Homologs in group_995

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05555 FBDBKF_05555 92.2 Morganella morganii S1 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
EHELCC_12035 EHELCC_12035 92.2 Morganella morganii S2 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
NLDBIP_12375 NLDBIP_12375 92.2 Morganella morganii S4 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
LHKJJB_12235 LHKJJB_12235 92.2 Morganella morganii S3 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
HKOGLL_10850 HKOGLL_10850 92.2 Morganella morganii S5 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
PMI_RS06580 PMI_RS06580 82.0 Proteus mirabilis HI4320 ttcA tRNA 2-thiocytidine(32) synthetase TtcA

Distribution of the homologs in the orthogroup group_995

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_995

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4TWA6 0.0 536 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella schwarzengrund (strain CVM19633)
B5BJ71 0.0 536 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain AKU_12601)
Q5PHS1 0.0 536 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TIS7 0.0 536 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella heidelberg (strain SL476)
A9MXN4 0.0 535 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
C0Q3V6 0.0 535 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi C (strain RKS4594)
B4T6P5 0.0 535 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella newport (strain SL254)
B5RA25 0.0 535 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R4D8 0.0 535 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella enteritidis PT4 (strain P125109)
B5FUP1 0.0 535 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella dublin (strain CT_02021853)
Q57P06 0.0 535 83 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella choleraesuis (strain SC-B67)
Q3Z194 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella sonnei (strain Ss046)
Q8ZP88 0.0 534 82 2 306 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z783 0.0 534 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhi
B5F5C0 0.0 534 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella agona (strain SL483)
B6IA61 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SE11)
Q8FHP6 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI22 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MUI7 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O81 (strain ED1a)
Q8X8Q5 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7
B7L5B2 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain 55989 / EAEC)
P76055 0.0 534 82 2 305 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12)
B1XCH3 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / DH10B)
C4ZV92 0.0 534 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / MC4100 / BW2952)
Q1RC21 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain UTI89 / UPEC)
B7MM21 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LG84 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7N4F3 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1ISR7 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZT7 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O9:H4 (strain HS)
B7LYL5 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O8 (strain IAI1)
B5Z0R4 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
A7ZLH4 0.0 533 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LRU9 0.0 533 83 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1AAV5 0.0 533 82 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O1:K1 / APEC
A7MLI7 0.0 533 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cronobacter sakazakii (strain ATCC BAA-894)
B2U0Z1 0.0 532 81 0 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7URE9 0.0 531 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83KS7 0.0 531 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri
Q0T3Z1 0.0 531 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri serotype 5b (strain 8401)
B7NHP6 0.0 531 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8AGE0 0.0 531 81 0 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q320D9 0.0 530 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 4 (strain Sb227)
Q32GI6 0.0 530 81 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q7N3Y7 0.0 527 82 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6T886 0.0 527 81 0 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XRN3 0.0 527 81 0 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae (strain 342)
A9MQT5 0.0 526 81 0 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C6DJ78 0.0 525 81 2 303 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D5P6 0.0 524 82 3 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4WAT7 0.0 522 80 0 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Enterobacter sp. (strain 638)
A8GF18 0.0 520 80 2 303 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Serratia proteamaculans (strain 568)
B2VKN8 0.0 518 80 2 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JJU2 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TIV5 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis (strain Pestoides F)
Q1CIQ7 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8Q5 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CIP8 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis
Q1C7C2 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHP9 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66A78 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5E0 0.0 510 80 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JND8 0.0 505 79 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2NSV5 5.44e-176 493 80 2 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sodalis glossinidius (strain morsitans)
Q7MKU7 2.18e-170 477 76 1 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain YJ016)
Q8D9J0 5.29e-170 476 76 1 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain CMCP6)
A6VP68 1.47e-168 473 74 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B5FE41 5e-168 471 72 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain MJ11)
Q5E590 5e-168 471 72 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LMC8 5.22e-168 471 75 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KS29 5.22e-168 471 75 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F888 2.91e-167 469 75 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q65TL6 2.01e-166 467 74 3 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3N0Y3 3.7e-165 464 74 2 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BPR8 1.06e-164 463 74 2 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXW8 6.66e-164 461 74 2 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A4SMC4 2.78e-162 456 70 0 295 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas salmonicida (strain A449)
Q9CN39 3.18e-162 457 72 5 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pasteurella multocida (strain Pm70)
A5UBX9 4.22e-162 456 71 4 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain PittEE)
Q57184 5.66e-162 456 71 4 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B6ELU0 6e-162 456 70 1 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio salmonicida (strain LFI1238)
Q4QK81 5.59e-161 453 71 4 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain 86-028NP)
C4L8F7 8.19e-161 452 69 1 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KKM7 1.26e-160 452 69 0 295 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VKY7 1.96e-160 452 72 3 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0UU61 1.04e-159 450 72 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 2336)
Q0I3K3 1.16e-159 450 72 3 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 129Pt)
A1SWS4 5.66e-155 438 71 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7NQK6 2.63e-154 437 71 1 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3IHG8 4.29e-152 431 68 1 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas translucida (strain TAC 125)
A1IS67 2.33e-151 429 72 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZH0 2.6e-151 429 71 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C (strain 053442)
B4RMM2 7.13e-151 428 71 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F956 8.49e-151 428 71 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q47ZU5 1.24e-150 427 63 1 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9JZJ6 1.64e-150 427 71 0 282 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KU93 3.33e-150 426 71 0 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q0AI06 2.04e-149 424 66 0 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A6VXH3 4.05e-149 422 73 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinomonas sp. (strain MWYL1)
Q3JAS2 3.86e-148 421 66 1 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q82UJ4 6.01e-145 413 66 0 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2YBQ4 1.51e-144 411 67 1 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5QZ01 3.1e-144 410 71 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0KF09 1.56e-142 407 64 2 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q477W2 1.69e-141 403 67 1 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dechloromonas aromatica (strain RCB)
B2AGH6 2.11e-140 401 67 1 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q2SK22 2.72e-140 400 70 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hahella chejuensis (strain KCTC 2396)
A4VJ19 7.63e-140 399 70 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stutzerimonas stutzeri (strain A1501)
Q476S4 1.37e-139 399 64 3 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1QZ76 1.4e-139 398 68 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1LS06 2.89e-139 399 62 1 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B2JIL8 3.53e-139 399 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A6V906 4.16e-139 397 70 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain PA7)
Q0VQ34 8.42e-139 396 69 0 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B2T6U6 8.74e-139 398 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13T64 1.17e-138 398 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia xenovorans (strain LB400)
A3D4P4 1.19e-138 397 62 2 302 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A4JIF6 2.01e-138 397 66 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1S6K0 2.12e-138 397 61 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q9I4E6 2.17e-138 395 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02J28 2.17e-138 395 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWY4 2.17e-138 395 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain LESB58)
Q8EEM4 2.82e-138 396 62 2 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9AKB0 2.85e-138 397 66 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia multivorans (strain ATCC 17616 / 249)
B1YP61 3.57e-138 397 66 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain MC40-6)
A4XWK1 4.01e-138 394 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas mendocina (strain ymp)
Q220I8 5.1e-138 396 67 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0BB90 5.59e-138 396 64 1 290 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1RJP0 7.31e-138 395 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain W3-18-1)
A4Y6T9 7.31e-138 395 63 2 302 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HVA7 7.8e-138 395 67 1 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-7)
Q0HIM8 7.8e-138 395 67 1 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-4)
A0KX28 7.8e-138 395 67 1 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain ANA-3)
Q082E9 9.97e-138 394 68 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella frigidimarina (strain NCIMB 400)
Q39C93 1.23e-137 395 66 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9L1D4 2.52e-137 394 66 1 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS195)
B3PID5 2.85e-137 393 69 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cellvibrio japonicus (strain Ueda107)
B1JZU7 4.63e-137 394 66 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain MC0-3)
Q2T1V1 4.84e-137 394 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2UD46 8.19e-137 392 65 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia pickettii (strain 12J)
A6WNB3 9.76e-137 392 65 1 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS185)
Q15U56 1.03e-136 392 64 2 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1BSY9 1.21e-136 392 65 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain AU 1054)
A0KB51 1.74e-136 392 65 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia cenocepacia (strain HI2424)
A5W7U0 2.04e-136 390 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5P3T7 2.3e-136 391 63 2 290 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C5BRQ7 4.44e-136 390 67 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q88MD2 4.64e-136 389 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q63Y74 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain K96243)
A3N4V9 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 668)
Q3JWX0 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1710b)
A3NQK2 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1106a)
A1V7Z5 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain SAVP1)
Q62EN9 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain ATCC 23344)
A2S7T4 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10229)
A3MND8 4.76e-136 391 66 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10247)
B1J1K3 6.65e-136 389 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain W619)
Q8Y306 8.27e-136 390 65 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B0KT32 8.46e-136 388 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain GB-1)
Q3K8D5 1.1e-135 388 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain Pf0-1)
Q1IDN2 1.11e-135 388 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas entomophila (strain L48)
C3JY43 1.24e-135 388 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain SBW25)
A1TUY3 1.47e-135 389 65 0 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracidovorax citrulli (strain AAC00-1)
Q4K882 4.32e-135 386 67 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q48FG8 5.74e-135 386 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZQ35 6.7e-135 386 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. syringae (strain B728a)
A4G9W3 6.84e-135 387 66 0 267 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Herminiimonas arsenicoxydans
Q12N51 1.91e-134 387 66 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1WHW6 5.81e-134 385 65 0 277 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Verminephrobacter eiseniae (strain EF01-2)
A6T3N1 7.24e-134 385 65 0 267 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Janthinobacterium sp. (strain Marseille)
A1U1K6 7.42e-134 384 70 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q21IJ4 1.52e-133 384 67 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8H4Q7 1.91e-133 384 65 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q885Z7 2.17e-133 382 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1VJK9 2.92e-133 383 65 0 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas naphthalenivorans (strain CJ2)
A1K2P7 3.07e-133 383 66 1 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azoarcus sp. (strain BH72)
C1DPQ6 4.19e-133 381 67 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0TUN8 5.97e-133 382 65 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella halifaxensis (strain HAW-EB4)
A3QEG3 9.15e-133 382 66 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q603C7 2.14e-132 380 66 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1Y629 7.58e-132 380 67 0 268 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q124R0 2.62e-131 378 62 1 293 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A9BXV6 3.08e-130 375 61 0 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q1H4T8 4.11e-130 375 68 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A2SD77 1e-129 374 63 0 279 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1KFY6 1.12e-129 374 64 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A8FVF7 1.53e-129 374 59 2 301 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sediminis (strain HAW-EB3)
C5CNK9 1.63e-129 374 63 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Variovorax paradoxus (strain S110)
A1W3C0 3.63e-129 373 60 0 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax sp. (strain JS42)
B9MCI6 5.94e-129 372 60 0 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax ebreus (strain TPSY)
Q87PG9 1.08e-128 371 64 0 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N0R3 2.03e-128 370 63 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio campbellii (strain ATCC BAA-1116)
A4T0E0 8.36e-127 367 63 1 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1XSG8 8.45e-127 367 62 1 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q6LR31 8.19e-126 364 62 0 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photobacterium profundum (strain SS9)
Q7WEL6 3.17e-125 363 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9HY25 3.88e-125 363 63 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2KU24 4.18e-125 363 63 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella avium (strain 197N)
Q7W398 1.09e-124 362 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VU56 1.65e-124 361 64 0 266 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1IX43 1.99e-124 360 63 1 262 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q9RX35 8.12e-121 351 59 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A5EXQ4 2.76e-120 348 64 0 254 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dichelobacter nodosus (strain VCS1703A)
Q0AA41 3.71e-120 350 61 1 269 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B2FU61 1.25e-118 346 62 1 262 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain K279a)
B0CEK4 1.41e-117 342 63 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acaryochloris marina (strain MBIC 11017)
B0VDQ2 2.27e-116 340 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AYE)
B2HXA8 2.27e-116 340 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ACICU)
B7I610 2.27e-116 340 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB0057)
B7GY44 2.27e-116 340 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB307-0294)
A3M828 5.21e-116 339 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VT10 5.21e-116 339 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain SDF)
Q8PEW6 1.03e-114 336 60 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas axonopodis pv. citri (strain 306)
Q87B85 2.08e-114 335 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7H1 2.08e-114 335 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M23)
Q3BMF4 2.73e-114 335 60 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6F8Q3 5.11e-114 334 61 0 247 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0U453 1.05e-113 333 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M12)
Q9PFT8 1.55e-113 333 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain 9a5c)
Q4FTN3 3.58e-112 332 63 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q11U13 6.19e-112 328 56 3 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B4SRP3 1.54e-111 328 57 1 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain R551-3)
B2SIG7 1.77e-111 328 55 2 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
A5WG99 1.84e-111 330 63 0 237 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter sp. (strain PRwf-1)
Q1QCP2 2.23e-111 330 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4UNZ5 2.31e-111 327 57 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain 8004)
Q8P3H2 2.47e-111 327 57 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RYY8 2.47e-111 327 57 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain B100)
Q5GUF3 2.76e-111 327 55 2 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NXR3 2.76e-111 327 55 2 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2SGI4 9.77e-111 324 58 0 262 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IXY7 9.77e-111 324 58 0 262 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NG17 9.77e-111 324 58 0 262 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HG9 9.77e-111 324 58 0 262 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q6E3 4.61e-110 323 57 0 262 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. novicida (strain U112)
Q0BLX1 1.1e-109 322 58 0 262 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3F9 1.1e-109 322 58 0 262 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain LVS)
A7NC76 1.1e-109 322 58 0 262 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0U092 4.15e-106 313 56 0 258 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A9G6U6 2.98e-101 301 59 0 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sorangium cellulosum (strain So ce56)
Q1CZQ8 5.04e-101 300 57 0 247 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Myxococcus xanthus (strain DK1622)
Q2IPE3 3.89e-100 298 54 0 247 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
A7H8W2 3.13e-99 296 54 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain Fw109-5)
Q11IV8 9.56e-99 295 56 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chelativorans sp. (strain BNC1)
B4UF77 1.02e-98 295 53 0 247 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain K)
B8JEH9 1.14e-98 295 53 0 247 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A1B0E2 9.69e-98 293 55 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracoccus denitrificans (strain Pd 1222)
B9KNZ4 6.17e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3IYY8 6.17e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNA9 6.17e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8YGM6 6.45e-97 290 56 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q16A99 9.75e-96 286 53 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A9KE14 8.33e-94 281 52 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain Dugway 5J108-111)
A9NCM4 1.04e-93 281 52 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q5X752 1.62e-93 281 52 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Paris)
Q5ZXN3 2e-93 281 52 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B6J031 2.4e-93 280 51 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuG_Q212)
A4WWJ3 3.45e-93 281 52 1 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A5IGL1 3.6e-93 280 52 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Corby)
Q5LW09 4.63e-93 280 52 2 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B6J7A4 5.15e-93 279 51 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuK_Q154)
Q5WYK1 6.92e-93 280 52 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Lens)
A6U9M6 8.61e-93 280 52 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium medicae (strain WSM419)
Q83CP2 9.38e-93 278 51 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B0CLF8 1.16e-92 280 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8G189 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis biovar 1 (strain 1330)
A5VQ10 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RIG5 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MAK8 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57DS4 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus biovar 1 (strain 9-941)
Q2YNH1 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain 2308)
B2S568 1.27e-92 279 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain S19)
Q2K7U6 2.34e-92 278 55 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1GJX4 3.87e-92 278 51 2 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria sp. (strain TM1040)
Q7CYD2 1.18e-91 278 53 1 263 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92PH1 1.3e-91 277 52 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium meliloti (strain 1021)
Q1MG13 3.03e-91 276 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C3MD80 3.53e-91 276 52 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A6X1K4 4.02e-91 275 55 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q98NP4 4.68e-91 275 55 0 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0BYJ5 5.63e-91 275 50 3 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hyphomonas neptunium (strain ATCC 15444)
A8LMA2 2.56e-90 273 50 1 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A9IUA2 1.35e-88 269 51 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6G5E1 2.4e-88 268 51 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6MLE7 3.54e-88 267 52 1 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A1UT10 7.65e-87 264 52 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B0TY35 2.61e-86 262 49 0 248 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q736 5.36e-86 261 48 0 250 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. novicida (strain U112)
Q5NFP3 2.5e-84 257 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H45 2.5e-84 257 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BMI3 7.04e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A447 7.04e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain LVS)
A7NBC6 7.04e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4IYL5 2.57e-83 254 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q3A6S7 6.91e-75 233 46 4 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q74GW7 3.58e-70 221 43 2 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q39QC5 1.03e-65 209 40 1 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1AUS1 2.91e-64 206 44 1 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5GBX4 9.93e-63 202 41 1 242 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea uraniireducens (strain Rf4)
C6E087 1.29e-62 201 41 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sp. (strain M21)
B5ED57 1.29e-62 201 41 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B9M1Y2 5.08e-58 189 42 1 245 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
O76365 4.43e-18 87 27 5 232 1 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis elegans
Q6Z6G6 6.01e-18 86 28 5 230 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Oryza sativa subsp. japonica
A8WR63 6.54e-18 86 27 5 231 3 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis briggsae
A8JF71 9.18e-18 85 24 6 277 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Chlamydomonas reinhardtii
Q5FW05 9.84e-16 79 26 6 255 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus tropicalis
B5RV24 1.57e-15 79 26 8 250 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
D4GSH6 1.63e-15 79 28 10 264 1 ncsA tRNA 2-thiolation protein NcsA Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A5DPQ4 1.69e-15 79 25 8 264 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q7JWW5 1.89e-15 79 28 8 221 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila melanogaster
B3N7L9 2.33e-15 79 28 8 221 3 GG10584 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila erecta
B4P3W7 3.96e-15 78 28 8 221 3 GE22576 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila yakuba
B4HSL7 4.03e-15 78 28 8 221 3 GM20632 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila sechellia
B3MI77 5.38e-15 77 28 8 221 3 GF12710 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila ananassae
O64862 6.46e-15 77 27 5 221 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Arabidopsis thaliana
A3GGB3 1.88e-14 76 24 7 258 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
B1L8R5 1.99e-14 76 30 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga sp. (strain RQ2)
B4NN33 4.08e-14 75 28 7 220 3 GK22963 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila willistoni
Q05AW7 6.29e-14 74 25 6 255 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus laevis
B4KLL0 7.01e-14 74 28 8 221 3 GI19452 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila mojavensis
B4LM02 8.24e-14 74 28 6 220 3 GJ21203 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila virilis
B4J5B3 8.48e-14 74 28 8 221 3 GH20281 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila grimshawi
P0CS70 1.18e-13 73 25 5 246 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CS71 1.6e-13 73 25 5 246 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q94480 2.11e-13 73 27 5 231 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Dictyostelium discoideum
Q16QI1 2.66e-13 72 27 6 216 3 AAEL011283 Cytoplasmic tRNA 2-thiolation protein 1 Aedes aegypti
Q9WZ48 5.37e-13 72 29 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q803X1 6.26e-13 71 26 7 247 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Danio rerio
Q28ZC1 8.39e-13 71 27 8 222 3 GA20807 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila pseudoobscura pseudoobscura
B4GHY8 9.13e-13 71 27 8 222 3 GL16852 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila persimilis
A2Q879 1.11e-12 70 23 10 310 3 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B7IFR8 4.04e-12 69 29 9 191 3 tilS tRNA(Ile)-lysidine synthase Thermosipho africanus (strain TCF52B)
Q6C8R5 5.33e-12 69 26 6 221 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q5AML2 6.2e-12 68 24 6 222 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A7TER7 6.37e-12 68 24 7 255 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
B0DK66 8.23e-12 68 26 5 219 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q7Q9I4 1.73e-11 67 25 7 226 3 AGAP005220 Cytoplasmic tRNA 2-thiolation protein 1 Anopheles gambiae
Q6CWX6 2.56e-11 67 25 7 247 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6FMB5 8.42e-11 65 23 6 232 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4P6R3 1.15e-10 65 24 8 259 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Ustilago maydis (strain 521 / FGSC 9021)
A8PVM6 1.62e-10 64 28 3 145 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q8RHN5 1.65e-10 65 28 5 175 3 tilS tRNA(Ile)-lysidine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q755T1 2.26e-10 64 24 6 220 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q9ZGE2 3.59e-10 63 29 3 168 3 tilS tRNA(Ile)-lysidine synthase Heliobacterium mobile
Q181G3 3.99e-10 63 28 4 178 3 tilS tRNA(Ile)-lysidine synthase Clostridioides difficile (strain 630)
A5E3Q3 4.43e-10 63 27 6 176 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q74C65 9.81e-10 62 26 6 195 3 tilS tRNA(Ile)-lysidine synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8R7K9 1.1e-09 62 25 4 180 3 tilS tRNA(Ile)-lysidine synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1WBV0 2.67e-09 61 24 8 225 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Rattus norvegicus
Q99J10 3.98e-09 60 24 8 225 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Mus musculus
Q58558 5.8e-09 60 30 10 200 3 MJ1157 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P53088 7.36e-09 59 21 7 252 1 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZTX8 8.92e-09 59 21 7 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain YJM789)
B3LHQ7 8.92e-09 59 21 7 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain RM11-1a)
Q899H5 1.41e-08 59 27 4 175 3 tilS tRNA(Ile)-lysidine synthase Clostridium tetani (strain Massachusetts / E88)
Q3ZYX5 2.04e-08 58 27 7 193 3 tilS tRNA(Ile)-lysidine synthase Dehalococcoides mccartyi (strain CBDB1)
Q82VP4 2.24e-08 58 27 9 229 3 tilS tRNA(Ile)-lysidine synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A8F7F8 2.41e-08 58 26 5 187 3 tilS tRNA(Ile)-lysidine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q7Z7A3 2.44e-08 58 21 9 292 1 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Homo sapiens
O94282 4e-08 57 25 6 223 1 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0TMI0 6.1e-08 57 27 5 181 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q72LF3 6.81e-08 56 24 5 219 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8XHL1 1e-07 56 27 5 181 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain 13 / Type A)
Q97EB0 1.23e-07 56 26 4 170 3 tilS tRNA(Ile)-lysidine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C0QU23 1.53e-07 55 24 5 181 3 tilS tRNA(Ile)-lysidine synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q9WY40 2.72e-07 54 25 7 220 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A8B000 4.07e-07 54 27 6 172 3 tilS tRNA(Ile)-lysidine synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8EU18 7.27e-07 53 26 4 182 3 tilS tRNA(Ile)-lysidine synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8A7D1 1.19e-06 53 27 7 171 3 tilS tRNA(Ile)-lysidine synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q67JG9 2.36e-06 52 27 5 180 3 tilS tRNA(Ile)-lysidine synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7MTC4 4.03e-06 51 28 9 190 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A6LBU3 4.98e-06 51 24 6 183 3 tilS tRNA(Ile)-lysidine synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A9BJK2 5.15e-06 50 26 4 148 3 tilS tRNA(Ile)-lysidine synthase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q4W568 5.76e-06 51 29 7 179 3 tilS1 tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUE9 5.76e-06 51 29 7 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
O58038 6.22e-06 50 26 11 261 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5L3T3 6.39e-06 50 26 6 180 1 tilS tRNA(Ile)-lysidine synthase Geobacillus kaustophilus (strain HTA426)
A3CJX7 6.82e-06 50 25 5 184 3 tilS tRNA(Ile)-lysidine synthase Streptococcus sanguinis (strain SK36)
Q73FE5 8.18e-06 50 25 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q0VC66 9.13e-06 50 21 9 292 2 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Bos taurus
Q8KC15 9.57e-06 50 22 3 171 3 tilS tRNA(Ile)-lysidine synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q32RX0 1.35e-05 50 24 5 174 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Staurastrum punctulatum
Q7NT72 1.82e-05 49 27 8 192 3 tilS tRNA(Ile)-lysidine synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B2RMB4 2.1e-05 49 28 9 190 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q601M6 2.27e-05 48 25 9 207 3 tilS tRNA(Ile)-lysidine synthase Mesomycoplasma hyopneumoniae (strain 232)
Q8DIH2 2.51e-05 48 25 4 170 3 tilS tRNA(Ile)-lysidine synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P37563 3.12e-05 48 25 6 189 1 tilS tRNA(Ile)-lysidine synthase Bacillus subtilis (strain 168)
Q6HPV4 3.13e-05 48 26 7 187 3 tilS tRNA(Ile)-lysidine synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VX7 3.16e-05 48 26 7 187 3 tilS tRNA(Ile)-lysidine synthase Bacillus anthracis
Q5F8F6 3.82e-05 48 27 6 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q0SM64 4.54e-05 48 23 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella afzelii (strain PKo)
Q5ZXE5 5.73e-05 48 27 7 169 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q65ZY6 5.99e-05 47 24 5 204 3 tilS tRNA(Ile)-lysidine synthase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q5X6W4 6.13e-05 47 27 7 169 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila (strain Paris)
Q2GC97 7.61e-05 47 22 6 188 3 tilS tRNA(Ile)-lysidine synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q63HD6 7.86e-05 47 24 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ZK / E33L)
Q57909 8.34e-05 47 26 9 236 3 MJ0485 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5M6K9 8.97e-05 47 24 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M217 8.97e-05 47 24 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain CNRZ 1066)
Q8Y074 0.000117 47 22 4 174 3 tilS tRNA(Ile)-lysidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q58873 0.000119 46 26 9 219 3 MJ1478 tRNA-5-methyluridine(54) 2-sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9KGH8 0.000128 47 24 4 176 3 tilS tRNA(Ile)-lysidine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q88MG3 0.000171 46 27 9 179 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q92JY3 0.000173 46 26 9 205 3 tilS tRNA(Ile)-lysidine synthase Rhizobium meliloti (strain 1021)
C1C992 0.000223 46 24 5 175 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain 70585)
Q97TC5 0.000231 46 24 5 175 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DRP9 0.000239 46 24 5 175 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04N53 0.000239 46 24 5 175 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6MLS8 0.000281 45 25 6 186 3 tilS tRNA(Ile)-lysidine synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5WYB4 0.000304 45 27 7 169 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila (strain Lens)
Q8E2H4 0.000307 45 26 6 168 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Y2 0.000307 45 26 6 168 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype III (strain NEM316)
Q724J4 0.000363 45 24 6 180 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serotype 4b (strain F2365)
Q81J84 0.000398 45 24 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q822B9 0.000472 45 25 6 182 3 tilS tRNA(Ile)-lysidine synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
O67728 0.000676 44 26 5 172 1 tilS tRNA(Ile)-lysidine synthase Aquifex aeolicus (strain VF5)
Q92F56 0.001 44 22 5 183 3 tilS/hprT Bifunctional protein TilS/HprT Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5R0Q7 0.001 44 26 8 178 3 tilS tRNA(Ile)-lysidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03745
Feature type CDS
Gene ttcA
Product tRNA 2-thiocytidine(32) synthetase TtcA
Location 795281 - 796201 (strand: -1)
Length 921 (nucleotides) / 306 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_995
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01171 PP-loop family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0037 Translation, ribosomal structure and biogenesis (J) J tRNA(Ile)-lysidine synthase TilS/MesJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14058 tRNA 2-thiocytidine biosynthesis protein TtcA - -

Protein Sequence

MNTPKDQHNINKLQKRLRSHTGKAIADFNMIEDGDRIMVCLSGGKDSYTLLSVLQSLQQSAPISFSLIAVNLDQKQPGFPGHILPEYLENLGVEYKIVEENTYGIVKEKIPEGKTTCSLCSRLRRGILYRTATELGATKIALGHHRDDILQTLFLNMFFGGKLKGMPPKLMSDDGKHIVIRPLAYCREKDIEHFAEAKGFPIIPCNLCGSQPNLQRQIIKDLLRDWDKRYPGRIETMFTATQNVVPSHLCDTGLFDFKSIHQGGDVVDGGDLAFDRETLPSQPVWTVDDDESSDFTEHRLDVVEVK

Flanking regions ( +/- flanking 50bp)

TTATCTGTCAGTCTGCAAAACAACACAAAACAGTAAAGAAACAGTAAGAAATGAATACACCAAAAGATCAGCACAATATTAATAAATTGCAGAAACGCTTACGCAGCCATACCGGTAAAGCCATTGCCGATTTTAATATGATTGAAGATGGCGACCGCATTATGGTTTGTCTCTCCGGCGGCAAAGACAGCTATACCCTGCTTTCTGTTTTGCAGAGTCTGCAACAGAGCGCACCCATCAGTTTTTCACTGATCGCGGTAAACCTGGATCAGAAACAACCGGGCTTTCCCGGTCATATTCTGCCGGAATATCTGGAAAACCTCGGTGTTGAATACAAAATCGTGGAAGAGAACACGTACGGGATTGTGAAAGAGAAAATCCCCGAAGGTAAAACGACCTGTTCTCTCTGTTCACGCCTGCGCCGTGGTATTTTATACCGCACTGCTACCGAGCTTGGCGCGACAAAAATTGCCCTCGGACATCACAGGGACGATATTTTACAGACACTGTTCCTGAATATGTTTTTTGGCGGCAAACTCAAAGGTATGCCACCAAAACTGATGAGTGATGATGGCAAGCACATTGTTATCCGTCCGCTGGCGTATTGCCGCGAAAAAGATATTGAGCATTTCGCCGAGGCAAAAGGATTCCCGATTATTCCGTGTAATTTATGTGGTTCACAGCCGAATTTACAGCGCCAGATAATTAAAGATCTGCTGCGTGACTGGGACAAACGGTATCCGGGTCGCATTGAAACCATGTTCACCGCCACACAGAATGTCGTACCATCACATTTATGTGATACCGGACTATTTGATTTCAAATCAATTCATCAGGGTGGTGATGTAGTGGATGGCGGCGATTTGGCGTTTGACAGGGAAACACTGCCATCGCAACCCGTTTGGACGGTTGATGACGATGAAAGCTCAGACTTTACAGAACACCGCCTGGATGTGGTGGAAGTGAAGTAAGCCTGTACGGTCAATTCTGCTAAAGCGCTCCCTGTGAGCGTTTTTTTTTG