Homologs in group_1520

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09425 FBDBKF_09425 90.8 Morganella morganii S1 ahpF alkyl hydroperoxide reductase subunit F
EHELCC_09985 EHELCC_09985 90.8 Morganella morganii S2 ahpF alkyl hydroperoxide reductase subunit F
NLDBIP_10330 NLDBIP_10330 90.8 Morganella morganii S4 ahpF alkyl hydroperoxide reductase subunit F
LHKJJB_11025 LHKJJB_11025 90.8 Morganella morganii S3 ahpF alkyl hydroperoxide reductase subunit F
HKOGLL_14085 HKOGLL_14085 90.8 Morganella morganii S5 ahpF alkyl hydroperoxide reductase subunit F
PMI_RS05855 PMI_RS05855 77.5 Proteus mirabilis HI4320 ahpF alkyl hydroperoxide reductase subunit F

Distribution of the homologs in the orthogroup group_1520

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1520

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19480 0.0 842 78 0 518 1 ahpF Alkyl hydroperoxide reductase subunit F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P35340 0.0 832 76 0 520 1 ahpF Alkyl hydroperoxide reductase subunit F Escherichia coli (strain K12)
P0A156 0.0 692 65 2 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida
P0A155 0.0 692 65 2 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I6Z2 0.0 692 65 1 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O06465 0.0 672 65 3 522 3 ahpF Alkyl hydroperoxide reductase subunit F Xanthomonas campestris pv. phaseoli
P26829 0.0 610 56 4 520 1 ahpF NADH dehydrogenase Ferdinandcohnia aciditolerans (strain JCM 32973 / CCTCC AB 2017280 / YN-1)
P42974 0.0 595 57 5 518 1 ahpF NADH dehydrogenase Bacillus subtilis (strain 168)
Q6GC92 0.0 562 55 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MSSA476)
P66013 0.0 561 55 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MW2)
Q6GJR8 0.0 561 55 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MRSA252)
P99118 0.0 561 55 5 518 1 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain N315)
P66012 0.0 561 55 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIR6 0.0 556 54 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain COL)
O05204 0.0 556 54 5 518 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CMQ1 0.0 528 54 6 498 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRY2 0.0 528 53 6 498 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P80880 2.42e-53 186 33 3 306 1 trxB Thioredoxin reductase Bacillus subtilis (strain 168)
O32823 5.47e-51 180 33 3 306 3 trxB Thioredoxin reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P52215 2.47e-50 178 33 6 303 2 trxB Thioredoxin reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q928B5 2.7e-50 178 33 3 306 3 trxB Thioredoxin reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q68WT3 3.19e-49 175 35 6 310 3 trxB Thioredoxin reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P39916 5.45e-49 174 35 5 319 3 trxB Thioredoxin reductase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q9ZD97 8.84e-49 174 34 6 310 3 trxB Thioredoxin reductase Rickettsia prowazekii (strain Madrid E)
Q9PR71 1.09e-48 173 35 7 318 3 trxB Thioredoxin reductase Ureaplasma parvum serovar 3 (strain ATCC 700970)
O30973 3.51e-48 172 33 6 311 3 trxB Thioredoxin reductase Mycolicibacterium smegmatis
Q1RJD8 1.67e-47 170 35 6 310 3 trxB Thioredoxin reductase Rickettsia bellii (strain RML369-C)
P9WHH1 5.36e-47 169 34 6 302 1 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH0 5.36e-47 169 34 6 302 3 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4ULP1 8.02e-47 168 34 6 304 3 trxB Thioredoxin reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92I02 1.49e-46 167 34 6 306 3 trxB Thioredoxin reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q93HX6 3.08e-46 167 35 6 310 1 None Glucosaminate ammonia-lyase Pseudomonas fluorescens
Q8CPY8 3.87e-46 166 33 3 308 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW4 3.87e-46 166 33 3 308 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P46843 1.12e-45 169 34 7 308 3 trxB/A Bifunctional thioredoxin reductase/thioredoxin Mycobacterium leprae (strain TN)
P43788 1.5e-45 165 35 9 314 1 trxB Thioredoxin reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q05741 4.08e-45 164 31 6 307 1 trxB Thioredoxin reductase Streptomyces clavuligerus
Q70G58 1.33e-44 167 32 7 319 1 Os07g0657900 Thioredoxin reductase NTRC Oryza sativa subsp. japonica
P66011 3.83e-44 161 33 3 305 1 trxB Thioredoxin reductase Staphylococcus aureus (strain MW2)
Q6GB66 3.83e-44 161 33 3 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MSSA476)
P99101 3.83e-44 161 33 3 305 1 trxB Thioredoxin reductase Staphylococcus aureus (strain N315)
P66010 3.83e-44 161 33 3 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHQ4 3.83e-44 161 33 3 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain COL)
O22229 5.28e-44 166 33 8 312 1 NTRC NADPH-dependent thioredoxin reductase 3 Arabidopsis thaliana
P23160 5.59e-44 160 30 4 310 3 None 34.2 kDa protein in rubredoxin operon Clostridium pasteurianum
P50971 6.41e-44 160 34 6 307 1 trxB Thioredoxin reductase Peptoclostridium acidaminophilum
Q6GIM7 1.61e-43 159 33 3 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MRSA252)
Q9KSS4 5.09e-43 158 33 8 311 3 trxB Thioredoxin reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6C7L4 2.76e-42 156 32 6 314 3 TRR1 Thioredoxin reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
P94284 2.86e-42 157 33 5 298 3 trxB Thioredoxin reductase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P52213 9.48e-42 155 34 7 312 3 trxB Thioredoxin reductase Peptoclostridium litorale
P0A9P4 9.51e-42 155 35 10 315 1 trxB Thioredoxin reductase Escherichia coli (strain K12)
P0A9P5 9.51e-42 155 35 10 315 3 trxB Thioredoxin reductase Escherichia coli O157:H7
Q9ZL18 3.5e-40 150 30 4 310 3 trxB Thioredoxin reductase Helicobacter pylori (strain J99 / ATCC 700824)
Q6BIS1 5.41e-40 150 30 5 313 3 TRR1 Thioredoxin reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q7Z7S3 6.58e-40 150 32 5 303 2 TRR1 Thioredoxin reductase Pneumocystis carinii
Q8J0U0 7.49e-40 150 33 6 303 2 TRR1 Thioredoxin reductase Pneumocystis jirovecii
P38816 1.03e-39 150 29 5 338 1 TRR2 Thioredoxin reductase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54UU8 1.12e-39 149 33 9 315 3 trrA Thioredoxin reductase Dictyostelium discoideum
Q6FR39 4.21e-39 148 31 5 311 3 TRR1 Thioredoxin reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q75CM8 7.37e-39 147 29 5 313 3 TRR1 Thioredoxin reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P56431 7.78e-39 147 30 4 310 1 trxB Thioredoxin reductase Helicobacter pylori (strain ATCC 700392 / 26695)
Q39242 8.84e-39 149 33 9 318 2 NTR2 Thioredoxin reductase 2 Arabidopsis thaliana
P51978 1.35e-38 147 33 6 321 3 cys-9 Thioredoxin reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9PKT7 4.1e-38 145 32 10 307 3 trxB Thioredoxin reductase Chlamydia muridarum (strain MoPn / Nigg)
Q92375 6.82e-38 144 31 6 311 1 trr1 Thioredoxin reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P29509 9.74e-38 144 31 5 311 1 TRR1 Thioredoxin reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6HA24 1.05e-37 145 30 5 313 3 TRR1 Thioredoxin reductase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O83790 3.04e-37 142 34 9 298 3 trxB Thioredoxin reductase Treponema pallidum (strain Nichols)
O84101 5.13e-37 142 31 10 309 3 trxB Thioredoxin reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q39243 2.45e-36 142 34 10 318 1 NTR1 Thioredoxin reductase 1, mitochondrial Arabidopsis thaliana
O66790 4.16e-36 140 31 5 301 3 trxB Thioredoxin reductase Aquifex aeolicus (strain VF5)
P43496 7.4e-36 139 31 7 322 1 TRR1 Thioredoxin reductase Penicillium chrysogenum
Q9Z8M4 8.52e-36 139 31 9 313 3 trxB Thioredoxin reductase Chlamydia pneumoniae
P47348 5.08e-35 136 30 5 318 3 trxB Thioredoxin reductase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q89AJ2 1.63e-34 135 31 7 311 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P81433 4.81e-34 134 30 8 316 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57399 4.96e-34 134 32 8 312 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q6ZFU6 3.81e-33 132 32 8 314 2 NTRB Thioredoxin reductase NTRB Oryza sativa subsp. japonica
Q8T6Z1 4.51e-33 131 30 6 302 2 TRXB Thioredoxin reductase (Fragment) Spironucleus barkhanus
Q98PK9 4.51e-32 128 29 6 304 3 trxB Thioredoxin reductase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q69PS6 1.73e-31 128 32 9 315 3 Os06g0327300 Thioredoxin reductase NTRA Oryza sativa subsp. japonica
Q58931 2.3e-30 123 28 9 306 3 MJ1536 Putative thioredoxin reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P75531 2.33e-30 124 32 5 318 3 trxB Thioredoxin reductase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9K7F3 1.27e-21 99 29 10 302 3 BH3408 Ferredoxin--NADP reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q72LG3 1.32e-21 99 28 12 308 3 TT_C0096 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6L1Y6 5.43e-21 97 26 9 293 3 PTO0431 Ferredoxin--NADP reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q5SL28 5.59e-21 97 28 12 308 1 TTHA0465 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q67QU3 2.52e-20 95 28 10 307 3 STH965 Ferredoxin--NADP reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q96YN9 6.84e-20 94 28 12 314 3 STK_21330 Ferredoxin--NADP reductase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A4YER6 1.22e-18 90 27 13 322 3 Msed_0743 Ferredoxin--NADP reductase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q97WJ5 2.48e-17 86 27 10 301 3 SSO2222 Ferredoxin--NADP reductase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q71X35 1.18e-16 84 27 12 322 3 LMOf2365_2364 Ferredoxin--NADP reductase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q71Y53 1.26e-16 84 27 11 319 3 LMOf2365_1991 Ferredoxin--NADP reductase 1 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y5U4 1.51e-16 84 27 11 319 3 lmo1961 Ferredoxin--NADP reductase 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AK73 1.86e-16 84 28 11 319 3 lwe1987 Ferredoxin--NADP reductase 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92A47 2.26e-16 84 28 15 327 3 lin2075 Ferredoxin--NADP reductase 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AL74 2.47e-16 83 26 10 302 3 lwe2338 Ferredoxin--NADP reductase 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5WDV1 2.97e-16 83 27 13 315 3 ABC2925 Ferredoxin--NADP reductase 2 Shouchella clausii (strain KSM-K16)
Q928P3 6.01e-16 82 25 10 321 3 lin2489 Ferredoxin--NADP reductase 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q82ZZ8 1.82e-15 81 25 9 324 3 EF_2899 Ferredoxin--NADP reductase Enterococcus faecalis (strain ATCC 700802 / V583)
Q4JCM0 1.86e-15 80 27 12 294 3 Saci_0029 Ferredoxin--NADP reductase 1 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8Y4P5 1.91e-15 80 25 9 303 3 lmo2390 Ferredoxin--NADP reductase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A4ISE6 3.89e-15 80 26 10 320 3 GTNG_2905 Ferredoxin--NADP reductase Geobacillus thermodenitrificans (strain NG80-2)
A8AA47 5.02e-15 79 27 11 309 3 Igni_0617 Ferredoxin--NADP reductase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A0LT79 1.47e-14 78 27 13 302 3 Acel_0866 Ferredoxin--NADP reductase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q5KVP7 2.84e-14 77 25 9 319 3 GK2954 Ferredoxin--NADP reductase Geobacillus kaustophilus (strain HTA426)
Q4J6Z4 3.41e-14 77 29 15 296 3 Saci_2144 Ferredoxin--NADP reductase 2 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q03JS2 5.98e-14 76 24 7 306 3 STER_1382 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3J6 5.98e-14 76 24 7 306 3 stu1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY3 5.98e-14 76 24 7 306 3 str1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain CNRZ 1066)
B1YKW2 1.59e-13 75 25 10 302 3 Exig_2313 Ferredoxin--NADP reductase 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9CF34 2.31e-13 74 23 8 319 3 LL1647 Ferredoxin--NADP reductase Lactococcus lactis subsp. lactis (strain IL1403)
A3CM39 3.56e-13 73 24 13 324 3 SSA_0813 Ferredoxin--NADP reductase Streptococcus sanguinis (strain SK36)
A8AXQ6 4.44e-13 73 25 11 316 3 SGO_1284 Ferredoxin--NADP reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
O05268 5.8e-13 73 25 10 301 1 yumC Ferredoxin--NADP reductase 2 Bacillus subtilis (strain 168)
A9VRK8 6.4e-13 73 25 13 299 3 BcerKBAB4_0332 Ferredoxin--NADP reductase 1 Bacillus mycoides (strain KBAB4)
A4X398 7.15e-13 73 27 12 301 3 Strop_0871 Ferredoxin--NADP reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B1I067 7.68e-13 73 25 8 298 3 Bsph_0993 Ferredoxin--NADP reductase 2 Lysinibacillus sphaericus (strain C3-41)
A7Z8C1 8.75e-13 73 25 10 301 3 RBAM_029160 Ferredoxin--NADP reductase 2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8M2W8 8.83e-13 72 28 12 301 3 Sare_0817 Ferredoxin--NADP reductase Salinispora arenicola (strain CNS-205)
Q0RRX8 1.25e-12 72 25 11 305 3 FRAAL1022 Ferredoxin--NADP reductase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q2JFM8 1.89e-12 72 25 12 307 3 Francci3_0530 Ferredoxin--NADP reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A7Z171 2.89e-12 71 27 13 320 3 RBAM_003480 Ferredoxin--NADP reductase 1 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q98M06 4.31e-12 70 25 12 307 3 mll0792 Ferredoxin--NADP reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q02XL9 4.35e-12 70 24 10 323 3 LACR_1811 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain SK11)
Q8DP13 4.63e-12 70 25 13 304 3 spr1421 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JI5 4.63e-12 70 25 13 304 3 SPD_1393 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B3QPZ8 4.87e-12 70 25 11 314 3 Cpar_1603 Ferredoxin--NADP reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A7GKN4 5.36e-12 70 25 11 296 3 Bcer98_0331 Ferredoxin--NADP reductase 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B3EKW5 5.62e-12 70 25 13 308 3 Cphamn1_1733 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain BS1)
Q4L8N5 6.85e-12 70 25 10 303 3 SH0681 Ferredoxin--NADP reductase Staphylococcus haemolyticus (strain JCSC1435)
B2GEF7 8.12e-12 70 27 11 310 3 LAF_1703 Ferredoxin--NADP reductase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q6HP49 8.13e-12 70 24 13 299 3 BT9727_0321 Ferredoxin--NADP reductase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZB7 8.13e-12 70 24 13 299 3 BA_0352 Ferredoxin--NADP reductase 1 Bacillus anthracis
A0R951 8.13e-12 70 24 13 299 3 BALH_0343 Ferredoxin--NADP reductase 1 Bacillus thuringiensis (strain Al Hakam)
A2RJC6 8.32e-12 70 23 8 319 3 llmg_0776 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain MG1363)
Q3STP0 8.93e-12 70 26 12 308 3 Nwi_1089 Ferredoxin--NADP reductase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A8FB45 1.04e-11 70 23 10 306 3 BPUM_0777 Ferredoxin--NADP reductase 1 Bacillus pumilus (strain SAFR-032)
B2G9D0 1.09e-11 69 28 14 327 3 LAR_1546 Ferredoxin--NADP reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM22 1.09e-11 69 28 14 327 3 Lreu_1657 Ferredoxin--NADP reductase Limosilactobacillus reuteri (strain DSM 20016)
A8FH11 1.7e-11 68 24 13 305 3 BPUM_2873 Ferredoxin--NADP reductase 2 Bacillus pumilus (strain SAFR-032)
Q88UC0 1.7e-11 68 24 9 307 3 lp_2585 Ferredoxin--NADP reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5WAF1 2.42e-11 68 22 8 311 3 ABC0094 Ferredoxin--NADP reductase 1 Shouchella clausii (strain KSM-K16)
Q8ENX4 2.73e-11 68 25 10 307 3 OB2351 Ferredoxin--NADP reductase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q38YJ1 3.83e-11 68 25 11 307 3 LCA_0435 Ferredoxin--NADP reductase 2 Latilactobacillus sakei subsp. sakei (strain 23K)
Q2ITC6 3.85e-11 68 25 15 322 3 RPB_3841 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain HaA2)
Q04HB6 3.99e-11 68 25 12 314 3 OEOE_0163 Ferredoxin--NADP reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A9C3H6 4.61e-11 67 27 10 303 3 Daci_4658 Ferredoxin--NADP reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
A4VXW3 5.39e-11 67 24 12 304 3 SSU05_1986 Ferredoxin--NADP reductase Streptococcus suis (strain 05ZYH33)
A4W460 5.39e-11 67 24 12 304 3 SSU98_1991 Ferredoxin--NADP reductase Streptococcus suis (strain 98HAH33)
B1ICY3 6.65e-11 67 25 13 304 3 SPH_1677 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain Hungary19A-6)
Q13AK7 7.25e-11 67 24 15 321 3 RPD_1645 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB5)
A1SKI3 8.97e-11 67 24 14 312 3 Noca_2816 Ferredoxin--NADP reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A1BHP4 1.05e-10 67 24 10 310 3 Cpha266_1905 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B2IR81 1.1e-10 66 25 13 304 3 SPCG_1548 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain CGSP14)
Q97PP0 1.1e-10 66 25 13 304 3 SP_1563 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q03ZE9 1.26e-10 66 25 13 324 3 LEUM_0297 Ferredoxin--NADP reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8DUN5 1.27e-10 66 25 8 307 3 SMU_869 Ferredoxin--NADP reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B1MX70 1.48e-10 66 23 12 325 3 LCK_00289 Ferredoxin--NADP reductase Leuconostoc citreum (strain KM20)
B4U394 1.74e-10 65 25 10 312 3 Sez_1109 Ferredoxin--NADP reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B5E6K6 1.74e-10 65 23 10 301 3 SPG_1489 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 19F (strain G54)
Q1QNQ1 1.94e-10 65 25 14 312 3 Nham_1321 Ferredoxin--NADP reductase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1RHV1 2.27e-10 65 23 13 316 3 RBE_0982 Ferredoxin--NADP reductase Rickettsia bellii (strain RML369-C)
Q8KCB2 2.79e-10 65 23 9 304 1 CT1512 Ferredoxin--NADP reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QXR3 2.87e-10 65 24 13 308 3 Ctha_2529 Ferredoxin--NADP reductase 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A7GUD5 4.27e-10 64 26 14 314 3 Bcer98_3539 Ferredoxin--NADP reductase 2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O31475 4.32e-10 64 26 14 327 1 ycgT Ferredoxin--NADP reductase 1 Bacillus subtilis (strain 168)
Q473F6 4.46e-10 65 27 14 325 3 Reut_A1099 Ferredoxin--NADP reductase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A8GW75 6.32e-10 64 23 13 316 3 A1I_03745 Ferredoxin--NADP reductase Rickettsia bellii (strain OSU 85-389)
Q632D6 7.39e-10 63 25 11 306 3 BCE33L4658 Ferredoxin--NADP reductase Bacillus cereus (strain ZK / E33L)
Q6HBX6 7.39e-10 63 25 11 306 3 BT9727_4639 Ferredoxin--NADP reductase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q72YF6 7.39e-10 63 25 11 306 3 BCE_5065 Ferredoxin--NADP reductase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81XS0 7.39e-10 63 25 11 306 3 BA_5160 Ferredoxin--NADP reductase 2 Bacillus anthracis
A0RKB9 7.39e-10 63 25 11 306 3 BALH_4465 Ferredoxin--NADP reductase 2 Bacillus thuringiensis (strain Al Hakam)
Q92HY3 7.83e-10 63 24 13 317 3 RC0637 Ferredoxin--NADP reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A4SFT9 7.88e-10 64 23 12 311 3 Cvib_1336 Ferredoxin--NADP reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B3CMJ8 7.89e-10 63 24 14 321 3 WP1010 Ferredoxin--NADP reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A7HW48 8.27e-10 63 25 11 318 3 Plav_2522 Ferredoxin--NADP reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q1LKJ7 8.34e-10 64 23 10 339 3 Rmet_2452 Ferredoxin--NADP reductase 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1IZM1 8.69e-10 63 26 12 298 3 Dgeo_1013 Ferredoxin--NADP reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A8GS72 9.55e-10 63 24 13 317 3 A1G_03605 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Sheila Smith)
Q045M0 1.01e-09 63 24 9 303 3 LGAS_0447 Ferredoxin--NADP reductase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q03AW0 1.06e-09 63 23 11 308 3 LSEI_0826 Ferredoxin--NADP reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B0BXN8 1.2e-09 63 24 14 317 3 RrIowa_0762 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Iowa)
Q73EA6 1.47e-09 63 23 13 299 3 BCE_0452 Ferredoxin--NADP reductase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q0K8J6 1.62e-09 63 24 10 321 3 H16_A2592 Ferredoxin--NADP reductase 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q65FE0 1.69e-09 63 24 11 306 3 BLi03393 Ferredoxin--NADP reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65GY3 1.74e-09 63 24 12 309 3 BLi02810 Ferredoxin--NADP reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A0LXL9 1.82e-09 63 25 15 330 3 GFO_0125 Ferredoxin--NADP reductase 1 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q816D9 1.84e-09 62 25 11 309 1 BC_4926 Ferredoxin--NADP reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1HZ05 2.26e-09 62 23 10 307 3 Bsph_0789 Ferredoxin--NADP reductase 1 Lysinibacillus sphaericus (strain C3-41)
Q4ULM2 2.36e-09 62 23 13 317 3 RF_0700 Ferredoxin--NADP reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q49ZU9 2.48e-09 62 25 11 306 3 SSP0530 Ferredoxin--NADP reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B4SFQ3 2.72e-09 62 25 13 307 3 Ppha_1024 Ferredoxin--NADP reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q89HV6 2.93e-09 62 25 12 326 3 bll5883 Ferredoxin--NADP reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B3WCB2 3.78e-09 62 23 12 311 3 LCABL_08900 Ferredoxin--NADP reductase Lacticaseibacillus casei (strain BL23)
Q46YY3 3.9e-09 62 23 10 334 3 Reut_A2287 Ferredoxin--NADP reductase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9VMZ3 3.98e-09 62 26 14 310 3 BcerKBAB4_4748 Ferredoxin--NADP reductase 2 Bacillus mycoides (strain KBAB4)
B3R5L8 4.28e-09 62 23 10 316 3 RALTA_A2094 Ferredoxin--NADP reductase 2 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B3QJ15 5.69e-09 61 22 12 327 3 Rpal_4475 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain TIE-1)
Q6N2U4 5.69e-09 61 22 12 327 1 RPA3954 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3QXE1 6.45e-09 61 26 12 306 3 Ctha_0950 Ferredoxin--NADP reductase 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
P75393 6.75e-09 61 28 13 316 1 pdhD Dihydrolipoyl dehydrogenase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A4JS50 6.89e-09 61 26 14 329 3 Bcep1808_6193 Ferredoxin--NADP reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8ETS1 6.97e-09 61 24 10 288 3 OB0186 Ferredoxin--NADP reductase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9ZD33 8.52e-09 60 23 12 307 3 RP514 Ferredoxin--NADP reductase Rickettsia prowazekii (strain Madrid E)
Q3B2Q8 1.19e-08 60 26 12 309 3 Plut_1516 Ferredoxin--NADP reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q68WM0 1.41e-08 60 23 13 319 3 RT0500 Ferredoxin--NADP reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8F1N2 1.54e-08 60 23 13 317 3 RMA_0647 Ferredoxin--NADP reductase Rickettsia massiliae (strain Mtu5)
Q0KCD1 2e-08 60 26 15 330 3 H16_A1199 Ferredoxin--NADP reductase 1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2GJY7 2.01e-08 59 24 13 322 3 APH_0734 Ferredoxin--NADP reductase Anaplasma phagocytophilum (strain HZ)
P37062 2.32e-08 60 25 5 231 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
B1HW35 2.86e-08 59 26 8 222 3 Bsph_2322 Ferredoxin--NADP reductase 3 Lysinibacillus sphaericus (strain C3-41)
Q4FMZ1 3.38e-08 58 23 11 316 3 SAR11_0627 Ferredoxin--NADP reductase Pelagibacter ubique (strain HTCC1062)
B3R4A7 4.25e-08 58 26 14 330 3 RALTA_A1176 Ferredoxin--NADP reductase 1 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4YXZ8 5.12e-08 58 24 12 311 3 BRADO5079 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain ORS 278)
Q51973 5.18e-08 58 24 9 293 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
D4APQ6 5.64e-08 58 27 3 162 1 ARB_06224 Probable thioredoxin reductase ARB_06224 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q07RK6 5.65e-08 58 22 14 321 3 RPE_1478 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisA53)
Q2W0C9 7.08e-08 58 25 12 321 3 amb3892 Ferredoxin--NADP reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A8EYV4 8.24e-08 57 24 13 324 3 A1E_02985 Ferredoxin--NADP reductase Rickettsia canadensis (strain McKiel)
B2IHR5 9.66e-08 57 24 13 322 3 Bind_2345 Ferredoxin--NADP reductase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
E9RAH5 1.15e-07 57 23 7 315 1 gliT Thioredoxin reductase gliT Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A8YTT2 1.18e-07 57 26 13 302 3 lhv_0465 Ferredoxin--NADP reductase Lactobacillus helveticus (strain DPC 4571)
Q5FLU4 1.31e-07 57 25 7 254 3 LBA0439 Ferredoxin--NADP reductase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A4SVT8 1.5e-07 57 23 13 317 3 Pnuc_0382 Ferredoxin--NADP reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1XWQ5 1.62e-07 57 25 13 304 3 Lcho_2791 Ferredoxin--NADP reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q73GH2 1.71e-07 57 23 12 321 3 WD_0982 Ferredoxin--NADP reductase Wolbachia pipientis wMel
P37337 1.74e-07 57 27 5 204 3 bphG Biphenyl dioxygenase system ferredoxin--NAD(+) reductase component Paraburkholderia xenovorans (strain LB400)
Q219B6 1.8e-07 57 21 11 325 3 RPC_1458 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB18)
Q03PJ4 1.94e-07 56 27 13 317 3 LVIS_1813 Ferredoxin--NADP reductase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B1YEQ1 2.36e-07 56 24 12 297 3 Exig_2773 Ferredoxin--NADP reductase 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B2T4Y1 2.59e-07 56 25 17 320 3 Bphyt_2243 Ferredoxin--NADP reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JN27 2.66e-07 56 25 15 320 3 Bphy_3740 Ferredoxin--NADP reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1LPH7 3.93e-07 55 27 15 329 3 Rmet_1063 Ferredoxin--NADP reductase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1WQW2 4.04e-07 55 26 9 306 3 Veis_4316 Ferredoxin--NADP reductase Verminephrobacter eiseniae (strain EF01-2)
Q3AS18 4.49e-07 55 24 11 313 3 Cag_0944 Ferredoxin--NADP reductase Chlorobium chlorochromatii (strain CaD3)
Q7NBE9 5.35e-07 55 22 11 309 3 MYCGA3300 Ferredoxin--NADP reductase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A5EMW5 6.07e-07 55 23 12 319 3 BBta_5550 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q8DYW9 7.19e-07 55 24 13 314 3 SAG1353 Ferredoxin--NADP reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E4H8 7.19e-07 55 24 13 314 3 gbs1423 Ferredoxin--NADP reductase Streptococcus agalactiae serotype III (strain NEM316)
Q3K0F9 7.19e-07 55 24 13 314 3 SAK_1384 Ferredoxin--NADP reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q74KS6 8.18e-07 54 21 7 310 3 LJ_0501 Ferredoxin--NADP reductase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A0LY71 8.4e-07 54 24 14 327 3 GFO_0330 Ferredoxin--NADP reductase 2 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q5S3I2 1.08e-06 54 27 5 201 1 ddmA1 Dicamba O-demethylase 1, ferredoxin reductase component Stenotrophomonas maltophilia
Q5S3I1 1.15e-06 54 27 5 201 1 ddmA2 Dicamba O-demethylase 2, ferredoxin reductase component Stenotrophomonas maltophilia
Q13Y97 1.16e-06 54 25 16 308 3 Bxeno_A2404 Ferredoxin--NADP reductase Paraburkholderia xenovorans (strain LB400)
W8X9R5 1.66e-06 54 24 10 303 1 ctmF Probable ferredoxin reductase CtmF Castellaniella defragrans (strain DSM 12143 / CCUG 39792 / 65Phen)
B4S9F8 1.7e-06 53 23 12 307 3 Paes_1610 Ferredoxin--NADP reductase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A9NFF6 2.58e-06 53 25 9 310 3 ACL_0467 Ferredoxin--NADP reductase Acholeplasma laidlawii (strain PG-8A)
Q0BQJ9 2.92e-06 53 25 12 315 3 GbCGDNIH1_2006 Ferredoxin--NADP reductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B3EEF0 4.31e-06 52 24 10 314 3 Clim_1719 Ferredoxin--NADP reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q5GRV1 4.99e-06 52 22 12 321 3 Wbm0685 Ferredoxin--NADP reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q12B36 5.72e-06 52 24 14 319 3 Bpro_2333 Ferredoxin--NADP reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1W6V2 9.04e-06 51 25 13 317 3 Ajs_1789 Ferredoxin--NADP reductase Acidovorax sp. (strain JS42)
B0S3V1 9.09e-06 52 26 4 174 3 mnmG tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
A2SFW9 1.06e-05 51 24 13 311 3 Mpe_A1496 Ferredoxin--NADP reductase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
O84925 1.24e-05 51 24 9 283 1 nox NADH oxidase Streptococcus pneumoniae
B2U9D2 2.02e-05 50 24 13 335 3 Rpic_0981 Ferredoxin--NADP reductase Ralstonia pickettii (strain 12J)
Q8DP70 2.86e-05 50 27 3 141 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
M1W428 4e-05 49 25 4 156 2 tcpT Thioredoxin reductase tcpT Claviceps purpurea (strain 20.1)
Q84PW3 5.74e-05 49 29 8 224 2 MDAR5 Monodehydroascorbate reductase 5, chlorplastic Oryza sativa subsp. japonica
A4F891 7.03e-05 48 26 13 307 3 SACE_0932 Ferredoxin--NADP reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q8NV36 7.19e-05 48 24 13 316 3 MW2294 Ferredoxin--NADP reductase Staphylococcus aureus (strain MW2)
Q6G6U7 7.19e-05 48 24 13 316 3 SAS2264 Ferredoxin--NADP reductase Staphylococcus aureus (strain MSSA476)
P85207 8.92e-05 48 26 17 360 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
A8GNK2 9.24e-05 48 22 9 310 3 A1C_03465 Ferredoxin--NADP reductase Rickettsia akari (strain Hartford)
Q2YZ12 9.29e-05 48 24 13 316 3 SAB2252c Ferredoxin--NADP reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2RNR2 0.000102 48 24 12 319 3 Rru_A3439 Ferredoxin--NADP reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O24679 0.000105 48 27 8 212 1 tecA4 Chlorobenzene dioxygenase, ferredoxin reductase component Cupriavidus sp. (strain PS12)
B5FG80 0.000107 48 29 7 167 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain MJ11)
Q07946 0.000115 48 25 6 226 1 bedA Benzene 1,2-dioxygenase system ferredoxin--NAD(+) reductase subunit Pseudomonas putida
A8Z563 0.000115 48 24 13 316 3 USA300HOU_2355 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300 / TCH1516)
Q99RQ5 0.000115 48 24 13 316 3 SAV2372 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJL4 0.000115 48 24 13 316 3 NWMN_2274 Ferredoxin--NADP reductase Staphylococcus aureus (strain Newman)
Q5HDI3 0.000115 48 24 13 316 3 SACOL2369 Ferredoxin--NADP reductase Staphylococcus aureus (strain COL)
A5IVF3 0.000115 48 24 13 316 3 SaurJH9_2396 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH9)
Q2FVP8 0.000115 48 24 13 316 1 SAOUHSC_02654 Ferredoxin--NADP reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEC4 0.000115 48 24 13 316 1 SAUSA300_2319 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300)
A6U499 0.000115 48 24 13 316 3 SaurJH1_2442 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH1)
A7X5Z9 0.000115 48 24 13 316 3 SAHV_2356 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A0A0H2UQZ4 0.000133 48 23 9 283 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5PAR7 0.00016 47 23 10 260 3 AM617 Ferredoxin--NADP reductase Anaplasma marginale (strain St. Maries)
Q21VM4 0.000192 47 23 14 337 3 Rfer_2462 Ferredoxin--NADP reductase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q6GE59 0.000213 47 23 12 315 3 SAR2461 Ferredoxin--NADP reductase Staphylococcus aureus (strain MRSA252)
Q6L0M1 0.000237 47 62 0 32 3 PTO0896 Digeranylgeranylglycerophospholipid reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
P42435 0.000268 47 30 7 142 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
P48639 0.000292 47 24 14 338 3 gor Glutathione reductase Burkholderia cepacia
Q84BZ0 0.000445 46 26 6 199 1 andAa Anthranilate 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Burkholderia cepacia
Q8NTE1 0.000471 46 24 14 318 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q54465 0.000522 46 29 6 126 3 merA Mercuric reductase Shewanella putrefaciens
P11959 0.000542 46 25 12 322 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
P72300 0.000626 46 23 13 320 3 ooxA Opine oxidase subunit A Rhizobium meliloti
Q049B3 0.000631 45 23 13 308 3 LBUL_1466 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G967 0.000631 45 23 13 308 3 Ldb1586 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9LK94 0.000652 46 26 8 210 1 MDAR4 Monodehydroascorbate reductase 4, peroxisomal Arabidopsis thaliana
Q2GCZ2 0.000668 45 22 10 323 3 NSE_0779 Ferredoxin--NADP reductase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A5FYH8 0.000742 45 25 12 316 3 Acry_1452 Ferredoxin--NADP reductase Acidiphilium cryptum (strain JF-5)
A5W4E9 0.000819 45 25 7 225 1 todA Toluene 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P06715 0.000868 45 27 9 211 1 gor Glutathione reductase Escherichia coli (strain K12)
Q96NN9 0.001 45 22 9 299 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10540
Feature type CDS
Gene ahpF
Product alkyl hydroperoxide reductase subunit F
Location 238742 - 240316 (strand: -1)
Length 1575 (nucleotides) / 524 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1520
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF07992 Pyridine nucleotide-disulphide oxidoreductase
PF13192 Thioredoxin domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3634 Defense mechanisms (V) V Alkyl hydroperoxide reductase subunit AhpF

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03387 NADH-dependent peroxiredoxin subunit F [EC:1.8.1.-] - -

Protein Sequence

MLDNTMKTQLRAYLEKLTRPVELVSTLDDSAKSAELKSLLNDIVALSPKISLREDNNAAARTPSFLITNPGESHGVRFAGSPLGHEFTSLVLALLQVGGHPSKEAQELLEQVRNLDGEFHFETYYSLSCHNCPDVVQALNLMAVLNPRITHTAIDGGVFQNEITERNIMGVPTVFLNGNEFGQGRMTLAEIINKVDSNAGKRAADALNQQAPYDVLIVGSGPAGASAAVYSARKGIRTGLIGERFGGQVLDTVDIENYISVPKTEGAKLAAALKMHVEDYTADIIDNQNVTALIPATEDGELHQLQTASGATLKARSVIISTGARWRNMGVPGEQEYRTKGVTYCPHCDGPLFKGKSVAVIGGGNSGAEAAIDLAGVVNHVTLLEFAPELKADAVLQQKLHSLPNVDIIVNAQTTEVLGDGSKVTGLQYKDRISGDIHTLTLSGIFVQIGLLPNTQWLKGTLALNPMGEIVIDARNETSIKGVFGAGDCTTVPYKQIIIAAGEGAKASLSAFDHLIRSSTRTAE

Flanking regions ( +/- flanking 50bp)

GGTGCATCAGCACCCGGTTTTTTAAGGGAATAATCATGCTCGATAACACGATCCTCGATAACACCATGAAAACGCAGCTCAGGGCGTATCTCGAAAAGTTAACCCGCCCGGTTGAGCTGGTATCAACCCTTGACGACAGTGCTAAATCCGCTGAGCTTAAATCGTTACTGAATGACATTGTGGCATTGTCCCCGAAAATTTCGCTGCGGGAAGATAACAATGCAGCTGCGCGCACGCCGTCATTTCTGATAACAAATCCCGGTGAATCACACGGTGTCCGTTTTGCCGGTTCACCGCTGGGTCATGAATTTACATCACTGGTGTTAGCACTGTTACAAGTCGGCGGTCATCCGTCAAAAGAAGCACAGGAATTATTGGAGCAGGTTCGTAATCTGGACGGAGAATTTCATTTTGAAACCTATTATTCCCTCTCCTGTCATAACTGCCCGGATGTTGTCCAGGCGCTGAACCTGATGGCAGTTTTGAATCCGCGCATTACCCATACGGCAATTGACGGCGGTGTATTTCAGAATGAAATAACCGAACGCAATATTATGGGTGTGCCGACCGTATTTCTTAATGGTAACGAATTTGGTCAGGGCCGTATGACGCTGGCTGAAATCATTAATAAAGTGGACAGCAATGCCGGAAAACGCGCAGCTGATGCACTGAATCAGCAGGCTCCTTATGATGTTCTGATTGTCGGCAGTGGTCCTGCGGGCGCATCAGCAGCCGTGTATTCCGCACGTAAAGGCATCCGTACCGGCCTTATCGGGGAGCGGTTCGGCGGTCAGGTTCTCGATACAGTGGATATCGAAAACTATATCTCAGTTCCGAAAACCGAAGGCGCAAAACTGGCTGCCGCGCTGAAGATGCATGTAGAAGATTATACCGCAGATATCATTGATAATCAGAATGTTACCGCACTTATCCCGGCTACAGAAGACGGTGAATTACATCAGTTACAGACCGCATCCGGTGCCACACTGAAAGCGCGCAGCGTTATCATCAGTACCGGCGCACGCTGGCGCAATATGGGTGTTCCCGGTGAGCAGGAATACCGCACCAAAGGTGTAACTTACTGCCCTCACTGTGACGGTCCGCTGTTTAAAGGAAAATCCGTTGCGGTTATCGGCGGCGGGAACTCGGGTGCGGAAGCCGCGATTGATTTGGCAGGTGTTGTAAACCATGTGACGTTACTGGAATTTGCCCCGGAACTGAAAGCCGATGCTGTGCTGCAACAGAAATTACACAGCCTGCCAAACGTGGATATCATTGTTAACGCCCAAACCACGGAAGTCCTTGGTGACGGCAGCAAAGTTACCGGTCTGCAATATAAAGACCGTATTTCAGGTGATATTCATACCCTGACGCTGTCCGGGATCTTCGTTCAGATTGGACTGCTGCCGAATACGCAGTGGCTGAAAGGCACATTAGCATTGAACCCGATGGGGGAAATTGTCATCGATGCCCGCAATGAAACCAGTATTAAAGGGGTCTTTGGTGCCGGTGACTGCACCACAGTGCCTTACAAGCAAATCATTATCGCGGCAGGCGAAGGTGCAAAAGCCTCACTCAGTGCATTTGACCATCTGATCCGCAGCAGTACCAGAACCGCTGAATAGTCCGCTATTCAGTTGTGATACCAAAGGCATCCGGGGGCGGATGCCTTTTT