 3 MJ1478 tRNA-5-methyluridine(54) 2-sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q65PF4 1.45e-05 50 24 5 177 3 tilS tRNA(Ile)-lysidine synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Y074 2.26e-05 49 22 4 221 3 tilS tRNA(Ile)-lysidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A4IXE6 2.47e-05 48 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFK3 2.47e-05 48 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H05 2.47e-05 48 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q6B8L1 2.48e-05 48 25 6 205 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Gracilaria tenuistipitata var. liui
B2SG31 2.66e-05 48 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q64WF9 4.01e-05 48 27 5 154 3 tilS tRNA(Ile)-lysidine synthase Bacteroides fragilis (strain YCH46)
Q65ZY6 4.79e-05 48 23 5 213 3 tilS tRNA(Ile)-lysidine synthase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A0Q7B6 4.98e-05 48 25 5 168 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. novicida (strain U112)
Q0SM64 5.05e-05 48 23 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella afzelii (strain PKo)
B1I6Y3 6.09e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Hungary19A-6)
C1CNP4 6.66e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CN76 6.78e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain P1031)
B2IQZ8 7.15e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain CGSP14)
B5E578 7.15e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 19F (strain G54)
C1CH91 7.28e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain JJA)
B8ZJI9 7.75e-05 47 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q7UZL1 8.48e-05 47 23 9 235 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q2GC97 8.48e-05 47 22 6 188 3 tilS tRNA(Ile)-lysidine synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
O67728 8.97e-05 47 24 5 197 1 tilS tRNA(Ile)-lysidine synthase Aquifex aeolicus (strain VF5)
Q7NT72 9.99e-05 47 28 8 173 3 tilS tRNA(Ile)-lysidine synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B7J0N4 0.000108 47 24 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ZS7)
O51728 0.000108 47 24 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B2RMB4 0.000135 47 26 12 239 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q6AJ19 0.000258 45 27 5 144 3 tilS tRNA(Ile)-lysidine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q92F56 0.000383 45 24 7 197 3 tilS/hprT Bifunctional protein TilS/HprT Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5WCA0 0.000438 45 26 4 130 3 tilS tRNA(Ile)-lysidine synthase Psychrobacter sp. (strain PRwf-1)
Q9PL79 0.000619 44 26 4 156 3 tilS tRNA(Ile)-lysidine synthase Chlamydia muridarum (strain MoPn / Nigg)
B0TYH9 0.000623 44 26 5 163 3 tilS tRNA(Ile)-lysidine synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A7GZX4 0.0007 44 33 6 122 3 mnmA tRNA-specific 2-thiouridylase MnmA Campylobacter curvus (strain 525.92)
Q255L6 0.00087 43 26 7 193 3 tilS tRNA(Ile)-lysidine synthase Chlamydia felis (strain Fe/C-56)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06580
Feature type CDS
Gene ttcA
Product tRNA 2-thiocytidine(32) synthetase TtcA
Location 1441215 - 1442135 (strand: 1)
Length 921 (nucleotides) / 306 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1062
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01171 PP-loop family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0037 Translation, ribosomal structure and biogenesis (J) J tRNA(Ile)-lysidine synthase TilS/MesJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14058 tRNA 2-thiocytidine biosynthesis protein TtcA - -

Protein Sequence

MSIPKEQYNFNKLQKRLRRNVGQAIADFNMIEDGDKIMVCLSGGKDSYTLLSILMNLQKSAPIQFSLIAVNLDQKQPGFPEHILPEYLEQLGVEYKIVEENTYGIVKEIIPEGKTTCSLCSRLRRGILYRTATEVGATKIALGHHRDDILETLFLNMFYGGKLKGMPPKLMSDDGKHIVIRPLAYAREKDIERFAQAKNFPIIPCNLCGSQPNLQRQVIKEMLRDWDKRYPGRIETMFRATQNIVPSHLCDTQLFDFANIKQGDEIINGGDLAFDKDDIPTSPILSDDEDERPDFSQARLDVVEVK

Flanking regions ( +/- flanking 50bp)

CTCTTTAAAGTAAGTTAAAAAACCTTAGCAACGATATAGAACCGTAAAAAATGAGCATCCCAAAAGAGCAATATAATTTTAACAAATTACAAAAACGCTTACGCCGTAACGTTGGGCAAGCTATCGCTGATTTTAATATGATTGAAGATGGCGATAAAATCATGGTGTGCCTTTCTGGCGGGAAAGATAGCTATACTCTCCTATCTATCTTAATGAATTTGCAAAAAAGCGCGCCAATACAATTTTCCTTAATTGCCGTTAATTTAGATCAAAAACAACCGGGCTTCCCTGAACATATTTTACCTGAATATCTTGAGCAACTGGGTGTAGAGTATAAAATTGTTGAAGAGAATACTTACGGTATTGTAAAAGAGATCATTCCAGAAGGTAAAACCACCTGTTCACTTTGCTCTCGCTTACGTCGTGGTATTTTATACCGTACAGCCACCGAAGTTGGGGCAACAAAAATTGCTTTAGGTCACCATCGTGATGATATTTTAGAAACGCTGTTTCTGAACATGTTTTATGGTGGAAAGCTAAAGGGCATGCCACCTAAATTAATGAGTGATGACGGAAAACATATCGTTATTCGTCCATTGGCTTATGCCCGAGAAAAAGACATTGAACGTTTTGCTCAAGCAAAAAATTTCCCTATTATTCCCTGTAATCTTTGTGGCTCTCAACCTAACTTACAGCGCCAAGTGATCAAAGAGATGCTAAGAGATTGGGATAAACGTTACCCTGGGCGCATTGAAACCATGTTTAGGGCAACCCAAAATATTGTTCCGTCGCATCTATGTGATACCCAATTATTTGACTTTGCTAATATCAAACAGGGTGATGAGATTATTAACGGCGGTGATCTAGCATTTGATAAGGATGATATTCCAACAAGCCCTATTCTTTCCGATGATGAAGATGAGCGTCCTGATTTTAGCCAAGCTAGATTGGATGTTGTTGAGGTAAAATAAGCATAGCCAGTATTATCCCTAGCAAACCATCGTCGTTGCGCTGGGGTTTA