Homologs in group_679

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02570 FBDBKF_02570 100.0 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_00420 NLDBIP_00420 100.0 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_01615 LHKJJB_01615 100.0 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_01655 HKOGLL_01655 100.0 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
F4V73_RS05000 F4V73_RS05000 88.0 Morganella psychrotolerans - amidohydrolase
PMI_RS06080 PMI_RS06080 80.4 Proteus mirabilis HI4320 - amidohydrolase

Distribution of the homologs in the orthogroup group_679

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_679

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0LMI3 1.23e-123 370 43 4 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2LTB7 1.52e-115 349 38 3 437 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
Q2LUH4 3.7e-110 335 40 4 439 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
B5YLB7 1.09e-107 329 38 5 430 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8PUQ3 9.12e-104 319 40 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TRA4 3.28e-101 312 39 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B8DKS6 6.38e-101 311 39 6 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q466Q9 1.38e-98 305 39 9 443 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
A1VD37 1.02e-96 301 37 7 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
Q72B14 1.17e-96 301 37 7 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B1I2P4 1.24e-96 300 39 7 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
B0K2W0 3.55e-93 291 37 6 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 3.55e-93 291 37 6 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q12WS1 2.84e-92 289 38 7 440 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q1MR44 1.17e-91 288 35 5 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
B8J2Q8 1.7e-91 287 36 6 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
O66851 4.76e-91 286 37 4 408 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q3AC64 2.3e-90 284 37 7 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5D1G6 7.99e-90 283 37 9 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0AYV2 5.87e-89 281 36 8 436 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8TYD4 2.27e-88 279 36 9 434 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
O27549 3.76e-87 276 38 9 406 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8R9L4 1.38e-86 275 37 7 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B6YUF8 1.67e-86 274 38 8 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
Q2NHL6 2.08e-86 274 35 9 437 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A5UMN6 2.22e-86 274 35 8 441 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B8CX03 2.54e-86 274 36 10 430 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A4J675 2.99e-86 274 34 6 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q67NQ5 5.29e-86 273 37 9 440 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C5BSJ0 6.64e-85 270 34 3 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
C6A048 2.8e-83 266 36 8 410 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
B5YDN9 1.01e-82 264 39 6 381 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A7GNR9 2.18e-82 264 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C1EPN0 4.32e-82 263 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
Q21IS0 4.7e-82 263 34 5 444 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5JER0 1.11e-81 261 37 8 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A0RCM7 4.23e-81 260 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
B8E183 5.72e-81 260 39 5 381 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B7JJI0 1.68e-80 259 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 1.68e-80 259 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 1.68e-80 259 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 1.68e-80 259 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
B7IS56 7.12e-80 257 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
Q81F14 7.76e-80 257 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HMN9 1.2e-79 256 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
Q6HK87 1.62e-79 256 33 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 1.62e-79 256 33 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
O31352 4.12e-79 255 33 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9V0Y5 3.8e-78 252 38 6 378 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q24UA2 4.17e-78 253 35 9 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
B7HIQ2 5.35e-78 252 34 8 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
Q2RJW1 5.51e-78 252 37 7 420 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q58936 6.83e-78 251 35 10 422 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B8FRL9 9.29e-78 251 35 9 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q8U0P7 1.09e-77 251 35 8 412 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A3DEQ2 3.88e-74 242 32 6 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
O59184 1.52e-73 240 35 6 378 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6VH76 3.17e-73 239 34 8 383 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q3ITF7 8.99e-73 239 36 13 443 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A9A9H3 1.62e-72 238 34 6 381 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A4XJI3 4.3e-72 237 33 10 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4FW32 8.99e-72 236 34 6 381 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q891Y7 9.56e-72 236 29 5 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
Q5UYR3 1.07e-71 236 36 10 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A6UQD4 1.92e-71 235 34 8 383 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6UUG9 2.16e-71 235 33 8 388 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q9HN51 1.49e-70 233 37 10 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q6LX61 4.92e-70 231 33 6 381 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A0B7V2 4.12e-68 226 34 8 386 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q9KC82 6.63e-68 226 33 11 440 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O29265 5.24e-66 221 35 10 381 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A7I6C5 6.36e-66 221 36 8 381 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q5WGA8 6.05e-65 218 31 10 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q2FRU6 3.66e-62 211 33 9 401 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
O29701 1.14e-61 209 33 10 409 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q18EV7 2.09e-60 207 31 8 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q92342 5.45e-58 201 29 12 457 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P72156 6.44e-56 196 30 8 440 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9X034 5.7e-55 191 30 9 411 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9EYU0 1.27e-54 192 30 8 440 1 triA Melamine deaminase Paracidovorax citrulli
Q52725 9.78e-33 132 30 2 235 1 trzA S-triazine hydrolase Gordonia rubripertincta
Q9I6Z0 3.64e-32 130 27 8 390 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07729 1.46e-28 121 26 7 338 1 GUD1 Probable guanine deaminase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5RAV9 1.56e-25 112 24 11 416 2 GDA Guanine deaminase Pongo abelii
Q9Y2T3 1.56e-25 112 24 11 416 1 GDA Guanine deaminase Homo sapiens
Q86AW9 6.4e-25 110 25 14 395 1 guaD Guanine deaminase Dictyostelium discoideum
Q9VMY9 3.63e-24 107 25 12 389 1 DhpD Guanine deaminase Drosophila melanogaster
Q9R111 3.91e-24 107 24 14 419 1 Gda Guanine deaminase Mus musculus
Q9WTT6 1.04e-23 106 25 12 386 1 Gda Guanine deaminase Rattus norvegicus
O14057 3.62e-23 105 27 11 345 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P95442 7.04e-21 98 25 16 459 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
P76641 1.79e-19 94 23 17 428 1 guaD Guanine deaminase Escherichia coli (strain K12)
P0CI72 2.02e-19 94 25 15 432 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q9RYX4 6.99e-19 92 24 10 402 3 guaD Probable guanine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q46812 9.83e-17 85 24 17 437 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
Q6MJP9 1.37e-11 69 25 17 395 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9HU77 1.72e-11 69 22 12 361 1 hutF Formimidoylglutamate deiminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8RFG1 1.3e-10 66 27 19 387 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A4J872 6.83e-10 65 24 15 389 3 ade Adenine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6KX92 2.98e-08 59 21 16 421 3 hutI Imidazolonepropionase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
O27075 9.68e-08 57 24 15 408 3 MTH_994 Putative aminohydrolase MTH_994 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P64418 2.32e-06 53 25 19 416 1 hutI Imidazolonepropionase Staphylococcus aureus (strain N315)
P64417 2.32e-06 53 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVB2 2.32e-06 53 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain JH9)
A6U455 2.32e-06 53 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain JH1)
A7X5T3 2.32e-06 53 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8RCH7 4.14e-06 52 23 16 403 3 hutI Imidazolonepropionase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8NV65 7.56e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain MW2)
Q6G6Z0 7.56e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain MSSA476)
A8Z519 7.63e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain USA300 / TCH1516)
A6QJH1 7.63e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain Newman)
Q5HDM7 7.63e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain COL)
Q2FVT6 7.63e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEG6 7.63e-06 51 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain USA300)
Q9RW45 1.21e-05 51 19 8 324 1 DR_0824 Aminodeoxyfutalosine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6ANH2 1.28e-05 51 22 15 407 3 ade1 Adenine deaminase 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7GQZ8 1.39e-05 50 35 2 78 3 hutI Imidazolonepropionase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2YYV8 1.41e-05 50 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q06555 1.49e-05 50 28 4 146 3 aepA Exoenzymes regulatory protein AepA Pectobacterium carotovorum subsp. carotovorum
Q6GEA5 1.71e-05 50 25 19 416 3 hutI Imidazolonepropionase Staphylococcus aureus (strain MRSA252)
P42358 3.38e-05 49 29 4 135 3 hutI Imidazolonepropionase (Fragment) Streptococcus gordonii
C1EN91 3.41e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain 03BB102)
A0RH37 3.41e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus thuringiensis (strain Al Hakam)
Q733I0 3.66e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HFF1 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9IUG8 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain Q1)
B7HKI9 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH187)
B7JI78 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH820)
Q81Y47 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus anthracis
C3L984 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4M0 3.72e-05 49 40 2 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain A0248)
A9VPT6 4.88e-05 49 39 2 76 3 hutI Imidazolonepropionase Bacillus mycoides (strain KBAB4)
Q637I0 5.92e-05 48 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ZK / E33L)
Q81AC8 7.18e-05 48 40 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCC8 7.44e-05 48 39 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain B4264)
A8AZ63 0.000271 47 30 5 136 3 hutI Imidazolonepropionase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B7ISJ0 0.000351 46 39 2 76 3 hutI Imidazolonepropionase Bacillus cereus (strain G9842)
Q0QLE9 0.000356 46 36 0 60 1 Ena Enamidase Eubacterium barkeri
Q73RN8 0.000387 46 31 4 94 3 hutI Imidazolonepropionase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
C5DA20 0.000578 45 42 2 54 3 hutI Imidazolonepropionase Geobacillus sp. (strain WCH70)
Q3ZXH1 0.000606 45 41 2 67 3 ade Adenine deaminase Dehalococcoides mccartyi (strain CBDB1)
Q1RF23 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli (strain UTI89 / UPEC)
Q8FK60 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD0 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8H7 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O1:K1 / APEC
B7MQM2 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O81 (strain ED1a)
B7ME34 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UKI9 0.001 45 31 7 138 3 allB Allantoinase Escherichia coli O127:H6 (strain E2348/69 / EPEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_03040
Feature type CDS
Gene ssnA
Product Cytosine/adenosine deaminase or related metal-dependent hydrolase
Location 600062 - 601459 (strand: -1)
Length 1398 (nucleotides) / 465 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_679
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12960 5-methylthioadenosine/S-adenosylhomocysteine deaminase [EC:3.5.4.31 3.5.4.28] Cysteine and methionine metabolism
Metabolic pathways		 -

Protein Sequence

MLLSRAFATTLLAAACSAYAADPADLMITDGTVLTMNPENTVFEHGTVVVSDGKIVAVGGPELTAKYQAKKVLDVKGDIVMPGLINTHTHGSMTVFRSLGDDVPDRLHRYIFPLENKLVSRDMVRTGANLANIEMIKGGVTTYADMYYFEDEVAKTVDKAGLRAVLGETIINFPVADAQTPEEGIAYAVRFIHKYKDHPRITPAFAPHAPYTNTTENLQKIAALSEELNVPVMIHLAETDREKEEIAKRTGGKSPVQYMADIGVLNNRLLAAHVIMADDNDLNLLKKYDVGVAHNISANTKSAKGVAPVTQMLEKGIRTGLGTDGPMSSNTLTTMNELNLVGKIHKLETKNRAAMPPLTVVEMATMGSARALHMDDKIGSLETGKLADIIVVDTKAPNMVPVYSPYAALVYGANGANVRHTIVDGVILMEDRQLLTVNENEIIQDAQRFAEKVRETVRASGEEVK

Flanking regions ( +/- flanking 50bp)

GATTAATGGCGGTGATATAGTAGGTTTTTCCGTTCAGTCATGAGGTTACTATGTTATTGTCCCGCGCGTTTGCCACCACACTGCTTGCTGCTGCCTGCTCCGCTTATGCTGCCGACCCGGCAGATCTGATGATAACGGACGGCACCGTGCTGACCATGAACCCGGAAAATACCGTATTTGAGCACGGTACCGTGGTGGTCAGTGACGGAAAAATTGTCGCCGTCGGCGGCCCTGAGCTGACAGCGAAATATCAGGCAAAAAAAGTGCTGGATGTAAAAGGCGATATTGTCATGCCGGGGCTGATAAACACCCACACTCACGGCTCGATGACGGTTTTCCGCTCTCTCGGGGATGATGTGCCGGATCGCCTGCACCGCTATATTTTCCCGCTGGAAAATAAACTGGTTTCCCGCGATATGGTGCGCACCGGCGCTAATCTGGCCAATATCGAAATGATTAAAGGCGGCGTGACCACCTATGCCGATATGTATTATTTCGAAGATGAGGTTGCGAAGACCGTAGATAAAGCAGGTTTACGCGCCGTGCTGGGTGAGACCATCATTAATTTCCCGGTTGCGGATGCACAGACGCCGGAAGAAGGGATCGCGTATGCGGTGCGCTTTATCCATAAATACAAAGATCATCCGCGCATCACACCGGCATTTGCCCCGCATGCCCCGTATACCAATACCACTGAAAACTTACAGAAAATCGCGGCACTGTCTGAAGAACTGAATGTACCGGTGATGATCCATCTGGCGGAAACAGATCGCGAAAAAGAAGAGATCGCCAAACGCACCGGCGGGAAAAGCCCGGTGCAGTATATGGCGGATATCGGCGTGCTGAATAACCGCCTGCTGGCGGCACATGTCATTATGGCCGATGATAATGATCTGAATCTGCTGAAAAAATATGATGTCGGGGTGGCACACAATATCAGTGCCAATACGAAATCCGCCAAAGGTGTGGCACCGGTCACGCAAATGCTGGAAAAAGGGATCCGCACCGGTCTCGGTACCGACGGGCCGATGTCCTCTAATACATTAACCACCATGAATGAACTCAATCTGGTCGGTAAAATCCATAAACTGGAAACCAAAAACCGCGCAGCCATGCCTCCGCTGACCGTGGTTGAAATGGCGACCATGGGATCGGCCCGTGCACTGCATATGGATGATAAAATCGGCTCACTGGAAACCGGGAAACTGGCAGATATCATTGTGGTGGATACCAAAGCACCGAATATGGTGCCGGTGTATAGTCCGTATGCCGCCCTGGTTTATGGCGCAAACGGCGCCAATGTCCGCCATACCATTGTCGACGGTGTGATCCTGATGGAAGACCGGCAGTTACTGACCGTCAATGAAAATGAAATTATTCAGGATGCACAGCGTTTTGCGGAAAAAGTCCGTGAAACCGTGCGCGCTTCAGGGGAAGAGGTGAAATGACAGAAAAACTCAAATGTGCGCTGATTTATGATTTTGACGGCACCCTGGCA