Homologs in group_3738
2 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| PMI_RS06595 | PMI_RS06595 | 23.8 | Proteus mirabilis HI4320 | - | outer membrane beta-barrel protein |
| PMI_RS14585 | PMI_RS14585 | 39.6 | Proteus mirabilis HI4320 | - | Ail/Lom family outer membrane beta-barrel protein |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| P16454 | 5.45e-46 | 152 | 45 | 0 | 178 | 1 | ail | Attachment invasion locus protein | Yersinia enterocolitica |
| Q56957 | 4.63e-43 | 144 | 43 | 3 | 183 | 3 | ail | Attachment invasion locus protein | Yersinia pseudotuberculosis serotype I (strain IP32953) |
| P25253 | 5.91e-28 | 105 | 40 | 6 | 158 | 1 | ompX | Outer membrane protein X | Enterobacter cloacae |
| P0A920 | 1.85e-26 | 101 | 35 | 5 | 170 | 3 | ompX | Outer membrane protein X | Shigella flexneri |
| P0A917 | 1.85e-26 | 101 | 35 | 5 | 170 | 1 | ompX | Outer membrane protein X | Escherichia coli (strain K12) |
| P0A918 | 1.85e-26 | 101 | 35 | 5 | 170 | 3 | ompX | Outer membrane protein X | Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) |
| P0A919 | 1.85e-26 | 101 | 35 | 5 | 170 | 3 | ompX | Outer membrane protein X | Escherichia coli O157:H7 |
| P23988 | 1.55e-23 | 94 | 34 | 6 | 188 | 3 | pagC | Virulence membrane protein PagC | Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) |
| P03701 | 1.56e-14 | 71 | 30 | 4 | 155 | 1 | lom | Outer membrane protein lom | Escherichia phage lambda |
| Source | Proteus mirabilis HI4320 |
|---|---|
| Locus tag | PMI_RS06560 |
| Feature type | CDS |
| Gene | - |
| Product | Ail/Lom family outer membrane beta-barrel protein |
| Location | 1438086 - 1438622 (strand: -1) |
| Length | 537 (nucleotides) / 178 (amino acids) |
| Accession | NC_010554 |
|---|---|
| Length | 4063606 nucleotides |
| Topology | circular |
| Plasmid | False |
| Orthogroup | group_3738 | |
|---|---|---|
| Orthogroup size | 3 | |
| N. genomes | 1 |
| PF13505 | Outer membrane protein beta-barrel domain |
|---|
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG3637 | Cell wall/membrane/envelope biogenesis (M) | M | Opacity protein LomR and related surface antigens |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K16078 | attachment invasion locus protein | - | - |
MKFNFLLSTSILVVSTLSFNAYATLENTVSIGYAKSKLKVDEDLINDNLKGINLKYNHEVANDWGVISSFSYAKNKNDGYDHWGYAGTSKISYYSLTAGPSYRLNNYVSAYGLIGFGYFHEDFHYYDEREKENKISMAYGLGVQVNPITNLAIDVSYEYSKLYDIDFTTWVVGIGYRF
AAAAAATATAATTTTTTTAGTTTTTTTGTTATTTTATATAGAGAATAAAAATGAAATTTAATTTTTTGCTTTCAACTTCAATACTCGTTGTTTCTACTCTTTCTTTTAATGCTTATGCAACATTAGAAAATACAGTGTCGATAGGGTATGCTAAATCTAAATTGAAAGTCGATGAAGATTTAATAAATGATAACCTTAAAGGTATTAACTTAAAATATAATCATGAAGTAGCTAATGATTGGGGCGTTATCAGTTCGTTTTCATATGCAAAAAATAAAAATGATGGTTATGATCATTGGGGATATGCAGGTACTTCAAAGATTAGCTACTATTCGTTAACGGCAGGTCCAAGTTACCGCCTTAACAATTATGTCAGTGCATATGGATTAATAGGTTTTGGCTATTTTCATGAAGACTTTCACTACTATGATGAAAGAGAAAAAGAAAATAAGATATCAATGGCTTATGGATTAGGTGTACAAGTAAACCCAATCACTAACTTAGCTATTGATGTTTCTTATGAATACTCCAAACTATATGATATTGATTTTACTACTTGGGTAGTGGGTATCGGTTATCGTTTTTAATCAAAGGTGTCACACACGATAGTCAATATATTTTTTAAGGTCGCTTTTGC
