Homologs in group_679

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02570 FBDBKF_02570 80.4 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_03040 EHELCC_03040 80.4 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_00420 NLDBIP_00420 80.4 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_01615 LHKJJB_01615 80.4 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_01655 HKOGLL_01655 80.4 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
F4V73_RS05000 F4V73_RS05000 79.2 Morganella psychrotolerans - amidohydrolase

Distribution of the homologs in the orthogroup group_679

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_679

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0LMI3 1.12e-119 360 40 4 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2LTB7 3.19e-110 336 37 3 436 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
Q2LUH4 2.79e-108 331 39 4 443 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
B5YLB7 2.72e-104 320 36 5 430 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B8DKS6 2.49e-101 313 38 6 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q8PUQ3 3.16e-100 310 39 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TRA4 2.68e-97 302 39 8 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B1I2P4 6.84e-95 296 38 7 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
B0K2W0 1.6e-94 295 36 6 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 1.6e-94 295 36 6 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q466Q9 1.83e-94 295 39 9 437 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q72B14 1.95e-94 295 37 5 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VD37 2.26e-94 295 37 5 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
A5D1G6 1.77e-93 292 37 8 436 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8J2Q8 3.94e-93 291 37 6 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q0AYV2 8.67e-93 290 37 7 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8R9L4 2.15e-91 287 37 8 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B6YUF8 2.85e-91 286 38 8 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
B8CX03 3.44e-91 286 36 10 430 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
O66851 8.59e-91 285 37 4 411 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
A4J675 9.19e-91 285 37 7 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q3AC64 1.41e-88 280 38 7 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q12WS1 3.49e-88 279 37 7 438 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q5JER0 3.6e-88 278 38 8 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1MR44 2.65e-87 276 34 5 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
O27549 5.89e-87 275 36 8 405 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B5YDN9 6.57e-87 275 38 8 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q8TYD4 1.59e-86 274 35 9 434 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q67NQ5 3.02e-86 274 38 8 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C6A048 3.77e-86 273 36 10 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
B8E183 6.76e-86 273 40 5 381 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A5UMN6 4.35e-84 268 35 7 416 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
C5BSJ0 8.14e-84 268 36 3 424 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
C1EPN0 1.18e-83 267 34 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
A7GNR9 4.79e-83 265 33 8 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q81F14 5.06e-83 265 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7IS56 6.13e-83 265 34 8 436 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
O31352 1.08e-82 265 34 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RCM7 1.13e-82 265 34 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
B7JJI0 2.6e-82 263 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 2.6e-82 263 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 2.6e-82 263 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 2.6e-82 263 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
Q24UA2 6.86e-82 262 35 9 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
B7HMN9 9.62e-82 262 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
B8FRL9 1.15e-81 262 35 9 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q6HK87 1.41e-81 261 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 1.41e-81 261 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
B7HIQ2 1.08e-80 259 33 8 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
Q9V0Y5 1.17e-80 259 36 7 413 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q8U0P7 6.1e-79 254 36 10 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2NHL6 1.25e-78 254 34 9 429 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q2RJW1 1.16e-77 251 35 7 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
O59184 2e-77 250 36 7 379 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q58936 2.14e-77 250 35 10 414 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4XJI3 4.23e-76 247 33 9 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q21IS0 7.1e-76 247 34 5 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q891Y7 2.01e-73 240 32 8 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
A6VH76 6.87e-73 239 35 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q5UYR3 1.29e-71 236 35 10 436 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A4FW32 5.36e-71 234 32 11 427 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A3DEQ2 8e-71 234 31 6 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A9A9H3 2.35e-70 232 34 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6UQD4 6.96e-70 231 34 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6UUG9 1.29e-69 230 33 9 391 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q3ITF7 3.48e-69 229 36 9 406 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q6LX61 5.25e-69 229 32 11 427 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q9HN51 5e-68 226 36 10 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
A7I6C5 7.24e-68 226 36 8 381 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q9KC82 2.76e-67 224 32 10 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0B7V2 1.14e-65 219 33 11 411 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
O29265 8.38e-65 218 34 14 430 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q2FRU6 1.65e-64 218 33 9 413 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q5WGA8 2.03e-64 217 32 10 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q18EV7 9.53e-63 213 33 9 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
O29701 7.19e-62 210 34 8 391 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9X034 1.11e-59 204 33 8 376 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q92342 2.1e-59 204 30 11 450 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P72156 8.73e-54 190 28 9 464 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9EYU0 1.87e-52 186 28 9 464 1 triA Melamine deaminase Paracidovorax citrulli
Q52725 7.98e-34 135 29 2 235 1 trzA S-triazine hydrolase Gordonia rubripertincta
Q9I6Z0 1.33e-30 126 25 9 442 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07729 1.22e-26 115 26 8 340 1 GUD1 Probable guanine deaminase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Y2T3 6.65e-25 110 24 10 369 1 GDA Guanine deaminase Homo sapiens
Q5RAV9 2.41e-24 108 24 10 369 2 GDA Guanine deaminase Pongo abelii
Q9VMY9 2.81e-24 108 25 15 450 1 DhpD Guanine deaminase Drosophila melanogaster
Q9WTT6 6.04e-24 107 25 8 335 1 Gda Guanine deaminase Rattus norvegicus
Q9R111 1.04e-23 106 24 9 338 1 Gda Guanine deaminase Mus musculus
P95442 6.88e-23 104 25 16 464 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
Q86AW9 6.28e-22 101 24 13 385 1 guaD Guanine deaminase Dictyostelium discoideum
P76641 7.92e-21 98 22 12 414 1 guaD Guanine deaminase Escherichia coli (strain K12)
O14057 9.61e-21 98 26 11 345 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q46812 1.11e-19 94 23 17 437 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
P0CI72 3.28e-16 84 24 16 434 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q9RYX4 2.45e-14 78 22 10 412 3 guaD Probable guanine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6MJP9 3.71e-13 74 26 18 383 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9HU77 3.36e-12 71 21 13 396 1 hutF Formimidoylglutamate deiminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4J872 4.07e-07 56 21 12 387 3 ade Adenine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
O27075 4.27e-07 55 23 15 411 3 MTH_994 Putative aminohydrolase MTH_994 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q6ANH2 5.55e-07 55 23 17 406 3 ade1 Adenine deaminase 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9RW45 2.58e-05 50 22 9 315 1 DR_0824 Aminodeoxyfutalosine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B7GUU8 3.58e-05 49 22 16 405 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain AB307-0294)
P64418 4.07e-05 49 24 21 420 1 hutI Imidazolonepropionase Staphylococcus aureus (strain N315)
P64417 4.07e-05 49 24 21 420 3 hutI Imidazolonepropionase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVB2 4.07e-05 49 24 21 420 3 hutI Imidazolonepropionase Staphylococcus aureus (strain JH9)
A6U455 4.07e-05 49 24 21 420 3 hutI Imidazolonepropionase Staphylococcus aureus (strain JH1)
A7X5T3 4.07e-05 49 24 21 420 3 hutI Imidazolonepropionase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8RFG1 4.81e-05 49 36 3 80 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RFG1 0.000221 47 29 5 145 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A7GQZ8 4.94e-05 49 34 2 78 3 hutI Imidazolonepropionase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q73RN8 5.25e-05 49 30 5 130 3 hutI Imidazolonepropionase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B7I268 5.32e-05 48 22 16 405 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain AB0057)
Q2YYV8 5.88e-05 48 24 19 418 3 hutI Imidazolonepropionase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q0QLE9 8.67e-05 48 35 0 62 1 Ena Enamidase Eubacterium barkeri
A9VPT6 0.000113 48 36 1 76 3 hutI Imidazolonepropionase Bacillus mycoides (strain KBAB4)
P42084 0.000165 47 32 2 80 1 hutI Imidazolonepropionase Bacillus subtilis (strain 168)
B2VC08 0.000174 47 34 2 85 3 hutI Imidazolonepropionase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6KX92 0.000177 47 26 4 135 3 hutI Imidazolonepropionase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q8RCH7 0.000186 47 23 16 390 3 hutI Imidazolonepropionase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A3MA48 0.000193 47 29 2 97 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I2C1 0.000208 47 29 2 97 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain ACICU)
B7ISJ0 0.000368 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain G9842)
Q18C47 0.000373 46 35 2 65 3 pyrC Dihydroorotase Clostridioides difficile (strain 630)
B7HCC8 0.000457 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain B4264)
Q733I0 0.000486 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1EN91 0.000491 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain 03BB102)
A0RH37 0.000491 46 36 1 76 3 hutI Imidazolonepropionase Bacillus thuringiensis (strain Al Hakam)
Q6HFF1 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9IUG8 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain Q1)
B7HKI9 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH187)
B7JI78 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH820)
Q81Y47 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus anthracis
C3L984 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4M0 0.000495 46 36 1 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain A0248)
P42358 0.000524 45 29 2 97 3 hutI Imidazolonepropionase (Fragment) Streptococcus gordonii
Q68AP4 0.00055 46 37 2 74 1 nfdA N-substituted formamide deformylase Arthrobacter pascens
Q06555 0.000698 45 24 7 194 3 aepA Exoenzymes regulatory protein AepA Pectobacterium carotovorum subsp. carotovorum
Q5WCP8 0.000745 45 34 4 126 3 hutI Imidazolonepropionase Shouchella clausii (strain KSM-K16)
A7RX26 0.000787 45 27 3 127 3 amdhd1 Probable imidazolonepropionase Nematostella vectensis
Q637I0 0.000808 45 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ZK / E33L)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06080
Feature type CDS
Gene -
Product amidohydrolase
Location 1332925 - 1334325 (strand: 1)
Length 1401 (nucleotides) / 466 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_679
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12960 5-methylthioadenosine/S-adenosylhomocysteine deaminase [EC:3.5.4.31 3.5.4.28] Cysteine and methionine metabolism
Metabolic pathways		 -

Protein Sequence

MSFTKSMLALAVMAVSFTSHAAKQADLMIVDGTVLTMDAQNQVIEQGTVVVKENKIIAVGGPELTQEYQANKVLDVDGDIVMPGLINTHTHASMTVFRSLADDVPDRLHRYIFPLENKMVSRDMVRVGANLANVEMVKGGVTTYVDMYYFEDEVAKTVDKMGNRAILGESVINFPVADAQTPEEGIQYAVNFINEYKDHPRIIPAFAPHAPYTNTTENLQKIAKLSVELDAPVMIHLAETDREKEEIAKRTDGKSPVQYMADIGALNNKVIAAHAIMVDEQDIDLLKKYDVGVAHNISANTKSAKGVSPVVAMLEKGVRVGLGTDGPMSSNTLTTMNELNLVGKIHKLENKDRAAMPPLTVVEMATIGSAKALHMEDKLGSLESGKLADIIVVDTKAPNMVPMYSPYAALVYGANGSNVRHTIVDGKILMEDRQLLTVDEQAIISEAQNFANKVRQTVVDSGEVVK

Flanking regions ( +/- flanking 50bp)

ATCAATAAAATAATAAACTTTTGAATATTCTTACCATCCGAGAGGTAGTTATGTCATTTACTAAATCAATGCTTGCACTCGCTGTTATGGCGGTTTCTTTTACTAGTCACGCAGCCAAACAGGCTGATTTAATGATTGTCGATGGCACAGTGTTAACAATGGACGCACAAAATCAGGTTATCGAACAAGGAACGGTTGTTGTAAAAGAAAATAAAATTATCGCCGTTGGGGGGCCTGAGTTAACACAAGAATACCAAGCCAACAAAGTGTTAGATGTGGATGGTGATATCGTGATGCCAGGATTAATTAATACCCACACACATGCATCAATGACGGTTTTTCGCTCTTTAGCCGATGACGTGCCAGACCGATTACATCGTTATATTTTCCCTTTAGAAAATAAAATGGTGTCTCGCGATATGGTTCGCGTGGGAGCAAACCTCGCCAATGTTGAAATGGTAAAAGGGGGAGTAACTACCTATGTTGATATGTATTATTTTGAAGATGAAGTCGCTAAAACGGTTGATAAGATGGGAAATAGAGCCATCTTAGGTGAATCAGTGATTAATTTTCCGGTGGCTGATGCACAAACCCCTGAAGAAGGCATTCAATATGCTGTCAATTTTATTAATGAATATAAAGATCACCCGCGCATTATTCCTGCCTTTGCACCTCATGCACCTTATACCAATACCACAGAGAATCTGCAAAAAATTGCTAAACTCTCGGTAGAGCTTGATGCCCCTGTGATGATCCATTTAGCAGAAACCGATAGAGAGAAAGAAGAAATTGCAAAACGAACCGATGGTAAAAGCCCAGTTCAATATATGGCAGATATTGGCGCTTTAAATAATAAAGTCATTGCCGCTCATGCGATTATGGTTGATGAGCAAGATATTGATTTATTAAAAAAATATGATGTAGGTGTGGCTCATAATATTAGTGCTAATACCAAATCAGCCAAAGGTGTTTCGCCCGTTGTTGCCATGCTAGAAAAAGGTGTTCGTGTTGGTTTAGGGACTGACGGGCCAATGTCGAGCAATACACTCACAACGATGAATGAGTTAAATTTAGTAGGCAAAATTCATAAATTAGAGAATAAAGATCGCGCCGCAATGCCACCATTAACCGTCGTTGAAATGGCAACAATAGGCTCAGCCAAGGCATTACATATGGAAGATAAATTAGGCTCTTTAGAATCGGGAAAACTTGCTGATATTATTGTTGTTGATACTAAAGCACCTAATATGGTGCCTATGTATAGCCCATATGCAGCATTAGTTTATGGTGCGAATGGAAGTAATGTTCGTCATACCATTGTAGATGGTAAAATTTTGATGGAAGATCGCCAACTGTTAACCGTAGATGAACAAGCGATTATCAGTGAAGCTCAAAATTTTGCGAATAAAGTACGCCAAACCGTTGTTGATAGTGGTGAAGTTGTTAAATAGATTGTAGTAATATAGCGTTAATAAGTTTATAAAAGGTGATTTGATATCAA