Homologs in group_1469

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09425 FBDBKF_09425 100.0 Morganella morganii S1 ahpF alkyl hydroperoxide reductase subunit F
EHELCC_09985 EHELCC_09985 100.0 Morganella morganii S2 ahpF alkyl hydroperoxide reductase subunit F
NLDBIP_10330 NLDBIP_10330 100.0 Morganella morganii S4 ahpF alkyl hydroperoxide reductase subunit F
HKOGLL_14085 HKOGLL_14085 100.0 Morganella morganii S5 ahpF alkyl hydroperoxide reductase subunit F
F4V73_RS10540 F4V73_RS10540 90.8 Morganella psychrotolerans ahpF alkyl hydroperoxide reductase subunit F
PMI_RS05855 PMI_RS05855 79.5 Proteus mirabilis HI4320 ahpF alkyl hydroperoxide reductase subunit F

Distribution of the homologs in the orthogroup group_1469

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1469

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19480 0.0 849 79 0 518 1 ahpF Alkyl hydroperoxide reductase subunit F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P35340 0.0 844 78 0 520 1 ahpF Alkyl hydroperoxide reductase subunit F Escherichia coli (strain K12)
P0A156 0.0 695 66 2 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida
P0A155 0.0 695 66 2 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I6Z2 0.0 680 64 1 519 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O06465 0.0 654 63 3 522 3 ahpF Alkyl hydroperoxide reductase subunit F Xanthomonas campestris pv. phaseoli
P26829 0.0 607 56 4 520 1 ahpF NADH dehydrogenase Ferdinandcohnia aciditolerans (strain JCM 32973 / CCTCC AB 2017280 / YN-1)
P42974 0.0 587 57 5 517 1 ahpF NADH dehydrogenase Bacillus subtilis (strain 168)
Q6GC92 0.0 562 54 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MSSA476)
P66013 0.0 561 54 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MW2)
Q6GJR8 0.0 561 54 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MRSA252)
P99118 0.0 561 54 5 517 1 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain N315)
P66012 0.0 561 54 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIR6 0.0 555 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain COL)
O05204 0.0 555 53 5 517 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CMQ1 0.0 532 54 6 497 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRY2 0.0 530 53 6 497 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P80880 7.91e-51 179 33 4 311 1 trxB Thioredoxin reductase Bacillus subtilis (strain 168)
P39916 2.27e-50 178 35 5 319 3 trxB Thioredoxin reductase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P46843 1.31e-49 180 36 7 312 3 trxB/A Bifunctional thioredoxin reductase/thioredoxin Mycobacterium leprae (strain TN)
O30973 1.58e-49 176 33 5 309 3 trxB Thioredoxin reductase Mycolicibacterium smegmatis
P52215 2.6e-49 175 33 6 306 2 trxB Thioredoxin reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WHH1 6.67e-49 174 35 6 307 1 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH0 6.67e-49 174 35 6 307 3 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32823 4.9e-48 172 33 3 310 3 trxB Thioredoxin reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q928B5 1.52e-47 171 33 4 310 3 trxB Thioredoxin reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93HX6 8.54e-47 169 36 7 311 1 None Glucosaminate ammonia-lyase Pseudomonas fluorescens
P43788 5.12e-46 166 35 7 312 1 trxB Thioredoxin reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q68WT3 6.99e-46 166 33 6 311 3 trxB Thioredoxin reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9PR71 8.38e-46 166 35 7 317 3 trxB Thioredoxin reductase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q8CPY8 9.24e-46 166 33 3 308 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW4 9.24e-46 166 33 3 308 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1RJD8 1.99e-45 164 34 6 311 3 trxB Thioredoxin reductase Rickettsia bellii (strain RML369-C)
Q70G58 3.73e-45 169 33 7 312 1 Os07g0657900 Thioredoxin reductase NTRC Oryza sativa subsp. japonica
Q9KSS4 9.35e-45 163 33 7 312 3 trxB Thioredoxin reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q05741 1.19e-44 163 31 6 306 1 trxB Thioredoxin reductase Streptomyces clavuligerus
Q9ZD97 2.66e-44 162 32 6 311 3 trxB Thioredoxin reductase Rickettsia prowazekii (strain Madrid E)
O22229 3.3e-44 167 33 8 315 1 NTRC NADPH-dependent thioredoxin reductase 3 Arabidopsis thaliana
Q92I02 8.61e-44 160 32 5 307 3 trxB Thioredoxin reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P66011 1.09e-43 160 33 4 305 1 trxB Thioredoxin reductase Staphylococcus aureus (strain MW2)
Q6GB66 1.09e-43 160 33 4 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MSSA476)
P99101 1.09e-43 160 33 4 305 1 trxB Thioredoxin reductase Staphylococcus aureus (strain N315)
P66010 1.09e-43 160 33 4 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHQ4 1.09e-43 160 33 4 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain COL)
P23160 2.57e-43 159 30 3 310 3 None 34.2 kDa protein in rubredoxin operon Clostridium pasteurianum
Q6GIM7 4.14e-43 158 33 4 305 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MRSA252)
Q4ULP1 8.04e-43 157 32 6 311 3 trxB Thioredoxin reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P0A9P4 2.43e-42 157 35 9 313 1 trxB Thioredoxin reductase Escherichia coli (strain K12)
P0A9P5 2.43e-42 157 35 9 313 3 trxB Thioredoxin reductase Escherichia coli O157:H7
Q9ZL18 2.95e-42 156 31 4 310 3 trxB Thioredoxin reductase Helicobacter pylori (strain J99 / ATCC 700824)
P52213 1.94e-41 154 34 7 312 3 trxB Thioredoxin reductase Peptoclostridium litorale
P50971 5.25e-41 153 34 6 312 1 trxB Thioredoxin reductase Peptoclostridium acidaminophilum
P94284 1.18e-40 152 31 5 304 3 trxB Thioredoxin reductase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q75CM8 1.35e-40 152 30 5 313 3 TRR1 Thioredoxin reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6BIS1 1.85e-40 151 30 5 313 3 TRR1 Thioredoxin reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P56431 2.68e-40 151 30 4 310 1 trxB Thioredoxin reductase Helicobacter pylori (strain ATCC 700392 / 26695)
P38816 6.18e-40 150 29 5 338 1 TRR2 Thioredoxin reductase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FR39 7e-40 150 31 5 312 3 TRR1 Thioredoxin reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6C7L4 7.99e-40 150 31 5 305 3 TRR1 Thioredoxin reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6HA24 1.18e-39 150 31 5 313 3 TRR1 Thioredoxin reductase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P51978 1.87e-39 149 33 6 313 3 cys-9 Thioredoxin reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P29509 4.25e-39 148 31 5 312 1 TRR1 Thioredoxin reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54UU8 6.52e-39 147 31 8 313 3 trrA Thioredoxin reductase Dictyostelium discoideum
Q7Z7S3 1.05e-38 147 31 5 304 2 TRR1 Thioredoxin reductase Pneumocystis carinii
Q8J0U0 4.75e-38 145 31 8 307 2 TRR1 Thioredoxin reductase Pneumocystis jirovecii
Q9PKT7 1.94e-37 143 32 10 314 3 trxB Thioredoxin reductase Chlamydia muridarum (strain MoPn / Nigg)
O83790 4.13e-37 142 34 9 310 3 trxB Thioredoxin reductase Treponema pallidum (strain Nichols)
Q39242 5.31e-37 144 32 10 319 2 NTR2 Thioredoxin reductase 2 Arabidopsis thaliana
Q9Z8M4 1.2e-36 141 31 9 318 3 trxB Thioredoxin reductase Chlamydia pneumoniae
Q92375 1.22e-36 141 30 6 312 1 trr1 Thioredoxin reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O84101 1.32e-36 141 31 10 314 3 trxB Thioredoxin reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P47348 1.97e-36 140 31 5 316 3 trxB Thioredoxin reductase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P57399 9.43e-36 139 32 7 314 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P43496 1.94e-35 138 30 7 324 1 TRR1 Thioredoxin reductase Penicillium chrysogenum
Q89AJ2 5.57e-35 137 31 7 315 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q39243 2.74e-34 136 33 10 319 1 NTR1 Thioredoxin reductase 1, mitochondrial Arabidopsis thaliana
P81433 3.25e-34 134 29 8 314 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q58931 7.23e-33 130 29 10 306 3 MJ1536 Putative thioredoxin reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O66790 8.3e-33 130 30 5 306 3 trxB Thioredoxin reductase Aquifex aeolicus (strain VF5)
Q98PK9 1.73e-31 127 29 6 304 3 trxB Thioredoxin reductase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q6ZFU6 1.74e-31 127 30 8 315 2 NTRB Thioredoxin reductase NTRB Oryza sativa subsp. japonica
Q69PS6 4.16e-31 127 31 9 316 3 Os06g0327300 Thioredoxin reductase NTRA Oryza sativa subsp. japonica
Q8T6Z1 1.29e-30 124 30 7 312 2 TRXB Thioredoxin reductase (Fragment) Spironucleus barkhanus
P75531 1.22e-28 119 31 5 318 3 trxB Thioredoxin reductase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q67QU3 3.44e-21 98 29 10 309 3 STH965 Ferredoxin--NADP reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q6L1Y6 1.31e-20 96 26 9 293 3 PTO0431 Ferredoxin--NADP reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9K7F3 1.34e-20 96 28 8 301 3 BH3408 Ferredoxin--NADP reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q72LG3 1.4e-20 96 29 12 308 3 TT_C0096 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SL28 5.58e-20 94 28 12 308 1 TTHA0465 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A4YER6 1.51e-19 93 28 12 320 3 Msed_0743 Ferredoxin--NADP reductase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q96YN9 5.49e-19 91 28 12 314 3 STK_21330 Ferredoxin--NADP reductase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q82ZZ8 5.6e-18 88 27 11 320 3 EF_2899 Ferredoxin--NADP reductase Enterococcus faecalis (strain ATCC 700802 / V583)
Q71Y53 7.88e-18 88 26 10 332 3 LMOf2365_1991 Ferredoxin--NADP reductase 1 Listeria monocytogenes serotype 4b (strain F2365)
A0AK73 8.33e-18 88 27 10 332 3 lwe1987 Ferredoxin--NADP reductase 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q97WJ5 1.56e-17 87 28 11 293 3 SSO2222 Ferredoxin--NADP reductase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q92A47 1.81e-17 87 26 11 330 3 lin2075 Ferredoxin--NADP reductase 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y5U4 1.96e-17 87 26 10 332 3 lmo1961 Ferredoxin--NADP reductase 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5WDV1 2.78e-17 86 26 10 309 3 ABC2925 Ferredoxin--NADP reductase 2 Shouchella clausii (strain KSM-K16)
Q71X35 1.91e-16 84 27 12 307 3 LMOf2365_2364 Ferredoxin--NADP reductase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q928P3 2.45e-16 83 26 12 307 3 lin2489 Ferredoxin--NADP reductase 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AL74 3.38e-16 83 26 12 307 3 lwe2338 Ferredoxin--NADP reductase 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5KVP7 4.78e-16 82 27 11 305 3 GK2954 Ferredoxin--NADP reductase Geobacillus kaustophilus (strain HTA426)
Q4JCM0 5.25e-16 82 28 12 294 3 Saci_0029 Ferredoxin--NADP reductase 1 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8Y4P5 6.53e-16 82 27 12 307 3 lmo2390 Ferredoxin--NADP reductase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0LT79 9.08e-16 82 28 12 302 3 Acel_0866 Ferredoxin--NADP reductase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q4J6Z4 9.38e-16 82 32 11 233 3 Saci_2144 Ferredoxin--NADP reductase 2 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A4ISE6 1.88e-15 81 27 12 307 3 GTNG_2905 Ferredoxin--NADP reductase Geobacillus thermodenitrificans (strain NG80-2)
A8AA47 2.08e-15 80 29 13 313 3 Igni_0617 Ferredoxin--NADP reductase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q03JS2 2.76e-15 80 25 7 306 3 STER_1382 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3J6 2.76e-15 80 25 7 306 3 stu1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY3 2.76e-15 80 25 7 306 3 str1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain CNRZ 1066)
A3CM39 4.16e-15 79 25 10 308 3 SSA_0813 Ferredoxin--NADP reductase Streptococcus sanguinis (strain SK36)
A8AXQ6 8.31e-15 79 25 10 308 3 SGO_1284 Ferredoxin--NADP reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q9CF34 1.5e-14 78 24 7 299 3 LL1647 Ferredoxin--NADP reductase Lactococcus lactis subsp. lactis (strain IL1403)
Q8DP13 2.11e-14 77 26 14 317 3 spr1421 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JI5 2.11e-14 77 26 14 317 3 SPD_1393 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2GEF7 2.45e-14 77 28 11 310 3 LAF_1703 Ferredoxin--NADP reductase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A9VRK8 4.89e-14 77 26 13 299 3 BcerKBAB4_0332 Ferredoxin--NADP reductase 1 Bacillus mycoides (strain KBAB4)
B3QPZ8 1.41e-13 75 26 10 312 3 Cpar_1603 Ferredoxin--NADP reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1ICY3 3.63e-13 73 26 14 317 3 SPH_1677 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain Hungary19A-6)
Q3STP0 6.99e-13 73 25 12 319 3 Nwi_1089 Ferredoxin--NADP reductase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B2IR81 7.55e-13 73 26 14 317 3 SPCG_1548 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain CGSP14)
Q97PP0 7.55e-13 73 26 14 317 3 SP_1563 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E6K6 8.44e-13 72 25 11 314 3 SPG_1489 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 19F (strain G54)
B3EKW5 8.89e-13 73 25 11 313 3 Cphamn1_1733 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain BS1)
Q6HP49 1.17e-12 72 25 12 298 3 BT9727_0321 Ferredoxin--NADP reductase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZB7 1.17e-12 72 25 12 298 3 BA_0352 Ferredoxin--NADP reductase 1 Bacillus anthracis
A0R951 1.17e-12 72 25 12 298 3 BALH_0343 Ferredoxin--NADP reductase 1 Bacillus thuringiensis (strain Al Hakam)
A4VXW3 1.49e-12 72 23 11 322 3 SSU05_1986 Ferredoxin--NADP reductase Streptococcus suis (strain 05ZYH33)
A4W460 1.49e-12 72 23 11 322 3 SSU98_1991 Ferredoxin--NADP reductase Streptococcus suis (strain 98HAH33)
O05268 1.71e-12 72 24 12 305 1 yumC Ferredoxin--NADP reductase 2 Bacillus subtilis (strain 168)
B1I067 1.76e-12 72 24 9 302 3 Bsph_0993 Ferredoxin--NADP reductase 2 Lysinibacillus sphaericus (strain C3-41)
Q816D9 1.94e-12 72 26 13 310 1 BC_4926 Ferredoxin--NADP reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GKN4 1.98e-12 72 24 11 298 3 Bcer98_0331 Ferredoxin--NADP reductase 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q632D6 2.28e-12 71 26 13 310 3 BCE33L4658 Ferredoxin--NADP reductase Bacillus cereus (strain ZK / E33L)
Q6HBX6 2.28e-12 71 26 13 310 3 BT9727_4639 Ferredoxin--NADP reductase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q72YF6 2.28e-12 71 26 13 310 3 BCE_5065 Ferredoxin--NADP reductase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81XS0 2.28e-12 71 26 13 310 3 BA_5160 Ferredoxin--NADP reductase 2 Bacillus anthracis
A0RKB9 2.28e-12 71 26 13 310 3 BALH_4465 Ferredoxin--NADP reductase 2 Bacillus thuringiensis (strain Al Hakam)
Q02XL9 2.35e-12 71 24 8 303 3 LACR_1811 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain SK11)
A8FB45 2.78e-12 71 24 9 304 3 BPUM_0777 Ferredoxin--NADP reductase 1 Bacillus pumilus (strain SAFR-032)
A7Z8C1 2.87e-12 71 24 12 305 3 RBAM_029160 Ferredoxin--NADP reductase 2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B2G9D0 3.03e-12 71 28 13 308 3 LAR_1546 Ferredoxin--NADP reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM22 3.03e-12 71 28 13 308 3 Lreu_1657 Ferredoxin--NADP reductase Limosilactobacillus reuteri (strain DSM 20016)
Q13AK7 3.06e-12 71 23 14 323 3 RPD_1645 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB5)
A8M2W8 3.24e-12 71 27 10 306 3 Sare_0817 Ferredoxin--NADP reductase Salinispora arenicola (strain CNS-205)
B3QXR3 3.57e-12 71 26 13 307 3 Ctha_2529 Ferredoxin--NADP reductase 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q38YJ1 3.65e-12 71 25 12 310 3 LCA_0435 Ferredoxin--NADP reductase 2 Latilactobacillus sakei subsp. sakei (strain 23K)
A1SKI3 3.95e-12 70 25 12 304 3 Noca_2816 Ferredoxin--NADP reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q2JFM8 5.08e-12 70 26 12 307 3 Francci3_0530 Ferredoxin--NADP reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A2RJC6 5.27e-12 70 23 7 299 3 llmg_0776 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain MG1363)
Q4L8N5 5.56e-12 70 24 9 303 3 SH0681 Ferredoxin--NADP reductase Staphylococcus haemolyticus (strain JCSC1435)
Q8KCB2 5.84e-12 70 25 10 304 1 CT1512 Ferredoxin--NADP reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q1QNQ1 8.61e-12 70 23 12 319 3 Nham_1321 Ferredoxin--NADP reductase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A8FH11 9.64e-12 69 23 12 305 3 BPUM_2873 Ferredoxin--NADP reductase 2 Bacillus pumilus (strain SAFR-032)
Q8DUN5 1.02e-11 69 25 8 308 3 SMU_869 Ferredoxin--NADP reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A7Z171 1.12e-11 69 25 11 323 3 RBAM_003480 Ferredoxin--NADP reductase 1 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2ITC6 1.25e-11 69 24 13 327 3 RPB_3841 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain HaA2)
A0LXL9 1.41e-11 69 25 14 327 3 GFO_0125 Ferredoxin--NADP reductase 1 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A1BHP4 1.44e-11 69 25 9 305 3 Cpha266_1905 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q88UC0 1.58e-11 69 25 12 318 3 lp_2585 Ferredoxin--NADP reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03AW0 1.61e-11 69 24 12 309 3 LSEI_0826 Ferredoxin--NADP reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A9VMZ3 1.73e-11 68 25 13 310 3 BcerKBAB4_4748 Ferredoxin--NADP reductase 2 Bacillus mycoides (strain KBAB4)
A7GUD5 2.32e-11 68 25 13 310 3 Bcer98_3539 Ferredoxin--NADP reductase 2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B1YKW2 2.96e-11 68 24 9 304 3 Exig_2313 Ferredoxin--NADP reductase 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8ENX4 3.16e-11 68 24 12 318 3 OB2351 Ferredoxin--NADP reductase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65FE0 3.23e-11 68 24 12 305 3 BLi03393 Ferredoxin--NADP reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q0RRX8 3.42e-11 68 24 11 310 3 FRAAL1022 Ferredoxin--NADP reductase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q473F6 3.6e-11 68 27 14 326 3 Reut_A1099 Ferredoxin--NADP reductase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LKJ7 3.95e-11 68 24 14 338 3 Rmet_2452 Ferredoxin--NADP reductase 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q04HB6 4.18e-11 68 24 13 327 3 OEOE_0163 Ferredoxin--NADP reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B3WCB2 5.76e-11 67 25 13 312 3 LCABL_08900 Ferredoxin--NADP reductase Lacticaseibacillus casei (strain BL23)
A4SFT9 8.45e-11 67 24 11 306 3 Cvib_1336 Ferredoxin--NADP reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A4X398 8.66e-11 67 26 10 306 3 Strop_0871 Ferredoxin--NADP reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q1IZM1 8.87e-11 67 27 11 297 3 Dgeo_1013 Ferredoxin--NADP reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q5WAF1 1.11e-10 66 22 8 311 3 ABC0094 Ferredoxin--NADP reductase 1 Shouchella clausii (strain KSM-K16)
B3QJ15 1.22e-10 66 23 12 320 3 Rpal_4475 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain TIE-1)
Q6N2U4 1.22e-10 66 23 12 320 1 RPA3954 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1RHV1 1.3e-10 66 25 12 315 3 RBE_0982 Ferredoxin--NADP reductase Rickettsia bellii (strain RML369-C)
A8GW75 1.86e-10 65 25 12 315 3 A1I_03745 Ferredoxin--NADP reductase Rickettsia bellii (strain OSU 85-389)
Q92HY3 1.97e-10 65 25 13 317 3 RC0637 Ferredoxin--NADP reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GS72 2.85e-10 65 25 13 317 3 A1G_03605 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Sheila Smith)
B3R4A7 2.92e-10 65 28 14 328 3 RALTA_A1176 Ferredoxin--NADP reductase 1 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q03ZE9 3.15e-10 65 25 11 320 3 LEUM_0297 Ferredoxin--NADP reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q65GY3 3.58e-10 65 24 11 309 3 BLi02810 Ferredoxin--NADP reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q89HV6 3.62e-10 65 25 14 322 3 bll5883 Ferredoxin--NADP reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B0BXN8 4.09e-10 65 24 13 317 3 RrIowa_0762 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Iowa)
Q98M06 4.86e-10 64 23 11 305 3 mll0792 Ferredoxin--NADP reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O31475 5.09e-10 64 24 11 330 1 ycgT Ferredoxin--NADP reductase 1 Bacillus subtilis (strain 168)
A9C3H6 5.91e-10 64 26 9 303 3 Daci_4658 Ferredoxin--NADP reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q4ULM2 7.12e-10 64 24 13 317 3 RF_0700 Ferredoxin--NADP reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B3CMJ8 7.47e-10 63 25 11 308 3 WP1010 Ferredoxin--NADP reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q73EA6 8.42e-10 63 23 12 298 3 BCE_0452 Ferredoxin--NADP reductase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q07RK6 8.6e-10 63 23 15 326 3 RPE_1478 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisA53)
Q4FMZ1 9.27e-10 63 23 13 317 3 SAR11_0627 Ferredoxin--NADP reductase Pelagibacter ubique (strain HTCC1062)
Q045M0 1.29e-09 63 23 8 301 3 LGAS_0447 Ferredoxin--NADP reductase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B1MX70 1.36e-09 63 22 11 324 3 LCK_00289 Ferredoxin--NADP reductase Leuconostoc citreum (strain KM20)
B3R5L8 1.53e-09 63 24 14 340 3 RALTA_A2094 Ferredoxin--NADP reductase 2 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B3QXE1 1.82e-09 63 26 11 305 3 Ctha_0950 Ferredoxin--NADP reductase 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q49ZU9 2e-09 62 25 11 306 3 SSP0530 Ferredoxin--NADP reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P37062 2.04e-09 63 28 6 225 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
A8F1N2 2.55e-09 62 24 11 319 3 RMA_0647 Ferredoxin--NADP reductase Rickettsia massiliae (strain Mtu5)
Q9ZD33 2.71e-09 62 24 12 297 3 RP514 Ferredoxin--NADP reductase Rickettsia prowazekii (strain Madrid E)
Q3B2Q8 2.77e-09 62 25 10 309 3 Plut_1516 Ferredoxin--NADP reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B4SFQ3 2.97e-09 62 25 13 320 3 Ppha_1024 Ferredoxin--NADP reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B4U394 2.98e-09 62 25 9 305 3 Sez_1109 Ferredoxin--NADP reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A4JS50 3.37e-09 62 27 14 329 3 Bcep1808_6193 Ferredoxin--NADP reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0K8J6 3.92e-09 62 25 13 316 3 H16_A2592 Ferredoxin--NADP reductase 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1YEQ1 4.97e-09 61 24 11 304 3 Exig_2773 Ferredoxin--NADP reductase 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A4YXZ8 6.45e-09 61 23 13 322 3 BRADO5079 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain ORS 278)
Q219B6 6.93e-09 61 22 13 321 3 RPC_1458 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB18)
Q1LPH7 7.15e-09 61 27 16 325 3 Rmet_1063 Ferredoxin--NADP reductase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0KCD1 7.5e-09 61 27 16 330 3 H16_A1199 Ferredoxin--NADP reductase 1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2W0C9 7.78e-09 60 27 12 317 3 amb3892 Ferredoxin--NADP reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q46YY3 7.82e-09 61 23 13 329 3 Reut_A2287 Ferredoxin--NADP reductase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q68WM0 7.86e-09 60 24 13 318 3 RT0500 Ferredoxin--NADP reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A7HW48 1.06e-08 60 24 10 316 3 Plav_2522 Ferredoxin--NADP reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B2IHR5 1.22e-08 60 23 12 321 3 Bind_2345 Ferredoxin--NADP reductase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B1XWQ5 1.64e-08 60 25 11 309 3 Lcho_2791 Ferredoxin--NADP reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2GJY7 1.69e-08 60 24 13 322 3 APH_0734 Ferredoxin--NADP reductase Anaplasma phagocytophilum (strain HZ)
A4SVT8 2.17e-08 59 23 11 311 3 Pnuc_0382 Ferredoxin--NADP reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
D4APQ6 2.31e-08 60 27 3 162 1 ARB_06224 Probable thioredoxin reductase ARB_06224 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q8ETS1 2.46e-08 59 22 9 288 3 OB0186 Ferredoxin--NADP reductase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A8YTT2 2.54e-08 59 26 12 306 3 lhv_0465 Ferredoxin--NADP reductase Lactobacillus helveticus (strain DPC 4571)
A8EYV4 3.68e-08 58 25 12 317 3 A1E_02985 Ferredoxin--NADP reductase Rickettsia canadensis (strain McKiel)
P75393 3.71e-08 59 27 13 317 1 pdhD Dihydrolipoyl dehydrogenase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q03PJ4 3.76e-08 58 27 13 316 3 LVIS_1813 Ferredoxin--NADP reductase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B1HZ05 4.31e-08 58 22 11 314 3 Bsph_0789 Ferredoxin--NADP reductase 1 Lysinibacillus sphaericus (strain C3-41)
B4S9F8 4.45e-08 58 23 10 305 3 Paes_1610 Ferredoxin--NADP reductase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B2JN27 4.63e-08 58 25 16 336 3 Bphy_3740 Ferredoxin--NADP reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q13Y97 5.2e-08 58 25 17 324 3 Bxeno_A2404 Ferredoxin--NADP reductase Paraburkholderia xenovorans (strain LB400)
Q5FLU4 6.41e-08 58 28 6 194 3 LBA0439 Ferredoxin--NADP reductase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q74KS6 8.5e-08 57 24 11 315 3 LJ_0501 Ferredoxin--NADP reductase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q3AS18 9.71e-08 57 25 11 307 3 Cag_0944 Ferredoxin--NADP reductase Chlorobium chlorochromatii (strain CaD3)
Q8DYW9 9.94e-08 57 25 12 306 3 SAG1353 Ferredoxin--NADP reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E4H8 9.94e-08 57 25 12 306 3 gbs1423 Ferredoxin--NADP reductase Streptococcus agalactiae serotype III (strain NEM316)
Q3K0F9 9.94e-08 57 25 12 306 3 SAK_1384 Ferredoxin--NADP reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B3EEF0 1.07e-07 57 25 12 326 3 Clim_1719 Ferredoxin--NADP reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B1HW35 1.39e-07 57 24 7 222 3 Bsph_2322 Ferredoxin--NADP reductase 3 Lysinibacillus sphaericus (strain C3-41)
A1WQW2 1.59e-07 57 27 11 307 3 Veis_4316 Ferredoxin--NADP reductase Verminephrobacter eiseniae (strain EF01-2)
Q73GH2 1.85e-07 56 22 11 324 3 WD_0982 Ferredoxin--NADP reductase Wolbachia pipientis wMel
A0LY71 3.58e-07 55 25 15 328 3 GFO_0330 Ferredoxin--NADP reductase 2 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q12B36 5.02e-07 55 23 14 349 3 Bpro_2333 Ferredoxin--NADP reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q51973 5.96e-07 55 25 10 296 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
B2T4Y1 6.03e-07 55 25 17 333 3 Bphyt_2243 Ferredoxin--NADP reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q2GGH5 6.47e-07 55 22 11 313 3 ECH_0649 Ferredoxin--NADP reductase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5GRV1 6.91e-07 55 22 11 324 3 Wbm0685 Ferredoxin--NADP reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
A5EMW5 7.32e-07 55 23 13 321 3 BBta_5550 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q7NBE9 1.46e-06 53 23 12 334 3 MYCGA3300 Ferredoxin--NADP reductase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A9NFF6 1.59e-06 53 26 9 310 3 ACL_0467 Ferredoxin--NADP reductase Acholeplasma laidlawii (strain PG-8A)
A4F891 3.41e-06 52 27 12 314 3 SACE_0932 Ferredoxin--NADP reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q5S3I2 4.54e-06 52 27 5 197 1 ddmA1 Dicamba O-demethylase 1, ferredoxin reductase component Stenotrophomonas maltophilia
Q5S3I1 5.14e-06 52 27 5 197 1 ddmA2 Dicamba O-demethylase 2, ferredoxin reductase component Stenotrophomonas maltophilia
A1W6V2 5.65e-06 52 26 11 315 3 Ajs_1789 Ferredoxin--NADP reductase Acidovorax sp. (strain JS42)
P11959 6.61e-06 52 26 12 322 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
Q0BQJ9 8.09e-06 51 24 10 313 3 GbCGDNIH1_2006 Ferredoxin--NADP reductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
E9RAH5 8.87e-06 51 23 10 325 1 gliT Thioredoxin reductase gliT Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8DP70 9.06e-06 52 33 7 146 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8NV36 9.8e-06 51 23 11 319 3 MW2294 Ferredoxin--NADP reductase Staphylococcus aureus (strain MW2)
Q6G6U7 9.8e-06 51 23 11 319 3 SAS2264 Ferredoxin--NADP reductase Staphylococcus aureus (strain MSSA476)
O84925 9.88e-06 51 33 7 146 1 nox NADH oxidase Streptococcus pneumoniae
A8Z563 1.03e-05 51 23 11 319 3 USA300HOU_2355 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300 / TCH1516)
Q99RQ5 1.03e-05 51 23 11 319 3 SAV2372 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJL4 1.03e-05 51 23 11 319 3 NWMN_2274 Ferredoxin--NADP reductase Staphylococcus aureus (strain Newman)
Q5HDI3 1.03e-05 51 23 11 319 3 SACOL2369 Ferredoxin--NADP reductase Staphylococcus aureus (strain COL)
A5IVF3 1.03e-05 51 23 11 319 3 SaurJH9_2396 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH9)
Q2FVP8 1.03e-05 51 23 11 319 1 SAOUHSC_02654 Ferredoxin--NADP reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEC4 1.03e-05 51 23 11 319 1 SAUSA300_2319 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300)
A6U499 1.03e-05 51 23 11 319 3 SaurJH1_2442 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH1)
A7X5Z9 1.03e-05 51 23 11 319 3 SAHV_2356 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q21VM4 1.1e-05 51 23 12 327 3 Rfer_2462 Ferredoxin--NADP reductase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2YZ12 1.16e-05 51 24 12 322 3 SAB2252c Ferredoxin--NADP reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P37337 1.22e-05 51 26 5 204 3 bphG Biphenyl dioxygenase system ferredoxin--NAD(+) reductase component Paraburkholderia xenovorans (strain LB400)
A8GNK2 1.28e-05 50 24 10 314 3 A1C_03465 Ferredoxin--NADP reductase Rickettsia akari (strain Hartford)
P42435 1.84e-05 51 33 7 142 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
Q6GE59 2.44e-05 50 23 11 319 3 SAR2461 Ferredoxin--NADP reductase Staphylococcus aureus (strain MRSA252)
A5CF57 2.61e-05 50 23 12 322 3 OTBS_1841 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Boryong)
Q03H60 2.63e-05 50 23 14 311 3 PEPE_0366 Ferredoxin--NADP reductase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q2RNR2 3.03e-05 50 24 11 318 3 Rru_A3439 Ferredoxin--NADP reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B2U9D2 3.19e-05 50 25 16 344 3 Rpic_0981 Ferredoxin--NADP reductase Ralstonia pickettii (strain 12J)
A0A0H2UQZ4 0.000106 48 32 7 146 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B3CTT3 0.000107 48 24 13 322 3 OTT_1322 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Ikeda)
P85207 0.000114 48 24 13 349 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
Q2GCZ2 0.000128 47 21 9 316 3 NSE_0779 Ferredoxin--NADP reductase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q9PJI3 0.000222 47 24 14 333 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia muridarum (strain MoPn / Nigg)
B5FG80 0.000244 47 31 6 166 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain MJ11)
Q8Y0A5 0.000277 47 26 15 322 3 RSc1139 Ferredoxin--NADP reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5XC60 0.000297 47 28 3 143 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q54465 0.000344 47 30 6 126 3 merA Mercuric reductase Shewanella putrefaciens
P06715 0.000351 47 27 9 211 1 gor Glutathione reductase Escherichia coli (strain K12)
X5CY81 0.000373 46 26 6 197 1 cndC1 Chloroacetanilide N-alkylformylase, ferredoxin reductase component Rhizorhabdus wittichii (strain DC-6 / KACC 16600)
Q6L0M1 0.000374 46 62 0 32 3 PTO0896 Digeranylgeranylglycerophospholipid reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q8NTE1 0.000396 46 22 11 319 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q049B3 0.000412 46 24 14 306 3 LBUL_1466 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G967 0.000412 46 24 14 306 3 Ldb1586 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B0S3V1 0.000506 46 25 4 174 3 mnmG tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q1WUT6 0.000515 46 22 9 303 3 LSL_0439 Ferredoxin--NADP reductase Ligilactobacillus salivarius (strain UCC118)
Q7A3W1 0.000532 45 24 6 222 1 SA2162 Ferredoxin--NADP reductase Staphylococcus aureus (strain N315)
Q84PW3 0.000616 46 29 9 220 2 MDAR5 Monodehydroascorbate reductase 5, chlorplastic Oryza sativa subsp. japonica
A6H064 0.000671 45 23 14 317 3 FP1670 Ferredoxin--NADP reductase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
O84561 0.000687 45 23 14 330 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q5PAR7 0.000753 45 24 10 262 3 AM617 Ferredoxin--NADP reductase Anaplasma marginale (strain St. Maries)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_11025
Feature type CDS
Gene ahpF
Product alkyl hydroperoxide reductase subunit F
Location 181670 - 183244 (strand: 1)
Length 1575 (nucleotides) / 524 (amino acids)

Contig

Accession ZDB_367
Length 191445 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1469
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF07992 Pyridine nucleotide-disulphide oxidoreductase
PF13192 Thioredoxin domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3634 Defense mechanisms (V) V Alkyl hydroperoxide reductase subunit AhpF

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03387 NADH-dependent peroxiredoxin subunit F [EC:1.8.1.-] - -

Protein Sequence

MLDNTMKAQLKAYLEKLTRPVELVSTLDDSAKSGEIRTLLQEIAELSPKVTVREDNSASARKPSFLIVNPGQTQGIRFAGSPLGHEFTSLVLALLQVGGHPSKEAQELLDQVRNLEGEFHFETYYSLSCHNCPDVVQALNLMAVLNPDITHTAIDGGLFQNEITERNIMGVPAVFLNGNEFGQGRMTLAEIVNKMDSNAGKRAADALNQQAPYEVLIVGSGPAGASAAVYAARKGIRTGLIGERFGGQVLDTVDIENYISVPKTEGAKLAAALKVHVEDYTADVIDNQSITALIPATEQGGLHQLQTASGATLKARSVIISTGARWRNMGVPGEQEYRTKGVTYCPHCDGPLFKGKSVAVIGGGNSGAEAAIDLAGVVEHVTLLEFAPELKADAVLQQKLRSLANVDIIVNAQTTEVLGDGSKVTGLQYKDRVSGELHTLTLAGIFVQIGLLPNTQWLKGTLDLNPMGEIVVDARNETSIKGVYGAGDCTTVPYKQIIIAAGEGAKASLSAFDYLIRTSTRTAE

Flanking regions ( +/- flanking 50bp)

TTATTTACTGTTATCGGGTGCATTGCACCCGATTTTTTAAGGGAATAATCATGCTCGATAACACAATGAAAGCGCAGCTTAAAGCGTATCTCGAAAAATTAACCCGTCCGGTTGAACTGGTATCAACCCTTGACGACAGTGCTAAGTCCGGTGAAATCAGGACATTATTACAGGAAATTGCTGAGTTATCGCCGAAGGTTACCGTTCGCGAAGATAACAGTGCTTCTGCACGTAAGCCGTCATTCCTGATTGTAAATCCGGGACAGACTCAGGGTATCCGCTTTGCGGGCTCCCCGCTGGGTCATGAATTCACCTCACTGGTGTTAGCACTGTTACAAGTCGGCGGTCATCCGTCGAAAGAAGCACAGGAATTACTGGATCAGGTGCGTAATCTGGAAGGTGAATTCCATTTTGAGACCTACTATTCACTGTCATGCCATAACTGCCCGGATGTGGTGCAGGCACTGAATCTGATGGCGGTGCTTAATCCGGATATCACACACACGGCCATTGACGGCGGTCTGTTTCAGAATGAGATCACCGAACGCAATATCATGGGCGTGCCGGCGGTTTTCCTGAATGGTAACGAGTTTGGTCAGGGCCGTATGACACTGGCGGAAATCGTCAATAAAATGGACAGCAATGCCGGTAAACGGGCAGCTGACGCTCTGAATCAGCAGGCGCCGTATGAAGTGCTGATTGTCGGCAGCGGCCCTGCCGGGGCATCCGCTGCCGTGTATGCCGCCCGTAAAGGGATCCGTACCGGACTTATCGGTGAGCGTTTCGGCGGCCAGGTGCTGGATACCGTGGATATTGAAAACTATATCTCCGTGCCGAAAACCGAAGGCGCAAAACTGGCGGCGGCACTGAAAGTGCATGTGGAAGATTACACTGCAGATGTGATTGATAACCAGAGCATCACCGCACTGATCCCGGCCACAGAACAAGGCGGCCTGCATCAGTTACAGACCGCGTCCGGTGCGACCCTGAAAGCGCGCAGCGTCATTATCAGTACCGGTGCCCGCTGGCGTAACATGGGCGTTCCGGGCGAGCAGGAATACCGCACCAAAGGGGTGACTTACTGCCCGCACTGTGACGGCCCGCTGTTCAAAGGGAAATCTGTGGCAGTGATCGGCGGCGGTAACTCCGGCGCGGAAGCGGCTATCGACCTGGCCGGTGTGGTGGAACACGTCACCCTGCTGGAATTTGCCCCGGAACTGAAAGCCGATGCGGTGTTACAGCAGAAATTACGCAGCCTGGCAAACGTGGATATCATTGTGAATGCACAAACCACCGAAGTGCTCGGCGACGGCAGCAAAGTGACCGGCTTACAGTACAAAGATCGCGTATCCGGTGAGCTTCACACACTGACACTGGCCGGGATTTTCGTTCAGATTGGCCTGCTGCCGAATACGCAGTGGCTGAAAGGAACACTGGATCTGAACCCGATGGGTGAGATTGTGGTCGATGCCCGTAACGAAACCAGCATTAAAGGGGTGTACGGTGCCGGTGACTGTACCACCGTGCCGTACAAACAAATTATTATCGCGGCAGGCGAAGGGGCCAAAGCATCACTCAGTGCCTTTGATTACCTGATCCGCACCAGTACCAGAACCGCTGAATAGTCCGCTGTTCAGTTGTTGTACCCAAAGGCATCCGGGGGCGGATGCCTTTT