Homologs in group_1469

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09425 FBDBKF_09425 79.5 Morganella morganii S1 ahpF alkyl hydroperoxide reductase subunit F
EHELCC_09985 EHELCC_09985 79.5 Morganella morganii S2 ahpF alkyl hydroperoxide reductase subunit F
NLDBIP_10330 NLDBIP_10330 79.5 Morganella morganii S4 ahpF alkyl hydroperoxide reductase subunit F
LHKJJB_11025 LHKJJB_11025 79.5 Morganella morganii S3 ahpF alkyl hydroperoxide reductase subunit F
HKOGLL_14085 HKOGLL_14085 79.5 Morganella morganii S5 ahpF alkyl hydroperoxide reductase subunit F
F4V73_RS10540 F4V73_RS10540 77.5 Morganella psychrotolerans ahpF alkyl hydroperoxide reductase subunit F

Distribution of the homologs in the orthogroup group_1469

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1469

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19480 0.0 861 79 0 518 1 ahpF Alkyl hydroperoxide reductase subunit F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P35340 0.0 861 79 0 518 1 ahpF Alkyl hydroperoxide reductase subunit F Escherichia coli (strain K12)
P0A156 0.0 702 66 2 520 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida
P0A155 0.0 702 66 2 520 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I6Z2 0.0 687 64 1 520 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O06465 0.0 667 64 3 523 3 ahpF Alkyl hydroperoxide reductase subunit F Xanthomonas campestris pv. phaseoli
P26829 0.0 613 56 4 519 1 ahpF NADH dehydrogenase Ferdinandcohnia aciditolerans (strain JCM 32973 / CCTCC AB 2017280 / YN-1)
P42974 0.0 590 56 5 517 1 ahpF NADH dehydrogenase Bacillus subtilis (strain 168)
P66013 0.0 545 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MW2)
Q6GC92 0.0 545 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MSSA476)
Q6GJR8 0.0 545 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MRSA252)
P99118 0.0 545 53 5 517 1 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain N315)
P66012 0.0 545 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIR6 0.0 544 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain COL)
O05204 0.0 544 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CMQ1 2.59e-176 509 52 5 497 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRY2 8.31e-176 508 52 5 497 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P80880 3.88e-50 177 32 3 311 1 trxB Thioredoxin reductase Bacillus subtilis (strain 168)
P39916 4.27e-50 177 35 7 322 3 trxB Thioredoxin reductase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O32823 2.86e-49 175 34 4 322 3 trxB Thioredoxin reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q928B5 1.42e-48 173 34 4 322 3 trxB Thioredoxin reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P23160 2.88e-48 172 33 5 314 3 None 34.2 kDa protein in rubredoxin operon Clostridium pasteurianum
Q1RJD8 1.85e-45 164 35 7 310 3 trxB Thioredoxin reductase Rickettsia bellii (strain RML369-C)
Q05741 4.81e-45 164 31 6 310 1 trxB Thioredoxin reductase Streptomyces clavuligerus
P9WHH1 6.13e-45 164 34 6 310 1 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH0 6.13e-45 164 34 6 310 3 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P52215 7.74e-45 163 30 6 310 2 trxB Thioredoxin reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KSS4 9.15e-45 163 35 9 315 3 trxB Thioredoxin reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P43788 1.1e-44 163 35 9 315 1 trxB Thioredoxin reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P38816 4.94e-44 162 31 5 338 1 TRR2 Thioredoxin reductase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FR39 6.26e-44 160 32 5 311 3 TRR1 Thioredoxin reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P0A9P4 8.09e-44 160 36 9 315 1 trxB Thioredoxin reductase Escherichia coli (strain K12)
P0A9P5 8.09e-44 160 36 9 315 3 trxB Thioredoxin reductase Escherichia coli O157:H7
O30973 8.14e-44 160 33 7 311 3 trxB Thioredoxin reductase Mycolicibacterium smegmatis
Q9ZD97 9.36e-44 160 34 7 310 3 trxB Thioredoxin reductase Rickettsia prowazekii (strain Madrid E)
Q68WT3 1.12e-43 160 34 7 310 3 trxB Thioredoxin reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9PR71 3.11e-43 159 34 6 314 3 trxB Thioredoxin reductase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q6BIS1 4.56e-43 159 31 5 318 3 TRR1 Thioredoxin reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P46843 7.21e-43 161 33 7 308 3 trxB/A Bifunctional thioredoxin reductase/thioredoxin Mycobacterium leprae (strain TN)
Q75CM8 9.78e-43 157 33 5 311 3 TRR1 Thioredoxin reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8CPY8 9.8e-43 157 33 5 307 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW4 9.8e-43 157 33 5 307 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4ULP1 1.08e-42 157 34 8 310 3 trxB Thioredoxin reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O22229 1.63e-42 162 32 7 312 1 NTRC NADPH-dependent thioredoxin reductase 3 Arabidopsis thaliana
Q6HA24 2.34e-42 157 33 5 311 3 TRR1 Thioredoxin reductase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q70G58 4.11e-42 160 32 7 318 1 Os07g0657900 Thioredoxin reductase NTRC Oryza sativa subsp. japonica
Q93HX6 4.14e-42 156 35 8 311 1 None Glucosaminate ammonia-lyase Pseudomonas fluorescens
Q92I02 4.63e-42 155 33 7 310 3 trxB Thioredoxin reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P66011 6.46e-42 155 33 4 309 1 trxB Thioredoxin reductase Staphylococcus aureus (strain MW2)
Q6GB66 6.46e-42 155 33 4 309 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MSSA476)
P99101 6.46e-42 155 33 4 309 1 trxB Thioredoxin reductase Staphylococcus aureus (strain N315)
P66010 6.46e-42 155 33 4 309 3 trxB Thioredoxin reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHQ4 6.46e-42 155 33 4 309 3 trxB Thioredoxin reductase Staphylococcus aureus (strain COL)
P29509 6.61e-42 155 32 6 311 1 TRR1 Thioredoxin reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7Z7S3 1.28e-41 155 33 7 309 2 TRR1 Thioredoxin reductase Pneumocystis carinii
Q92375 1.37e-41 154 33 8 321 1 trr1 Thioredoxin reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8J0U0 1.4e-41 155 34 7 309 2 TRR1 Thioredoxin reductase Pneumocystis jirovecii
Q6C7L4 1.68e-41 154 33 7 309 3 TRR1 Thioredoxin reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q54UU8 2.51e-41 154 33 9 318 3 trrA Thioredoxin reductase Dictyostelium discoideum
Q6GIM7 2.61e-41 154 33 5 309 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MRSA252)
P94284 1.39e-40 152 29 5 304 3 trxB Thioredoxin reductase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P51978 1.68e-40 152 34 8 318 3 cys-9 Thioredoxin reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9ZL18 1.43e-39 149 31 6 312 3 trxB Thioredoxin reductase Helicobacter pylori (strain J99 / ATCC 700824)
P52213 1.83e-39 149 32 7 317 3 trxB Thioredoxin reductase Peptoclostridium litorale
O84101 2.51e-38 145 32 10 313 3 trxB Thioredoxin reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P50971 2.89e-38 145 31 5 313 1 trxB Thioredoxin reductase Peptoclostridium acidaminophilum
Q39242 3.27e-38 147 33 10 318 2 NTR2 Thioredoxin reductase 2 Arabidopsis thaliana
P43496 4.77e-38 145 32 8 321 1 TRR1 Thioredoxin reductase Penicillium chrysogenum
P56431 1.13e-37 144 30 7 313 1 trxB Thioredoxin reductase Helicobacter pylori (strain ATCC 700392 / 26695)
P81433 1.96e-37 143 31 9 328 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P47348 2.02e-37 143 32 5 316 3 trxB Thioredoxin reductase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q39243 3.73e-37 144 35 10 318 1 NTR1 Thioredoxin reductase 1, mitochondrial Arabidopsis thaliana
Q9PKT7 8.3e-36 139 31 9 311 3 trxB Thioredoxin reductase Chlamydia muridarum (strain MoPn / Nigg)
Q58931 8.37e-36 138 30 9 305 3 MJ1536 Putative thioredoxin reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P57399 1.82e-35 138 31 8 316 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O83790 3.17e-35 137 34 9 307 3 trxB Thioredoxin reductase Treponema pallidum (strain Nichols)
Q9Z8M4 3.69e-35 137 30 9 318 3 trxB Thioredoxin reductase Chlamydia pneumoniae
Q6ZFU6 7.84e-35 136 31 8 313 2 NTRB Thioredoxin reductase NTRB Oryza sativa subsp. japonica
O66790 2.77e-34 135 31 6 314 3 trxB Thioredoxin reductase Aquifex aeolicus (strain VF5)
Q89AJ2 8.98e-33 130 30 9 322 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q69PS6 9.13e-33 132 33 10 330 3 Os06g0327300 Thioredoxin reductase NTRA Oryza sativa subsp. japonica
Q98PK9 3.76e-31 125 29 7 306 3 trxB Thioredoxin reductase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q8T6Z1 1.13e-30 124 30 5 310 2 TRXB Thioredoxin reductase (Fragment) Spironucleus barkhanus
P75531 1.03e-29 122 32 5 318 3 trxB Thioredoxin reductase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5WDV1 4.82e-26 112 29 10 312 3 ABC2925 Ferredoxin--NADP reductase 2 Shouchella clausii (strain KSM-K16)
Q72LG3 6.47e-23 103 30 13 314 3 TT_C0096 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SL28 2.45e-22 101 29 13 314 1 TTHA0465 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q67QU3 8.15e-21 97 29 11 313 3 STH965 Ferredoxin--NADP reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9K7F3 8.95e-21 96 27 10 308 3 BH3408 Ferredoxin--NADP reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q928P3 5.3e-20 94 29 11 310 3 lin2489 Ferredoxin--NADP reductase 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8ENX4 7.27e-19 91 27 12 318 3 OB2351 Ferredoxin--NADP reductase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q71X35 1.03e-18 90 27 12 316 3 LMOf2365_2364 Ferredoxin--NADP reductase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y4P5 1.05e-18 90 29 11 310 3 lmo2390 Ferredoxin--NADP reductase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AL74 1.44e-18 90 27 10 307 3 lwe2338 Ferredoxin--NADP reductase 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6L1Y6 2.02e-18 89 24 9 322 3 PTO0431 Ferredoxin--NADP reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q82ZZ8 2.39e-18 89 28 14 324 3 EF_2899 Ferredoxin--NADP reductase Enterococcus faecalis (strain ATCC 700802 / V583)
Q5KVP7 2.89e-18 89 28 12 325 3 GK2954 Ferredoxin--NADP reductase Geobacillus kaustophilus (strain HTA426)
A4ISE6 4.62e-18 89 28 13 327 3 GTNG_2905 Ferredoxin--NADP reductase Geobacillus thermodenitrificans (strain NG80-2)
A0AK73 2.27e-17 86 26 12 335 3 lwe1987 Ferredoxin--NADP reductase 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q96YN9 4.08e-17 85 26 12 309 3 STK_21330 Ferredoxin--NADP reductase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8Y5U4 7.06e-17 85 26 12 332 3 lmo1961 Ferredoxin--NADP reductase 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71Y53 8.5e-17 85 26 12 330 3 LMOf2365_1991 Ferredoxin--NADP reductase 1 Listeria monocytogenes serotype 4b (strain F2365)
A0LT79 1.4e-16 84 27 12 302 3 Acel_0866 Ferredoxin--NADP reductase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A7Z8C1 1.48e-16 84 27 12 304 3 RBAM_029160 Ferredoxin--NADP reductase 2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q97WJ5 2.47e-16 83 27 12 295 3 SSO2222 Ferredoxin--NADP reductase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O05268 2.56e-16 83 27 12 304 1 yumC Ferredoxin--NADP reductase 2 Bacillus subtilis (strain 168)
A8FH11 6.41e-16 82 26 12 305 3 BPUM_2873 Ferredoxin--NADP reductase 2 Bacillus pumilus (strain SAFR-032)
A8AA47 8.25e-16 81 29 12 315 3 Igni_0617 Ferredoxin--NADP reductase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A8FB45 1.75e-15 81 25 9 305 3 BPUM_0777 Ferredoxin--NADP reductase 1 Bacillus pumilus (strain SAFR-032)
Q89HV6 4.38e-15 80 28 13 320 3 bll5883 Ferredoxin--NADP reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B2G9D0 6.51e-15 79 29 13 307 3 LAR_1546 Ferredoxin--NADP reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM22 6.51e-15 79 29 13 307 3 Lreu_1657 Ferredoxin--NADP reductase Limosilactobacillus reuteri (strain DSM 20016)
Q65FE0 7.75e-15 79 27 12 305 3 BLi03393 Ferredoxin--NADP reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q92A47 1.33e-14 78 26 13 330 3 lin2075 Ferredoxin--NADP reductase 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B2IHR5 1.75e-14 78 26 14 324 3 Bind_2345 Ferredoxin--NADP reductase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q9CF34 1.78e-14 77 24 7 305 3 LL1647 Ferredoxin--NADP reductase Lactococcus lactis subsp. lactis (strain IL1403)
Q0RRX8 2.15e-14 77 27 11 306 3 FRAAL1022 Ferredoxin--NADP reductase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
B3QJ15 2.7e-14 77 27 13 319 3 Rpal_4475 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain TIE-1)
Q6N2U4 2.7e-14 77 27 13 319 1 RPA3954 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2JFM8 3.02e-14 77 26 12 306 3 Francci3_0530 Ferredoxin--NADP reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A3CM39 3.19e-14 77 25 10 305 3 SSA_0813 Ferredoxin--NADP reductase Streptococcus sanguinis (strain SK36)
B3EKW5 3.55e-14 77 26 12 307 3 Cphamn1_1733 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain BS1)
Q2ITC6 3.68e-14 77 26 15 324 3 RPB_3841 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain HaA2)
A8M2W8 4.93e-14 76 28 10 306 3 Sare_0817 Ferredoxin--NADP reductase Salinispora arenicola (strain CNS-205)
A8AXQ6 6.09e-14 76 25 10 305 3 SGO_1284 Ferredoxin--NADP reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A4YER6 6.61e-14 76 25 14 318 3 Msed_0743 Ferredoxin--NADP reductase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q816D9 7.93e-14 76 27 13 308 1 BC_4926 Ferredoxin--NADP reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q03JS2 9.36e-14 75 26 7 300 3 STER_1382 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3J6 9.36e-14 75 26 7 300 3 stu1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY3 9.36e-14 75 26 7 300 3 str1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain CNRZ 1066)
Q13AK7 1.06e-13 75 25 14 320 3 RPD_1645 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB5)
Q04HB6 1.23e-13 75 26 14 332 3 OEOE_0163 Ferredoxin--NADP reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q632D6 1.43e-13 75 27 13 309 3 BCE33L4658 Ferredoxin--NADP reductase Bacillus cereus (strain ZK / E33L)
Q6HBX6 1.43e-13 75 27 13 309 3 BT9727_4639 Ferredoxin--NADP reductase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q72YF6 1.43e-13 75 27 13 309 3 BCE_5065 Ferredoxin--NADP reductase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81XS0 1.43e-13 75 27 13 309 3 BA_5160 Ferredoxin--NADP reductase 2 Bacillus anthracis
A0RKB9 1.43e-13 75 27 13 309 3 BALH_4465 Ferredoxin--NADP reductase 2 Bacillus thuringiensis (strain Al Hakam)
A1BHP4 1.57e-13 75 27 12 308 3 Cpha266_1905 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q4JCM0 1.67e-13 75 25 10 291 3 Saci_0029 Ferredoxin--NADP reductase 1 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A9VMZ3 1.67e-13 75 27 13 313 3 BcerKBAB4_4748 Ferredoxin--NADP reductase 2 Bacillus mycoides (strain KBAB4)
B3QPZ8 1.76e-13 75 26 8 309 3 Cpar_1603 Ferredoxin--NADP reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B4SFQ3 2.75e-13 74 27 12 322 3 Ppha_1024 Ferredoxin--NADP reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B1MX70 2.76e-13 74 25 12 324 3 LCK_00289 Ferredoxin--NADP reductase Leuconostoc citreum (strain KM20)
Q3STP0 3.34e-13 74 26 12 318 3 Nwi_1089 Ferredoxin--NADP reductase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A7GUD5 4.87e-13 73 26 12 314 3 Bcer98_3539 Ferredoxin--NADP reductase 2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8DP13 6.76e-13 73 26 16 321 3 spr1421 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JI5 6.76e-13 73 26 16 321 3 SPD_1393 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P75393 7.26e-13 74 29 13 324 1 pdhD Dihydrolipoyl dehydrogenase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8DUN5 9.3e-13 73 25 8 311 3 SMU_869 Ferredoxin--NADP reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5WAF1 9.9e-13 73 23 8 311 3 ABC0094 Ferredoxin--NADP reductase 1 Shouchella clausii (strain KSM-K16)
Q8KCB2 1.04e-12 73 24 11 326 1 CT1512 Ferredoxin--NADP reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q4J6Z4 1.13e-12 72 29 9 232 3 Saci_2144 Ferredoxin--NADP reductase 2 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
O31475 2e-12 72 26 11 331 1 ycgT Ferredoxin--NADP reductase 1 Bacillus subtilis (strain 168)
B3R4A7 2.14e-12 72 28 14 329 3 RALTA_A1176 Ferredoxin--NADP reductase 1 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q473F6 3.73e-12 71 27 14 329 3 Reut_A1099 Ferredoxin--NADP reductase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4L8N5 4.04e-12 71 27 11 307 3 SH0681 Ferredoxin--NADP reductase Staphylococcus haemolyticus (strain JCSC1435)
Q88UC0 4.09e-12 70 25 12 308 3 lp_2585 Ferredoxin--NADP reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A1SKI3 4.66e-12 70 25 12 303 3 Noca_2816 Ferredoxin--NADP reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q1RHV1 4.82e-12 70 25 13 317 3 RBE_0982 Ferredoxin--NADP reductase Rickettsia bellii (strain RML369-C)
A8GW75 4.87e-12 70 25 13 317 3 A1I_03745 Ferredoxin--NADP reductase Rickettsia bellii (strain OSU 85-389)
A7Z171 5.03e-12 70 27 11 323 3 RBAM_003480 Ferredoxin--NADP reductase 1 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q02XL9 5.17e-12 70 24 8 308 3 LACR_1811 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain SK11)
Q07RK6 5.62e-12 70 24 13 319 3 RPE_1478 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisA53)
Q1QNQ1 5.72e-12 70 24 13 322 3 Nham_1321 Ferredoxin--NADP reductase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B1I067 6.03e-12 70 25 8 302 3 Bsph_0993 Ferredoxin--NADP reductase 2 Lysinibacillus sphaericus (strain C3-41)
Q68WM0 6.38e-12 70 25 12 318 3 RT0500 Ferredoxin--NADP reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B2GEF7 7.34e-12 70 27 13 321 3 LAF_1703 Ferredoxin--NADP reductase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q1LKJ7 8.15e-12 70 26 13 306 3 Rmet_2452 Ferredoxin--NADP reductase 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q92HY3 8.25e-12 70 26 11 315 3 RC0637 Ferredoxin--NADP reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A2RJC6 8.39e-12 70 24 9 308 3 llmg_0776 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain MG1363)
B1ICY3 8.62e-12 69 26 16 321 3 SPH_1677 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain Hungary19A-6)
A8GS72 1.12e-11 69 26 11 315 3 A1G_03605 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Sheila Smith)
Q4FMZ1 1.23e-11 69 24 11 316 3 SAR11_0627 Ferredoxin--NADP reductase Pelagibacter ubique (strain HTCC1062)
Q4ULM2 1.3e-11 69 25 12 316 3 RF_0700 Ferredoxin--NADP reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1YKW2 1.39e-11 69 25 12 314 3 Exig_2313 Ferredoxin--NADP reductase 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A4X398 1.49e-11 69 27 10 300 3 Strop_0871 Ferredoxin--NADP reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B0BXN8 1.5e-11 69 26 11 315 3 RrIowa_0762 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Iowa)
Q219B6 1.64e-11 69 25 13 319 3 RPC_1458 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB18)
Q045M0 1.74e-11 68 23 6 303 3 LGAS_0447 Ferredoxin--NADP reductase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B2IR81 1.94e-11 68 26 16 321 3 SPCG_1548 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain CGSP14)
Q97PP0 1.94e-11 68 26 16 321 3 SP_1563 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9ZD33 2.2e-11 68 25 10 305 3 RP514 Ferredoxin--NADP reductase Rickettsia prowazekii (strain Madrid E)
Q0KCD1 2.21e-11 68 28 14 331 3 H16_A1199 Ferredoxin--NADP reductase 1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B5E6K6 4.54e-11 67 26 16 321 3 SPG_1489 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 19F (strain G54)
Q38YJ1 4.55e-11 67 23 12 319 3 LCA_0435 Ferredoxin--NADP reductase 2 Latilactobacillus sakei subsp. sakei (strain 23K)
B3CMJ8 4.8e-11 67 25 8 304 3 WP1010 Ferredoxin--NADP reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
B3R5L8 6.54e-11 67 25 13 305 3 RALTA_A2094 Ferredoxin--NADP reductase 2 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A0LXL9 6.74e-11 67 25 15 328 3 GFO_0125 Ferredoxin--NADP reductase 1 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A8YTT2 7.69e-11 67 26 12 305 3 lhv_0465 Ferredoxin--NADP reductase Lactobacillus helveticus (strain DPC 4571)
Q0K8J6 1.01e-10 67 26 13 306 3 H16_A2592 Ferredoxin--NADP reductase 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A4VXW3 1.08e-10 66 23 13 317 3 SSU05_1986 Ferredoxin--NADP reductase Streptococcus suis (strain 05ZYH33)
A4W460 1.08e-10 66 23 13 317 3 SSU98_1991 Ferredoxin--NADP reductase Streptococcus suis (strain 98HAH33)
A4SFT9 1.13e-10 66 25 11 306 3 Cvib_1336 Ferredoxin--NADP reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q2GJY7 1.19e-10 66 25 11 325 3 APH_0734 Ferredoxin--NADP reductase Anaplasma phagocytophilum (strain HZ)
Q03ZE9 1.24e-10 66 25 10 319 3 LEUM_0297 Ferredoxin--NADP reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A4YXZ8 1.3e-10 66 25 12 318 3 BRADO5079 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain ORS 278)
Q1IZM1 1.4e-10 66 27 12 301 3 Dgeo_1013 Ferredoxin--NADP reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B4S9F8 1.68e-10 66 25 11 310 3 Paes_1610 Ferredoxin--NADP reductase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B2U9D2 1.95e-10 66 27 15 323 3 Rpic_0981 Ferredoxin--NADP reductase Ralstonia pickettii (strain 12J)
A8EYV4 2e-10 65 26 11 317 3 A1E_02985 Ferredoxin--NADP reductase Rickettsia canadensis (strain McKiel)
B3QXE1 2.56e-10 65 26 13 308 3 Ctha_0950 Ferredoxin--NADP reductase 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q1LPH7 2.72e-10 65 28 17 339 3 Rmet_1063 Ferredoxin--NADP reductase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A8F1N2 3.22e-10 65 25 11 314 3 RMA_0647 Ferredoxin--NADP reductase Rickettsia massiliae (strain Mtu5)
Q74KS6 6.32e-10 64 23 9 307 3 LJ_0501 Ferredoxin--NADP reductase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A7GKN4 7.03e-10 64 25 9 296 3 Bcer98_0331 Ferredoxin--NADP reductase 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2GGH5 7.39e-10 64 23 13 313 3 ECH_0649 Ferredoxin--NADP reductase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A5EMW5 7.51e-10 64 25 11 318 3 BBta_5550 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A5CF57 9.52e-10 63 24 11 321 3 OTBS_1841 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Boryong)
Q8DYW9 1.24e-09 63 25 9 306 3 SAG1353 Ferredoxin--NADP reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E4H8 1.24e-09 63 25 9 306 3 gbs1423 Ferredoxin--NADP reductase Streptococcus agalactiae serotype III (strain NEM316)
Q3K0F9 1.24e-09 63 25 9 306 3 SAK_1384 Ferredoxin--NADP reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q46YY3 1.31e-09 63 24 13 314 3 Reut_A2287 Ferredoxin--NADP reductase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8Y0A5 2.24e-09 62 27 15 324 3 RSc1139 Ferredoxin--NADP reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A9VRK8 2.52e-09 62 24 12 302 3 BcerKBAB4_0332 Ferredoxin--NADP reductase 1 Bacillus mycoides (strain KBAB4)
A0LY71 2.78e-09 62 26 15 321 3 GFO_0330 Ferredoxin--NADP reductase 2 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q2W0C9 2.94e-09 62 25 11 324 3 amb3892 Ferredoxin--NADP reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B2JN27 3.19e-09 62 25 15 330 3 Bphy_3740 Ferredoxin--NADP reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A7HW48 3.19e-09 62 24 11 317 3 Plav_2522 Ferredoxin--NADP reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6HP49 3.58e-09 62 25 14 303 3 BT9727_0321 Ferredoxin--NADP reductase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZB7 3.58e-09 62 25 14 303 3 BA_0352 Ferredoxin--NADP reductase 1 Bacillus anthracis
A0R951 3.58e-09 62 25 14 303 3 BALH_0343 Ferredoxin--NADP reductase 1 Bacillus thuringiensis (strain Al Hakam)
B3QXR3 3.58e-09 62 24 14 312 3 Ctha_2529 Ferredoxin--NADP reductase 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B3WCB2 4.37e-09 61 22 10 317 3 LCABL_08900 Ferredoxin--NADP reductase Lacticaseibacillus casei (strain BL23)
B4U394 6.46e-09 61 23 6 304 3 Sez_1109 Ferredoxin--NADP reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q13Y97 7.48e-09 61 26 16 323 3 Bxeno_A2404 Ferredoxin--NADP reductase Paraburkholderia xenovorans (strain LB400)
Q03AW0 9.66e-09 60 21 9 314 3 LSEI_0826 Ferredoxin--NADP reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q73GH2 9.71e-09 60 23 9 315 3 WD_0982 Ferredoxin--NADP reductase Wolbachia pipientis wMel
Q5FLU4 1.14e-08 60 26 3 194 3 LBA0439 Ferredoxin--NADP reductase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q49ZU9 1.15e-08 60 24 12 313 3 SSP0530 Ferredoxin--NADP reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8ETS1 1.39e-08 60 25 11 295 3 OB0186 Ferredoxin--NADP reductase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B3CTT3 2.2e-08 59 23 11 321 3 OTT_1322 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Ikeda)
A4JS50 2.39e-08 59 26 12 320 3 Bcep1808_6193 Ferredoxin--NADP reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9C3H6 6.13e-08 58 25 10 303 3 Daci_4658 Ferredoxin--NADP reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q98M06 7.03e-08 58 23 11 305 3 mll0792 Ferredoxin--NADP reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5GRV1 7.15e-08 58 22 11 318 3 Wbm0685 Ferredoxin--NADP reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q12B36 9.29e-08 57 23 15 333 3 Bpro_2333 Ferredoxin--NADP reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3B2Q8 9.93e-08 57 26 12 310 3 Plut_1516 Ferredoxin--NADP reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P37062 1.28e-07 57 27 7 226 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
A5FYH8 1.34e-07 57 26 9 304 3 Acry_1452 Ferredoxin--NADP reductase Acidiphilium cryptum (strain JF-5)
P50970 1.6e-07 57 25 13 339 3 lpd Dihydrolipoyl dehydrogenase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
W8X9R5 1.85e-07 57 26 10 300 1 ctmF Probable ferredoxin reductase CtmF Castellaniella defragrans (strain DSM 12143 / CCUG 39792 / 65Phen)
A4SVT8 1.87e-07 56 24 14 306 3 Pnuc_0382 Ferredoxin--NADP reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1HZ05 2.19e-07 56 22 9 305 3 Bsph_0789 Ferredoxin--NADP reductase 1 Lysinibacillus sphaericus (strain C3-41)
B1XWQ5 2.27e-07 56 25 12 304 3 Lcho_2791 Ferredoxin--NADP reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2RNR2 2.33e-07 56 26 11 309 3 Rru_A3439 Ferredoxin--NADP reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q03PJ4 2.34e-07 56 25 11 309 3 LVIS_1813 Ferredoxin--NADP reductase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q3AS18 2.93e-07 56 23 11 306 3 Cag_0944 Ferredoxin--NADP reductase Chlorobium chlorochromatii (strain CaD3)
A4F891 3.06e-07 55 28 12 307 3 SACE_0932 Ferredoxin--NADP reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q0BQJ9 3.55e-07 55 25 9 303 3 GbCGDNIH1_2006 Ferredoxin--NADP reductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
P37337 5.45e-07 55 29 6 204 3 bphG Biphenyl dioxygenase system ferredoxin--NAD(+) reductase component Paraburkholderia xenovorans (strain LB400)
Q1WUT6 5.48e-07 55 27 5 162 3 LSL_0439 Ferredoxin--NADP reductase Ligilactobacillus salivarius (strain UCC118)
Q9PJI3 5.49e-07 55 26 12 322 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia muridarum (strain MoPn / Nigg)
A9NFF6 5.58e-07 55 26 11 312 3 ACL_0467 Ferredoxin--NADP reductase Acholeplasma laidlawii (strain PG-8A)
Q51973 5.71e-07 55 24 10 300 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
Q54465 6.17e-07 55 30 6 162 3 merA Mercuric reductase Shewanella putrefaciens
Q8DP70 6.19e-07 55 31 6 147 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5PAR7 6.32e-07 55 24 13 326 3 AM617 Ferredoxin--NADP reductase Anaplasma marginale (strain St. Maries)
B3EEF0 6.33e-07 55 26 13 325 3 Clim_1719 Ferredoxin--NADP reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
O84925 6.52e-07 55 31 6 147 1 nox NADH oxidase Streptococcus pneumoniae
Q73EA6 6.96e-07 55 23 13 302 3 BCE_0452 Ferredoxin--NADP reductase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
B1HW35 7.81e-07 54 25 5 182 3 Bsph_2322 Ferredoxin--NADP reductase 3 Lysinibacillus sphaericus (strain C3-41)
Q03H60 9.48e-07 54 23 14 321 3 PEPE_0366 Ferredoxin--NADP reductase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B2T4Y1 1.06e-06 54 25 14 319 3 Bphyt_2243 Ferredoxin--NADP reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q65GY3 1.13e-06 54 22 9 308 3 BLi02810 Ferredoxin--NADP reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P42435 1.92e-06 54 30 8 183 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
A1W6V2 1.95e-06 53 26 14 322 3 Ajs_1789 Ferredoxin--NADP reductase Acidovorax sp. (strain JS42)
A1WQW2 2e-06 53 26 13 310 3 Veis_4316 Ferredoxin--NADP reductase Verminephrobacter eiseniae (strain EF01-2)
Q483W3 2.19e-06 53 23 12 316 3 CPS_1923 Ferredoxin--NADP reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A8GNK2 2.69e-06 53 26 12 316 3 A1C_03465 Ferredoxin--NADP reductase Rickettsia akari (strain Hartford)
Q8EWR4 3.43e-06 52 26 7 172 3 MYPE1390 Ferredoxin--NADP reductase Malacoplasma penetrans (strain HF-2)
P31023 3.53e-06 53 30 8 195 1 LPD Dihydrolipoyl dehydrogenase, mitochondrial Pisum sativum
A4STH3 4.51e-06 52 30 11 200 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas salmonicida (strain A449)
Q84PW3 4.72e-06 52 28 6 212 2 MDAR5 Monodehydroascorbate reductase 5, chlorplastic Oryza sativa subsp. japonica
O24679 5.48e-06 52 27 15 328 1 tecA4 Chlorobenzene dioxygenase, ferredoxin reductase component Cupriavidus sp. (strain PS12)
A1VQ12 6.36e-06 52 23 15 344 3 Pnap_2433 Ferredoxin--NADP reductase Polaromonas naphthalenivorans (strain CJ2)
Q41219 7.02e-06 52 30 8 195 1 FLBR Leghemoglobin reductase Glycine max
Q96NN9 1.05e-05 52 25 11 299 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens
B1YEQ1 1.24e-05 51 27 7 185 3 Exig_2773 Ferredoxin--NADP reductase 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A5FJT9 1.38e-05 50 24 14 308 3 Fjoh_1507 Ferredoxin--NADP reductase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A2SFW9 1.53e-05 50 23 13 310 3 Mpe_A1496 Ferredoxin--NADP reductase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q5UWH2 1.57e-05 51 27 15 324 3 lpdA3 Dihydrolipoyl dehydrogenase 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P47513 1.66e-05 51 25 11 314 3 pdhD Dihydrolipoyl dehydrogenase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5FT88 1.97e-05 50 27 12 307 3 GOX0631 Ferredoxin--NADP reductase Gluconobacter oxydans (strain 621H)
Q8D4F7 2.52e-05 50 24 12 314 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain CMCP6)
G2ITT5 3.15e-05 50 29 7 200 1 ligXd 5,5'-dehydrodivanillate O-demethylase ferredoxin reductase subunit Sphingobium sp. (strain NBRC 103272 / SYK-6)
E9RAH5 3.33e-05 49 25 12 320 1 gliT Thioredoxin reductase gliT Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q1JHF5 3.34e-05 49 25 3 193 3 MGAS10270_Spy0716 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M2 (strain MGAS10270)
O84561 3.72e-05 50 27 17 335 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q1J776 4.03e-05 49 25 3 193 3 MGAS10750_Spy0748 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M4 (strain MGAS10750)
A9H9C9 4.08e-05 49 27 10 314 3 GDI0711 Ferredoxin--NADP reductase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A0A0H2UQZ4 4.67e-05 49 30 6 147 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q38YM3 4.69e-05 49 26 7 202 3 LCA_0403 Ferredoxin--NADP reductase 1 Latilactobacillus sakei subsp. sakei (strain 23K)
B5XKX5 5.17e-05 48 25 3 193 3 Spy49_0668 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M49 (strain NZ131)
P0DB07 5.17e-05 48 25 3 193 3 SPs1279 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB06 5.17e-05 48 25 3 193 3 SpyM3_0575 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q48U54 5.45e-05 48 25 3 193 3 M28_Spy0638 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RF47 5.45e-05 48 25 3 193 3 SpyM51151 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JMB2 5.45e-05 48 25 3 193 3 MGAS9429_Spy0712 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCC9 5.45e-05 48 25 3 193 3 MGAS2096_Spy0727 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8P1F2 5.45e-05 48 25 3 193 3 spyM18_0909 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCQ2 5.45e-05 48 25 3 193 3 M6_Spy0676 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9A0B5 5.8e-05 48 25 3 193 3 SPy_0850 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M1
B7N6U1 6.15e-05 48 27 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NSJ1 8.01e-05 48 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P17239 8.99e-05 48 27 7 185 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
Q7NBE9 0.000103 48 20 13 344 3 MYCGA3300 Ferredoxin--NADP reductase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q07946 0.000111 48 28 9 216 1 bedA Benzene 1,2-dioxygenase system ferredoxin--NAD(+) reductase subunit Pseudomonas putida
Q32CL7 0.000112 48 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella dysenteriae serotype 1 (strain Sd197)
Q9Z773 0.000121 48 25 14 317 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia pneumoniae
P16640 0.000121 48 27 15 305 1 camA Putidaredoxin reductase CamA Pseudomonas putida
Q04829 0.000134 48 25 19 364 1 lpdA Dihydrolipoyl dehydrogenase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5XC60 0.000138 48 27 3 143 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7N4V5 0.000144 47 26 7 223 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O50286 0.000157 48 24 11 327 3 lpd Dihydrolipoyl dehydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P59403 0.000159 47 26 9 213 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri
Q0T1D6 0.000159 47 26 9 213 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri serotype 5b (strain 8401)
P11959 0.000165 47 26 16 323 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
P37596 0.00017 47 26 9 209 1 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12)
B1IUW8 0.00017 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCN8 0.00017 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / DH10B)
C4ZYV6 0.00017 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / MC4100 / BW2952)
X5CY81 0.000195 47 26 7 221 1 cndC1 Chloroacetanilide N-alkylformylase, ferredoxin reductase component Rhizorhabdus wittichii (strain DC-6 / KACC 16600)
P43494 0.000218 47 26 10 298 1 thcD Rhodocoxin reductase Rhodococcus erythropolis
Q8NTE1 0.000223 47 22 11 358 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9SPB1 0.000232 47 30 9 195 1 FLBR Leghemoglobin reductase Vigna unguiculata
Q3YYF3 0.000244 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella sonnei (strain Ss046)
A8A3I8 0.000249 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O9:H4 (strain HS)
Q6L0M1 0.000255 47 65 0 32 3 PTO0896 Digeranylgeranylglycerophospholipid reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
B7M9E8 0.00026 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O8 (strain IAI1)
B7LEC2 0.00026 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain 55989 / EAEC)
B5Z372 0.000267 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X850 0.000267 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7
Q7MFY7 0.00027 47 26 8 219 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain YJ016)
B7MYL1 0.000274 47 27 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O81 (strain ED1a)
A7ZQE0 0.000291 47 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I697 0.000324 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SE11)
P85207 0.000359 47 26 16 347 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
A0KEJ2 0.000401 46 28 9 200 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6H064 0.000432 46 24 13 308 3 FP1670 Ferredoxin--NADP reductase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q0TEG9 0.00048 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R7Y9 0.000497 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain UTI89 / UPEC)
A1AEQ1 0.000497 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O1:K1 / APEC
B7MKI0 0.000497 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FEN4 0.000533 46 26 9 209 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A0E4 0.000621 46 23 12 344 3 merA Mercuric reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0A0E5 0.000621 46 23 12 344 3 merA Mercuric reductase Staphylococcus aureus
Q8NV36 0.00078 45 24 13 327 3 MW2294 Ferredoxin--NADP reductase Staphylococcus aureus (strain MW2)
Q6G6U7 0.00078 45 24 13 327 3 SAS2264 Ferredoxin--NADP reductase Staphylococcus aureus (strain MSSA476)
Q049B3 0.00084 45 21 8 294 3 LBUL_1466 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G967 0.00084 45 21 8 294 3 Ldb1586 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q02733 0.000848 45 22 14 334 1 IRC15 Increased recombination centers protein 15 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A8Z563 0.000898 45 24 13 327 3 USA300HOU_2355 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300 / TCH1516)
Q99RQ5 0.000898 45 24 13 327 3 SAV2372 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJL4 0.000898 45 24 13 327 3 NWMN_2274 Ferredoxin--NADP reductase Staphylococcus aureus (strain Newman)
Q5HDI3 0.000898 45 24 13 327 3 SACOL2369 Ferredoxin--NADP reductase Staphylococcus aureus (strain COL)
A5IVF3 0.000898 45 24 13 327 3 SaurJH9_2396 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH9)
Q2FVP8 0.000898 45 24 13 327 1 SAOUHSC_02654 Ferredoxin--NADP reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEC4 0.000898 45 24 13 327 1 SAUSA300_2319 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300)
A6U499 0.000898 45 24 13 327 3 SaurJH1_2442 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH1)
A7X5Z9 0.000898 45 24 13 327 3 SAHV_2356 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q43621 0.001 45 26 19 356 2 None Glutathione reductase, cytosolic Pisum sativum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05855
Feature type CDS
Gene ahpF
Product alkyl hydroperoxide reductase subunit F
Location 1282192 - 1283757 (strand: 1)
Length 1566 (nucleotides) / 521 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1469
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF07992 Pyridine nucleotide-disulphide oxidoreductase
PF13192 Thioredoxin domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3634 Defense mechanisms (V) V Alkyl hydroperoxide reductase subunit AhpF

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03387 NADH-dependent peroxiredoxin subunit F [EC:1.8.1.-] - -

Protein Sequence

MLDNNLKAQLKAYLERLTQPVELVATLDDSKHSADIQALLKEIEPLSDKVTYREDNSANVRKPSFLITNPGKTTGVRFAGSPLGHEFTSLVLALLQTGGHPSKEAPELLEQIRQLDGEFHFETYYSLSCHNCPDVVQALNLMAILNPNITHTAIDGGMFQNEIQERNIMGVPAVFLNGNEFGQGRMTLAEIVSKVDSNAEKRTAELLNKKDAFDVLIVGSGPAGASAAVYAARKGLNTGLIGERFGGQVLDTVDIENYISVPKTEGAKLAGALKAHVDDYQVDVIDSQTVSRLIPGAAEGDLHQIETASGAILKTRSLIIATGARWRNMNVPGENEYRTRGVTYCPHCDGPLFKGKRVAVIGGGNSGVEAAIDLAGLVEHVTVLEFASEMRADAVLQNKLRSLSNVDVILNAQTTEVYGDGTKLTGLKYKDRTNDSMHDIALAGIFVQIGLLPNTQWLDGTVERNKIGEIVVDSRGETNIKGVFAAGDCTTVPYKQIIIAAGEGAKASLSAFDYLIRTTAK

Flanking regions ( +/- flanking 50bp)

GTAGTTATTTATCGGGTGTTTCGGCACCCGATTTTATTGAGGGTGCAAAAATGTTAGATAATAATTTAAAAGCTCAACTGAAAGCTTACCTAGAACGATTAACCCAGCCAGTTGAGTTAGTTGCAACATTAGACGACAGCAAACATTCTGCTGATATCCAAGCCTTATTAAAAGAAATTGAACCGTTATCTGATAAAGTCACATACCGTGAAGATAACAGTGCTAATGTGCGCAAACCATCTTTTCTTATTACCAACCCAGGGAAAACAACTGGCGTTCGTTTTGCAGGCTCGCCATTAGGTCATGAGTTTACTTCTTTAGTATTAGCATTATTACAAACCGGTGGTCATCCATCTAAAGAAGCCCCAGAATTACTTGAACAAATTCGTCAGTTAGACGGTGAGTTTCATTTCGAAACCTATTATTCGCTCTCTTGTCATAACTGCCCTGATGTTGTTCAGGCATTAAACTTAATGGCGATTTTAAATCCGAACATCACCCATACGGCGATCGACGGAGGCATGTTCCAAAATGAAATTCAGGAACGTAATATCATGGGCGTTCCTGCGGTATTCTTAAATGGCAACGAGTTTGGCCAAGGTCGTATGACTTTAGCTGAAATTGTTAGCAAAGTAGATAGCAATGCAGAAAAACGCACTGCAGAGTTATTAAATAAAAAAGATGCCTTTGATGTTTTGATTGTCGGAAGCGGCCCTGCGGGGGCATCAGCGGCAGTATATGCTGCACGTAAAGGCTTAAATACAGGTCTTATCGGTGAACGTTTTGGTGGACAAGTTCTCGATACTGTTGATATTGAAAACTATATCTCTGTACCTAAAACAGAAGGTGCAAAATTAGCTGGGGCTTTAAAAGCTCATGTTGATGATTATCAAGTTGATGTCATTGACAGCCAAACTGTCAGCCGTTTAATTCCGGGAGCAGCGGAAGGTGATCTACACCAAATTGAAACCGCATCTGGTGCGATTTTAAAAACCCGTAGCTTAATTATTGCCACGGGTGCTCGCTGGAGAAATATGAACGTACCGGGTGAAAACGAGTACCGTACTCGCGGTGTAACATACTGCCCACATTGTGATGGTCCTCTATTTAAAGGTAAAAGAGTGGCTGTTATTGGTGGTGGTAACTCGGGTGTTGAAGCTGCCATTGACTTAGCGGGTTTAGTGGAGCACGTGACCGTACTAGAATTTGCCTCAGAAATGAGAGCCGATGCTGTTTTACAAAATAAACTGCGTAGCTTAAGTAATGTCGATGTTATCTTAAATGCCCAAACAACAGAAGTATATGGAGATGGCACTAAGTTAACAGGACTGAAATATAAAGATCGCACTAACGATTCAATGCATGATATTGCCTTAGCGGGTATTTTCGTCCAAATTGGTTTACTGCCAAACACACAATGGTTAGACGGAACTGTTGAGCGTAATAAAATTGGTGAGATCGTGGTTGATTCACGTGGTGAAACCAATATTAAAGGGGTATTTGCTGCGGGTGACTGTACAACTGTTCCTTATAAACAAATTATTATCGCCGCGGGTGAAGGTGCAAAAGCCTCATTAAGCGCCTTTGATTACTTAATTCGCACAACGGCAAAATAAGCAAATCAAAGATAATCAATAAGTTATAGAGAAAGGCATCTTTTTTAAGA