Homologs in group_1062

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05555 FBDBKF_05555 100.0 Morganella morganii S1 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
EHELCC_12035 EHELCC_12035 100.0 Morganella morganii S2 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
LHKJJB_12235 LHKJJB_12235 100.0 Morganella morganii S3 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
HKOGLL_10850 HKOGLL_10850 100.0 Morganella morganii S5 ttcA tRNA 2-thiocytidine(32) synthetase TtcA
F4V73_RS03745 F4V73_RS03745 92.2 Morganella psychrotolerans ttcA tRNA 2-thiocytidine(32) synthetase TtcA
PMI_RS06580 PMI_RS06580 83.7 Proteus mirabilis HI4320 ttcA tRNA 2-thiocytidine(32) synthetase TtcA

Distribution of the homologs in the orthogroup group_1062

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1062

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4TWA6 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella schwarzengrund (strain CVM19633)
B5BJ71 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain AKU_12601)
Q5PHS1 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6P5 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella newport (strain SL254)
B4TIS7 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella heidelberg (strain SL476)
B5RA25 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R4D8 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella enteritidis PT4 (strain P125109)
B5FUP1 0.0 551 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella dublin (strain CT_02021853)
Q8ZP88 0.0 550 86 2 308 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F5C0 0.0 550 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella agona (strain SL483)
Q8Z783 0.0 550 85 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella typhi
A9MXN4 0.0 550 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q3Z194 0.0 550 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella sonnei (strain Ss046)
B6IA61 0.0 550 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SE11)
Q8X8Q5 0.0 550 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7
B7L5B2 0.0 550 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain 55989 / EAEC)
C0Q3V6 0.0 549 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella paratyphi C (strain RKS4594)
Q57P06 0.0 549 86 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella choleraesuis (strain SC-B67)
P76055 0.0 549 85 2 307 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12)
B1XCH3 0.0 549 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / DH10B)
C4ZV92 0.0 549 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7N4F3 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1ISR7 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZT7 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O9:H4 (strain HS)
B7LYL5 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O8 (strain IAI1)
B5Z0R4 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
A7ZLH4 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FHP6 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI22 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MUI7 0.0 548 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O81 (strain ED1a)
Q83KS7 0.0 547 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri
Q0T3Z1 0.0 547 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella flexneri serotype 5b (strain 8401)
Q1RC21 0.0 547 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain UTI89 / UPEC)
B7MM21 0.0 547 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LG84 0.0 546 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7URE9 0.0 546 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q320D9 0.0 546 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 4 (strain Sb227)
B7LRU9 0.0 546 85 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1AAV5 0.0 546 84 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O1:K1 / APEC
B7NHP6 0.0 545 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q32GI6 0.0 545 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella dysenteriae serotype 1 (strain Sd197)
B2U0Z1 0.0 545 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MQT5 0.0 543 85 3 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MLI7 0.0 543 84 3 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q7N3Y7 0.0 542 85 1 304 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8AGE0 0.0 542 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6T886 0.0 540 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WAT7 0.0 540 83 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Enterobacter sp. (strain 638)
A8GF18 0.0 540 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Serratia proteamaculans (strain 568)
B5XRN3 0.0 540 84 2 307 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Klebsiella pneumoniae (strain 342)
C6DJ78 0.0 538 84 3 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D5P6 0.0 536 84 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JJU2 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TIV5 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis (strain Pestoides F)
Q1CIQ7 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8Q5 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CIP8 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis
Q1C7C2 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHP9 0.0 525 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VKN8 0.0 524 80 2 308 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q66A78 0.0 524 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5E0 0.0 524 82 2 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JND8 0.0 524 83 3 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2NSV5 0.0 506 82 1 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sodalis glossinidius (strain morsitans)
Q7MKU7 4.91e-176 491 76 1 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain YJ016)
Q8D9J0 1.15e-175 491 76 1 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio vulnificus (strain CMCP6)
C3LMC8 3.56e-173 484 78 1 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KS29 3.56e-173 484 78 1 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F888 1.9e-172 483 78 1 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VP68 7.94e-171 478 76 3 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65TL6 5.39e-169 474 77 2 289 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B5FE41 6.32e-169 473 73 1 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain MJ11)
Q5E590 6.32e-169 473 73 1 305 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B0BPR8 8.28e-167 468 76 3 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0Y3 1.26e-166 468 76 3 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UBX9 1.84e-166 467 76 4 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain PittEE)
Q57184 2.94e-166 467 76 4 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3GXW8 4.67e-166 467 76 3 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q4QK81 2.16e-165 464 76 4 288 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus influenzae (strain 86-028NP)
Q7VKY7 1.46e-164 463 76 2 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4L8F7 1.04e-163 460 75 0 281 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9CN39 2.59e-163 459 73 4 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pasteurella multocida (strain Pm70)
A4SMC4 3.83e-163 459 72 1 297 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas salmonicida (strain A449)
A0KKM7 1.28e-162 457 72 1 297 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0UU61 1.63e-162 457 74 2 291 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 2336)
Q0I3K3 2.58e-162 457 74 2 291 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Histophilus somni (strain 129Pt)
B6ELU0 2.59e-162 457 70 1 306 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aliivibrio salmonicida (strain LFI1238)
Q7NQK6 4.59e-159 449 72 1 291 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1SWS4 8.74e-157 443 71 1 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q3IHG8 2.62e-154 436 68 1 290 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas translucida (strain TAC 125)
A1IS67 5.03e-154 436 70 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZH0 5.99e-154 436 70 1 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C (strain 053442)
B4RMM2 2.75e-153 434 69 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain NCCP11945)
Q9JZJ6 3.23e-153 434 70 1 299 1 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F956 5.24e-153 434 69 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KU93 7.35e-153 433 70 1 298 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q47ZU5 2.04e-151 429 69 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3JAS2 6.53e-151 427 71 0 275 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6VXH3 5.29e-150 424 73 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinomonas sp. (strain MWYL1)
Q0AI06 1.18e-148 422 67 0 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82UJ4 1.21e-147 420 68 0 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5QZ01 7.21e-147 417 70 2 294 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q2YBQ4 5.26e-146 415 67 1 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2JIL8 3.58e-143 409 69 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A4VJ19 5.32e-143 407 72 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stutzerimonas stutzeri (strain A1501)
A6V906 7.81e-143 406 73 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain PA7)
Q9I4E6 3.31e-142 404 73 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02J28 3.31e-142 404 73 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWY4 3.31e-142 404 73 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas aeruginosa (strain LESB58)
Q0KF09 7.79e-142 405 67 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q477W2 9.38e-142 404 67 1 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dechloromonas aromatica (strain RCB)
Q2SK22 1.05e-141 404 71 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hahella chejuensis (strain KCTC 2396)
B2T6U6 1.21e-141 405 69 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13T64 1.47e-141 405 69 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paraburkholderia xenovorans (strain LB400)
Q0VQ34 1.68e-141 403 72 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A9AKB0 3.62e-141 404 68 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q2T1V1 3.86e-141 404 69 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2AGH6 4.77e-141 403 66 1 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4XWK1 8.36e-141 401 71 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas mendocina (strain ymp)
B1YP61 1.61e-140 403 68 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain MC40-6)
Q082E9 2.87e-140 401 70 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella frigidimarina (strain NCIMB 400)
Q0BB90 4.45e-140 401 68 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1QZ76 9.03e-140 399 68 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A1U1K6 1.05e-139 399 71 0 254 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q63Y74 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain K96243)
A3N4V9 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 668)
Q3JWX0 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1710b)
A3NQK2 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia pseudomallei (strain 1106a)
A1V7Z5 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain SAVP1)
Q62EN9 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain ATCC 23344)
A2S7T4 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10229)
A3MND8 1.06e-139 400 64 1 299 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia mallei (strain NCTC 10247)
B3PID5 1.06e-139 399 70 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cellvibrio japonicus (strain Ueda107)
A4JIF6 2.9e-139 399 68 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0HVA7 4.21e-139 398 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-7)
Q0HIM8 4.21e-139 398 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain MR-4)
A0KX28 4.21e-139 398 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain ANA-3)
Q476S4 5.03e-139 398 62 1 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B1JZU7 6.04e-139 399 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain MC0-3)
A3D4P4 1.15e-138 397 68 0 271 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A0KB51 1.76e-138 397 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia cenocepacia (strain HI2424)
Q1LS06 2.01e-138 396 61 1 292 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1S6K0 2.14e-138 397 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1BSY9 2.27e-138 397 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia orbicola (strain AU 1054)
Q4K882 2.83e-138 394 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A9L1D4 2.88e-138 396 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS195)
Q39C93 3.59e-138 397 67 0 273 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1J1K3 4.38e-138 394 70 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain W619)
A5W7U0 4.78e-138 394 70 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3K8D5 5.22e-138 394 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain Pf0-1)
B0KT32 5.27e-138 394 70 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain GB-1)
A1RJP0 5.68e-138 395 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sp. (strain W3-18-1)
A4Y6T9 5.68e-138 395 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q1IDN2 5.76e-138 394 70 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas entomophila (strain L48)
A6WNB3 1.25e-137 394 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella baltica (strain OS185)
Q88MD2 1.38e-137 393 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8EEM4 1.72e-137 394 67 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
C5BRQ7 1.82e-137 394 68 0 258 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
C3JY43 1.86e-137 392 70 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas fluorescens (strain SBW25)
Q220I8 1.89e-137 395 67 0 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q48FG8 2.72e-137 392 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZQ35 4.41e-137 392 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. syringae (strain B728a)
B2UD46 5.47e-137 393 64 2 284 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia pickettii (strain 12J)
Q15U56 7.98e-137 392 63 1 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q885Z7 1.35e-136 390 69 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1TUY3 1.56e-136 392 67 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracidovorax citrulli (strain AAC00-1)
A4G9W3 1.59e-136 392 66 0 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Herminiimonas arsenicoxydans
Q21IJ4 2.47e-136 391 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A6T3N1 3.19e-136 391 66 0 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Janthinobacterium sp. (strain Marseille)
Q8Y306 1.08e-135 389 63 2 287 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C1DPQ6 2.85e-135 387 69 0 253 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q603C7 2.03e-134 385 67 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A8H4Q7 2.22e-134 386 65 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1Y629 3.46e-134 386 67 0 270 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1VJK9 3.73e-134 385 66 0 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas naphthalenivorans (strain CJ2)
Q5P3T7 6.84e-134 385 65 1 269 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A9BXV6 7.58e-134 385 62 0 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1W3C0 1.07e-133 385 62 0 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax sp. (strain JS42)
B0TUN8 1.39e-133 384 66 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella halifaxensis (strain HAW-EB4)
Q87PG9 1.63e-133 383 66 0 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B9MCI6 1.81e-133 384 62 0 283 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acidovorax ebreus (strain TPSY)
A1WHW6 2.3e-133 384 66 0 275 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Verminephrobacter eiseniae (strain EF01-2)
A1K2P7 2.49e-133 383 64 2 285 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Azoarcus sp. (strain BH72)
Q12N51 2.81e-133 384 66 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A7N0R3 4.04e-133 382 66 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Vibrio campbellii (strain ATCC BAA-1116)
A3QEG3 1.11e-132 382 66 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1XSG8 2.23e-131 378 64 1 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q124R0 3.72e-131 378 64 0 276 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A4T0E0 6.89e-131 377 65 1 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A2SD77 2.53e-130 376 66 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1KFY6 2.61e-130 376 65 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q1H4T8 2.74e-130 375 63 2 280 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A8FVF7 1.3e-129 374 65 0 264 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Shewanella sediminis (strain HAW-EB3)
C5CNK9 2.52e-129 373 63 0 274 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Variovorax paradoxus (strain S110)
Q6LR31 3.82e-128 370 63 0 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Photobacterium profundum (strain SS9)
Q1IX43 5.01e-128 369 66 1 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2KU24 2.16e-126 366 63 0 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella avium (strain 197N)
Q7WEL6 5.89e-126 365 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W398 1.92e-125 364 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VU56 3e-125 363 63 0 272 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9HY25 6.7e-125 362 61 4 296 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q9RX35 2.39e-124 360 63 1 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0AA41 7.9e-123 357 65 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0CEK4 3.33e-121 352 63 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acaryochloris marina (strain MBIC 11017)
A5EXQ4 3.56e-121 351 65 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dichelobacter nodosus (strain VCS1703A)
B2FU61 2.24e-120 350 66 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain K279a)
B0VDQ2 3.38e-118 345 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AYE)
B2HXA8 3.38e-118 345 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ACICU)
B7I610 3.38e-118 345 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB0057)
B7GY44 3.38e-118 345 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain AB307-0294)
A3M828 8.94e-118 343 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VT10 8.94e-118 343 61 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baumannii (strain SDF)
Q87B85 1.72e-116 340 60 2 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7H1 1.72e-116 340 60 2 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M23)
Q6F8Q3 6.76e-116 339 60 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0U453 9.99e-116 338 59 2 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M12)
Q9PFT8 9.99e-116 338 59 2 271 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain 9a5c)
A5WG99 2.78e-115 340 65 0 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter sp. (strain PRwf-1)
Q4FTN3 2.84e-115 340 63 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QCP2 5.84e-115 339 62 0 255 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8PEW6 3.07e-114 335 61 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BMF4 4.08e-114 335 62 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B4SRP3 8.77e-114 333 61 0 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Stenotrophomonas maltophilia (strain R551-3)
Q11U13 1.51e-112 330 56 3 278 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q4UNZ5 1.62e-112 330 58 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain 8004)
Q8P3H2 1.87e-112 330 58 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RYY8 1.87e-112 330 58 0 265 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas campestris pv. campestris (strain B100)
B2SIG7 1.39e-111 328 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q5GUF3 2.03e-111 328 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NXR3 2.03e-111 328 61 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2SGI4 7.59e-110 322 58 0 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IXY7 7.59e-110 322 58 0 260 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NG17 7.59e-110 322 58 0 260 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HG9 7.59e-110 322 58 0 260 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q6E3 2.79e-109 321 57 0 260 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. novicida (strain U112)
Q0BLX1 9.47e-109 319 57 0 260 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3F9 9.47e-109 319 57 0 260 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain LVS)
A7NC76 9.47e-109 319 57 0 260 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0U092 2.22e-108 318 57 0 258 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1CZQ8 2.42e-101 301 57 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Myxococcus xanthus (strain DK1622)
Q11IV8 4.03e-101 301 56 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Chelativorans sp. (strain BNC1)
Q2IPE3 6.62e-101 300 55 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
B4UF77 1.45e-99 297 54 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain K)
B8JEH9 2.27e-99 296 54 0 246 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A1B0E2 2.65e-99 296 55 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Paracoccus denitrificans (strain Pd 1222)
A9G6U6 3.13e-99 296 57 0 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sorangium cellulosum (strain So ce56)
A7H8W2 5.38e-99 296 54 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Anaeromyxobacter sp. (strain Fw109-5)
Q8YGM6 9.88e-99 295 57 0 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9KE14 3.92e-97 290 53 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain Dugway 5J108-111)
A9NCM4 7.15e-97 289 53 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q3IYY8 7.72e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B9KNZ4 7.89e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PNA9 7.89e-97 290 54 0 249 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q16A99 8.09e-97 289 53 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B6J031 1.21e-96 288 53 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuG_Q212)
B6J7A4 2.48e-96 288 53 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain CbuK_Q154)
Q83CP2 5.74e-96 286 53 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5LW09 1.55e-95 287 52 2 260 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A6U9M6 3e-95 286 53 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium medicae (strain WSM419)
Q5X752 3.45e-95 286 52 0 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Paris)
Q5ZXN3 4.53e-95 285 52 0 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IGL1 6.36e-95 285 52 0 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Corby)
Q2K7U6 6.58e-95 285 55 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7CYD2 7.34e-95 286 54 1 259 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8G189 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis biovar 1 (strain 1330)
A5VQ10 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RIG5 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MAK8 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57DS4 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus biovar 1 (strain 9-941)
Q2YNH1 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain 2308)
B2S568 9.03e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella abortus (strain S19)
B0CLF8 9.23e-95 285 57 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q5WYK1 1.41e-94 284 51 0 261 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Legionella pneumophila (strain Lens)
Q92PH1 3.06e-94 283 53 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium meliloti (strain 1021)
Q1MG13 8.33e-94 282 54 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A4WWJ3 8.99e-94 282 52 1 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q1GJX4 9.92e-94 282 52 2 256 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Ruegeria sp. (strain TM1040)
A6X1K4 1.33e-93 282 56 0 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
C3MD80 2.53e-93 281 52 0 252 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q98NP4 1.11e-92 280 55 0 239 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0BYJ5 1.48e-92 279 50 3 282 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Hyphomonas neptunium (strain ATCC 15444)
A8LMA2 1.36e-91 276 51 1 257 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q6G5E1 2.52e-90 273 51 0 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A9IUA2 2.55e-90 273 52 0 250 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A1UT10 7.13e-89 269 52 0 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6MLE7 2.51e-88 267 52 1 248 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A0Q736 4.78e-86 261 48 0 250 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. novicida (strain U112)
B0TY35 5.22e-86 261 48 0 248 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5NFP3 2.68e-84 257 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H45 2.68e-84 257 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BMI3 6.77e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A447 6.77e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain LVS)
A7NBC6 6.77e-84 256 48 0 247 3 ttcA1 tRNA-cytidine(32) 2-sulfurtransferase 1 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4IYL5 1.95e-83 254 47 0 247 3 ttcA2 tRNA-cytidine(32) 2-sulfurtransferase 2 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q3A6S7 2.66e-76 236 46 2 251 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q74GW7 2.78e-72 226 44 2 242 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q39QC5 3.84e-68 216 42 1 244 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5GBX4 1.63e-63 204 42 1 242 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea uraniireducens (strain Rf4)
A1AUS1 1.93e-63 204 44 1 243 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
C6E087 5.17e-61 197 41 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geobacter sp. (strain M21)
B5ED57 5.17e-61 197 41 1 240 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B9M1Y2 3.6e-60 195 42 1 245 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
O76365 2.11e-19 90 28 5 232 1 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis elegans
A8WR63 3.66e-19 90 28 6 232 3 tut-1 Cytoplasmic tRNA 2-thiolation protein 1 Caenorhabditis briggsae
A8JF71 1.94e-18 87 25 6 265 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Chlamydomonas reinhardtii
Q6Z6G6 1.99e-17 85 28 6 231 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Oryza sativa subsp. japonica
B5RV24 2.2e-16 82 26 8 250 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5FW05 1.07e-15 79 27 6 230 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus tropicalis
A5DPQ4 2.65e-15 79 25 8 264 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
D4GSH6 5.51e-15 77 29 10 244 1 ncsA tRNA 2-thiolation protein NcsA Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q7JWW5 5.8e-15 77 28 8 222 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila melanogaster
B1L8R5 6.17e-15 78 30 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga sp. (strain RQ2)
B3N7L9 6.63e-15 77 28 8 222 3 GG10584 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila erecta
B4HSL7 1.19e-14 76 28 8 222 3 GM20632 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila sechellia
B4P3W7 1.26e-14 76 28 8 222 3 GE22576 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila yakuba
B3MI77 1.71e-14 76 28 8 222 3 GF12710 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila ananassae
O64862 1.84e-14 76 26 6 231 2 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Arabidopsis thaliana
Q94480 5.44e-14 75 27 6 231 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Dictyostelium discoideum
A3GGB3 6.72e-14 74 23 8 294 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q05AW7 1.27e-13 73 25 5 229 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Xenopus laevis
Q9WZ48 1.28e-13 74 29 5 178 3 tilS tRNA(Ile)-lysidine synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B4NN33 1.36e-13 73 28 8 221 3 GK22963 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila willistoni
B4KLL0 2.14e-13 73 27 8 222 3 GI19452 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila mojavensis
B4J5B3 2.9e-13 72 27 8 222 3 GH20281 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila grimshawi
B4LM02 3.16e-13 72 28 6 221 3 GJ21203 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila virilis
P0CS71 3.45e-13 72 26 6 227 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CS70 3.46e-13 72 26 6 227 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q803X1 7.89e-13 71 27 7 224 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Danio rerio
Q16QI1 1.01e-12 71 27 6 216 3 AAEL011283 Cytoplasmic tRNA 2-thiolation protein 1 Aedes aegypti
Q28ZC1 1.1e-12 71 27 8 222 3 GA20807 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila pseudoobscura pseudoobscura
B4GHY8 1.24e-12 70 27 8 222 3 GL16852 Cytoplasmic tRNA 2-thiolation protein 1 Drosophila persimilis
Q6C8R5 1.27e-12 70 25 6 232 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
B7IFR8 1.29e-12 71 29 9 191 3 tilS tRNA(Ile)-lysidine synthase Thermosipho africanus (strain TCF52B)
A2Q879 1.45e-12 70 23 7 241 3 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q5AML2 9.63e-12 68 24 6 222 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
B0DK66 9.96e-12 68 26 6 220 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q6CWX6 1.27e-11 68 24 8 268 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A7TER7 2.78e-11 67 23 6 234 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q8RHN5 2.94e-11 67 30 3 166 3 tilS tRNA(Ile)-lysidine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q74C65 3.2e-11 67 28 6 195 3 tilS tRNA(Ile)-lysidine synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6FMB5 3.4e-11 66 23 6 232 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q755T1 4.51e-11 66 25 6 220 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q4P6R3 5.08e-11 66 23 7 259 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Ustilago maydis (strain 521 / FGSC 9021)
Q181G3 6.5e-11 66 25 8 265 3 tilS tRNA(Ile)-lysidine synthase Clostridioides difficile (strain 630)
Q7Q9I4 9.82e-11 65 24 7 226 3 AGAP005220 Cytoplasmic tRNA 2-thiolation protein 1 Anopheles gambiae
A5E3Q3 1.04e-10 65 24 7 223 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A8PVM6 1.48e-10 65 27 3 145 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q9ZGE2 2.67e-10 64 29 3 168 3 tilS tRNA(Ile)-lysidine synthase Heliobacterium mobile
Q8R7K9 2.7e-10 64 27 5 182 3 tilS tRNA(Ile)-lysidine synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A8F7F8 3.09e-10 64 27 4 185 3 tilS tRNA(Ile)-lysidine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q58558 1.57e-09 61 29 9 199 3 MJ1157 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B1WBV0 3.4e-09 60 24 7 222 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Rattus norvegicus
Q97EB0 4.12e-09 60 27 4 170 3 tilS tRNA(Ile)-lysidine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P53088 4.7e-09 60 21 7 252 1 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZTX8 5.39e-09 60 21 7 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain YJM789)
B3LHQ7 5.39e-09 60 21 7 252 3 NCS6 Cytoplasmic tRNA 2-thiolation protein 1 Saccharomyces cerevisiae (strain RM11-1a)
Q82VP4 6.46e-09 60 26 8 230 3 tilS tRNA(Ile)-lysidine synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q99J10 7.2e-09 60 24 7 222 2 Ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Mus musculus
Q8A7D1 7.69e-09 60 26 5 169 3 tilS tRNA(Ile)-lysidine synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
O94282 1.38e-08 58 24 9 265 1 ncs6 Cytoplasmic tRNA 2-thiolation protein 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9WY40 1.81e-08 58 26 7 220 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q3ZYX5 2.03e-08 58 28 5 191 3 tilS tRNA(Ile)-lysidine synthase Dehalococcoides mccartyi (strain CBDB1)
Q0TMI0 3.92e-08 57 27 5 181 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8KC15 4.36e-08 57 24 3 171 3 tilS tRNA(Ile)-lysidine synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q72LF3 5.12e-08 57 25 5 216 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C0QU23 5.75e-08 57 25 5 180 3 tilS tRNA(Ile)-lysidine synthase Persephonella marina (strain DSM 14350 / EX-H1)
A8B000 5.97e-08 57 28 6 172 3 tilS tRNA(Ile)-lysidine synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8XHL1 6.74e-08 57 27 5 181 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain 13 / Type A)
Q7Z7A3 9.43e-08 56 27 5 145 1 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Homo sapiens
A9BJK2 1.31e-07 55 27 4 148 3 tilS tRNA(Ile)-lysidine synthase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q899H5 1.64e-07 55 26 4 175 3 tilS tRNA(Ile)-lysidine synthase Clostridium tetani (strain Massachusetts / E88)
Q65PF4 3.51e-07 55 25 7 189 3 tilS tRNA(Ile)-lysidine synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8EU18 7.74e-07 53 25 4 182 3 tilS tRNA(Ile)-lysidine synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O58038 8.89e-07 53 25 12 269 1 ttuA tRNA-5-methyluridine(54) 2-sulfurtransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q601M6 1.62e-06 52 26 9 207 3 tilS tRNA(Ile)-lysidine synthase Mesomycoplasma hyopneumoniae (strain 232)
Q67JG9 1.84e-06 52 27 5 180 3 tilS tRNA(Ile)-lysidine synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A6LBU3 1.92e-06 52 24 5 177 3 tilS tRNA(Ile)-lysidine synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q58873 2.09e-06 52 26 8 218 3 MJ1478 tRNA-5-methyluridine(54) 2-sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5L3T3 2.17e-06 52 25 6 184 1 tilS tRNA(Ile)-lysidine synthase Geobacillus kaustophilus (strain HTA426)
Q8EWQ7 3.11e-06 51 21 6 202 3 tilS tRNA(Ile)-lysidine synthase Malacoplasma penetrans (strain HF-2)
Q0VC66 3.55e-06 51 26 5 145 2 CTU1 Cytoplasmic tRNA 2-thiolation protein 1 Bos taurus
Q8DIH2 3.59e-06 51 25 4 170 3 tilS tRNA(Ile)-lysidine synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A3CJX7 4.01e-06 51 25 5 183 3 tilS tRNA(Ile)-lysidine synthase Streptococcus sanguinis (strain SK36)
Q4W568 4.55e-06 51 28 7 179 3 tilS1 tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUE9 4.55e-06 51 28 7 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7MTC4 6.13e-06 51 28 10 190 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q73FE5 7.87e-06 50 26 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q0SM64 8.1e-06 50 23 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella afzelii (strain PKo)
Q57909 8.78e-06 50 26 8 237 3 MJ0485 Probable sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q65ZY6 9.02e-06 50 23 5 213 3 tilS tRNA(Ile)-lysidine synthase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q6MLS8 1.05e-05 50 23 6 237 3 tilS tRNA(Ile)-lysidine synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5M6K9 1.18e-05 50 25 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M217 1.18e-05 50 25 3 132 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain CNRZ 1066)
Q9KGH8 1.37e-05 50 25 5 181 3 tilS tRNA(Ile)-lysidine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7J0N4 1.66e-05 49 24 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ZS7)
O51728 1.66e-05 49 24 5 213 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q2GC97 1.89e-05 49 23 6 188 3 tilS tRNA(Ile)-lysidine synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8Y074 2.5e-05 49 23 4 208 3 tilS tRNA(Ile)-lysidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5CFP2 2.82e-05 48 21 6 200 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Boryong)
Q5F8F6 2.83e-05 48 27 6 179 3 tilS tRNA(Ile)-lysidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q97TC5 3.33e-05 48 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B3CUJ5 3.34e-05 48 21 6 200 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Ikeda)
Q8DRP9 3.39e-05 48 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04N53 3.39e-05 48 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1C992 3.42e-05 48 25 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain 70585)
Q7NT72 4.34e-05 48 28 8 192 3 tilS tRNA(Ile)-lysidine synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q81VX7 4.43e-05 48 26 3 141 3 tilS tRNA(Ile)-lysidine synthase Bacillus anthracis
Q6HPV4 4.47e-05 48 26 3 141 3 tilS tRNA(Ile)-lysidine synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q88MG3 6.03e-05 47 24 10 219 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q63HD6 6.05e-05 48 25 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ZK / E33L)
O67728 7.8e-05 47 26 5 172 1 tilS tRNA(Ile)-lysidine synthase Aquifex aeolicus (strain VF5)
B2RMB4 7.86e-05 47 28 10 190 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q3KKJ9 9.11e-05 47 25 5 162 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
O84847 9.88e-05 47 25 5 162 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BAU8 0.000102 47 25 5 162 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B969 0.000102 47 25 5 162 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q32RX0 0.000102 47 25 5 161 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Staurastrum punctulatum
Q92JY3 0.000109 47 26 9 205 3 tilS tRNA(Ile)-lysidine synthase Rhizobium meliloti (strain 1021)
Q92F56 0.000115 47 22 5 183 3 tilS/hprT Bifunctional protein TilS/HprT Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q724J4 0.000116 47 24 5 179 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serotype 4b (strain F2365)
Q0BMM2 0.000183 46 24 5 169 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A488 0.000183 46 24 5 169 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NB76 0.000183 46 24 5 169 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q8YAC7 0.000193 46 22 5 179 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C1CNP4 0.00021 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Taiwan19F-14)
B2IQZ8 0.000212 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain CGSP14)
B5E578 0.000212 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 19F (strain G54)
C1CN76 0.000216 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain P1031)
B1I6Y3 0.000222 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Hungary19A-6)
B8ZJI9 0.000226 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CH91 0.000236 46 24 5 160 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain JJA)
Q822B9 0.000243 45 25 6 182 3 tilS tRNA(Ile)-lysidine synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q81J84 0.000263 45 25 2 142 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8E2H4 0.000265 45 25 5 157 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Y2 0.000265 45 25 5 157 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype III (strain NEM316)
Q5R0Q7 0.000277 45 27 9 182 3 tilS tRNA(Ile)-lysidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_12375
Feature type CDS
Gene ttcA
Product tRNA 2-thiocytidine(32) synthetase TtcA
Location 61342 - 62268 (strand: -1)
Length 927 (nucleotides) / 308 (amino acids)
In genomic island -

Contig

Accession ZDB_527
Length 181446 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1062
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01171 PP-loop family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0037 Translation, ribosomal structure and biogenesis (J) J tRNA(Ile)-lysidine synthase TilS/MesJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14058 tRNA 2-thiocytidine biosynthesis protein TtcA - -

Protein Sequence

MNTPKEQYNINKLQKRLRSHTGKAIADFNMIEDGDRIMVCLSGGKDSYTLLSILQSLQQSAPIRFSLVAVNLDQKQPGFPEHILPEYLEKLGVEYKIVEENTYGIVKEKIPEGKTTCSLCSRLRRGILYRTATELGATKIALGHHRDDILQTLFLNMFYGGKLKGMPPKLMSDDGKHVVIRPLAYCREKDIERFAEAKGFPIIPCNLCGSQPNLQRQVIKDLLRDWDKRYPGRIETMFRATQNVVPSHLCDTELFDFKSIHYGSEVVDGGDLAFDRETLPVQPVWEDEDDDGDSPDFTELRLDVTEVK

Flanking regions ( +/- flanking 50bp)

GCGGCCGGCCTGACACAGGCACCAGCCAAACCCGTTAAGAACAGTAAGACATGAATACACCGAAAGAACAGTACAACATCAATAAATTGCAAAAGCGCCTGCGCAGCCATACCGGCAAAGCAATCGCAGATTTTAATATGATTGAGGACGGCGACCGCATCATGGTTTGCCTGTCCGGCGGCAAAGACAGTTACACCCTGCTTTCCATTCTGCAGAGCCTGCAGCAGAGCGCCCCCATCCGTTTTTCCCTGGTGGCGGTGAATCTCGATCAGAAGCAACCGGGTTTCCCTGAGCATATTTTGCCGGAATATCTGGAAAAACTGGGCGTTGAATATAAAATCGTCGAAGAAAATACCTACGGGATTGTGAAAGAAAAAATCCCGGAAGGGAAAACCACCTGTTCCCTCTGCTCCCGTCTGCGCCGGGGCATTTTGTACCGCACCGCGACTGAGCTGGGTGCAACCAAAATCGCCCTTGGCCACCACCGCGACGATATTCTGCAGACCCTGTTCCTGAATATGTTTTACGGCGGCAAACTCAAAGGCATGCCGCCGAAGCTGATGAGTGACGATGGTAAACATGTGGTGATCCGCCCACTGGCCTATTGCCGTGAGAAAGATATTGAACGTTTCGCCGAAGCCAAAGGGTTCCCGATCATTCCGTGTAACCTGTGCGGCTCTCAGCCGAACCTGCAGCGTCAGGTTATCAAAGATCTGCTGCGCGACTGGGATAAACGCTATCCGGGCCGGATTGAAACCATGTTCCGTGCCACACAGAATGTCGTACCATCACATTTATGTGACACTGAATTATTCGATTTCAAATCTATCCATTACGGCAGTGAAGTCGTCGACGGTGGTGATCTCGCATTTGACCGCGAAACTCTGCCTGTTCAACCGGTATGGGAAGATGAGGATGATGACGGCGATAGCCCGGATTTCACAGAATTACGTCTGGATGTGACGGAAGTGAAATAATCACGCTGTTATAGTGCCGTGCCACGGAGGGTACGGCCTGAATATTGGCG